turbo dnasei  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Name:
    DNase I
    Description:
    DNase I Deoxyribonuclease I digests single and double stranded DNA to oligodeoxyribonucleotides containing a 5 phosphate Ribonuclease has been reduced to non detectable levels ApplicationsDNase I is suitable for removing DNA from protein preparations nick translating DNA and generating random fragments for dideoxy sequencing NOTE for removing DNA from RNA preparations use Amplification Grade DNase I Cat No 18068 015 SourceDNase I is purified from bovine pancreas Specific activityThe specific activity of DNase I is typically in the range of 10 000 25 000 units mg
    Catalog Number:
    18047019
    Price:
    None
    Category:
    Proteins Enzymes Peptides
    Applications:
    PCR & Real-Time PCR|Reverse Transcription
    Buy from Supplier


    Structured Review

    Thermo Fisher turbo dnasei
    DNase I Deoxyribonuclease I digests single and double stranded DNA to oligodeoxyribonucleotides containing a 5 phosphate Ribonuclease has been reduced to non detectable levels ApplicationsDNase I is suitable for removing DNA from protein preparations nick translating DNA and generating random fragments for dideoxy sequencing NOTE for removing DNA from RNA preparations use Amplification Grade DNase I Cat No 18068 015 SourceDNase I is purified from bovine pancreas Specific activityThe specific activity of DNase I is typically in the range of 10 000 25 000 units mg
    https://www.bioz.com/result/turbo dnasei/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    turbo dnasei - by Bioz Stars, 2021-04
    97/100 stars

    Images

    Related Articles

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: The NRG1 gene is frequently silenced by methylation in breast cancers and is a strong candidate for the 8p tumour suppressor gene
    Article Snippet: Purified luminal and myoepithelial cells were prepared from primary cultures initiated from organoids that had been trypsinised and fractionated using antibodies and magnetic bead technology ( ). .. RT-PCR RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA), treated with DNaseI (DNA-free kit, Ambion Division, Applied Biosystems, Foster City, CA) to remove genomic DNA, and was reverse-transcribed using oligo-dT primers and Superscript III (Invitrogen). .. Real-time RT-PCR for NRG1 exons 4 to 6 was performed using primers HrgPCRE4F1 (CATTAACAAAGCATCACTGGCT) and hrg3_6R1 (TGAAGAAGTATTTGCTCCTT); primers for exon 8 were HRGE8F1, CTACATCTACATCCACCACTGG and HRGE8R2, TTGCACAAGTATCTCGAGGGGT (chr8:32705009+32705138).

    Purification:

    Article Title: Basic Residues in the Foamy Virus Gag Protein ▿Basic Residues in the Foamy Virus Gag Protein ▿ †
    Article Snippet: After specificity control by melting point analysis, the sample nucleic acid content was calculated with the iCycler iQ Optical System software, version 3.1 (Bio-Rad). .. Partially purified PFV from 20 ml of supernatant of transiently transfected HEK 293T cells, resolved in 200 μl of PBS, was treated with 4 U of DNase I (Fermentas) at 37°C overnight to eliminate remaining plasmid contamination. ..

    Transfection:

    Article Title: Basic Residues in the Foamy Virus Gag Protein ▿Basic Residues in the Foamy Virus Gag Protein ▿ †
    Article Snippet: After specificity control by melting point analysis, the sample nucleic acid content was calculated with the iCycler iQ Optical System software, version 3.1 (Bio-Rad). .. Partially purified PFV from 20 ml of supernatant of transiently transfected HEK 293T cells, resolved in 200 μl of PBS, was treated with 4 U of DNase I (Fermentas) at 37°C overnight to eliminate remaining plasmid contamination. ..

    Plasmid Preparation:

    Article Title: Basic Residues in the Foamy Virus Gag Protein ▿Basic Residues in the Foamy Virus Gag Protein ▿ †
    Article Snippet: After specificity control by melting point analysis, the sample nucleic acid content was calculated with the iCycler iQ Optical System software, version 3.1 (Bio-Rad). .. Partially purified PFV from 20 ml of supernatant of transiently transfected HEK 293T cells, resolved in 200 μl of PBS, was treated with 4 U of DNase I (Fermentas) at 37°C overnight to eliminate remaining plasmid contamination. ..

    Amplification:

    Article Title: Allele-specific long-distance regulation dictates IL-32 isoform switching and mediates susceptibility to HIV-1
    Article Snippet: cDNA analysis Total cellular RNA was isolated from the different cell lines with TriPure Isolation Reagent according to the manufacturer’s instructions (Roche Diagnostics). .. Subsequent DNase I digestion was performed with amplification grade DNase I (Invitrogen). .. The reverse-transcriptase reaction was performed using SuperScript II RNase H reverse transcriptase (Invitrogen) according to the manufacturer’s instructions.

    Quantitative RT-PCR:

    Article Title: TRIM17 and TRIM28 antagonistically regulate the ubiquitination and anti-apoptotic activity of BCL2A1
    Article Snippet: Secondary amplification using overhang sequences and Illumina MISeq sequencing was done as previously described [ ]. .. RNA preparation and real-time quantitative RT-PCR Total RNA was extracted using the RNAqueous® kit (Ambion) and treated with DNase I from the DNA-free™ kit (Ambion) according to manufacturer’s instructions. .. RNA was used to perform a two-step reverse-transcription polymerase chain reaction (RT-PCR) as previously described [ ].

    Incubation:

    Article Title: Neisseria Prophage Repressor Implicated in Gonococcal Pathogenesis
    Article Snippet: The footprinting assay was carried out in a 50-μl reaction volume in which the PCR product (2,000 ng) was added to the binding buffer used for EMSA with 1 μg poly(dI-dC) and various concentrations of the Npr. .. After 30 min of incubation at room temperature, 2 U of DNase I (Ambion, Applied Biosystems) was added, and DNA digestion was carried out at 37°C for 2 min or 3 min. ..

    Immunoprecipitation:

    Article Title: SOX2 regulates common and specific stem cell features in the CNS and endoderm derived organs
    Article Snippet: .. To establish DNA dependency of the protein-protein interactions 100U/ml DNase I (Invitrogen) was added to the lysate for 30 min at 4°C before immunoprecipitation. .. SOX2 binding sites are shared more within germ layers than between them. ( A ) Percentage of iI67+ cells that are SOX2+ in the E11.5 cortex, spinal cord, stomach and lung/esophagus. ( B ) FACS plots of SOX2+ cells (encircled) sorted from dissected E11.5 SOX2-GFP cortices, spinal cords, stomachs and lung/esophagus. ( C ) Seqminer heat maps showing raw reads from all SOX2 ChIP-seqs (singlets or merged replicates) within peaks called from cortex, spinal cord, stomach or lung/esophagus SOX2 ChIP-seqs and the corresponding percentage of peaks bound in all tissues based on clustering. ( D ) The average proportion of SOX2 ChIP-seq reads derived from cortex, spinal cord, stomach and lung/esophagus experiments within the different SOX2 peak sets. (TIF) (3.0M, tif)

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Thermo Fisher turbo dna free dnasei kit
    Turbo Dna Free Dnasei Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/turbo dna free dnasei kit/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    turbo dna free dnasei kit - by Bioz Stars, 2021-04
    97/100 stars
      Buy from Supplier

    99
    Thermo Fisher turbo dnase 2 u µl
    Turbo Dnase 2 U µl, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/turbo dnase 2 u µl/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    turbo dnase 2 u µl - by Bioz Stars, 2021-04
    99/100 stars
      Buy from Supplier

    97
    Thermo Fisher turbo dnasei
    Turbo Dnasei, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/turbo dnasei/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    turbo dnasei - by Bioz Stars, 2021-04
    97/100 stars
      Buy from Supplier

    Image Search Results