truchip chromatin shearing kit  (Covaris)

Bioz Verified Symbol Covaris is a verified supplier
Bioz Manufacturer Symbol Covaris manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    truChIP Chromatin Shearing Tissue Kit
    The truChIP Chromatin Shearing Tissue Kit with Formaldehyde is designed and optimized for the efficient and reproducible shearing of chromatin from tissues 20 120mg using the Covaris Adaptive Focused Acoustics AFA technology
    Catalog Number:
    Product Aliases:
    Buy from Supplier

    Structured Review

    Covaris truchip chromatin shearing kit
    truChIP Chromatin Shearing Tissue Kit
    The truChIP Chromatin Shearing Tissue Kit with Formaldehyde is designed and optimized for the efficient and reproducible shearing of chromatin from tissues 20 120mg using the Covaris Adaptive Focused Acoustics AFA technology chromatin shearing kit/product/Covaris
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    truchip chromatin shearing kit - by Bioz Stars, 2019-10
    99/100 stars

    Related Products / Commonly Used Together

    truchip chromatin shearing kit Covaris
    s2 adaptive Covaris


    Related Articles


    Article Title: Zfx facilitates tumorigenesis caused by activation of the Hedgehog pathway
    Article Snippet: RNA for microarray analysis of DAOY human MB cells after ZFX knockdown was obtained 4 days after lentiviral transduction from one culture replicate for each of the ZFX-targeting shRNA constructs (H2, H3, H4) and non-targeting “scrambled” control (SCR). .. Sonication-sheared chromatin from DAOY human MB cells was generated and isolated using Covaris truChIP High Cell Chromatin Shearing Kit with SDS Buffer and S2 Sonicator.

    Methylation Sequencing:

    Article Title: Atopic asthma after rhinovirus‐induced wheezing is associated with DNA methylation change in the SMAD3 gene promoter, et al. Atopic asthma after rhinovirus‐induced wheezing is associated with DNA methylation change in the SMAD3 gene promoter
    Article Snippet: The reduced representation bisulfite sequencing (RRBS) libraries were prepared with a protocol adapted from Boyle et al. , For genomic localization of promoters and enhancers H3K4me1, H3K4me3 and H3K27Ac ChIP‐seq was carried out from peripheral blood mononuclear cells isolated from 2 reference individuals. .. Briefly, the chromatin was prepared (truChIP Low Cell Chromatin Kit, Covaris) and ChIP reactions (Auto Histone ChIP‐seq kit) were carried out with Diagenode IP‐Star SX 8G robot.


    Article Title: Intestinal, but not hepatic, ChREBP is required for fructose tolerance
    Article Snippet: Chromatin was isolated using a truChIP Chromatin Shearing Tissue Kit (Covaris) according to the manufacturer’s protocol, with modifications. .. Chromatin was isolated using a truChIP Chromatin Shearing Tissue Kit (Covaris) according to the manufacturer’s protocol, with modifications.


    Article Title: A PERK-miR211 axis suppresses circadian regulators and protein synthesis to promote cancer cell survival
    Article Snippet: Wild type miR-211 (5′UUCCCUUUGUCAUCCUUUGCCU3′Biotin) and mutant miR-211 5′UUUGUCGAGUCAUCCUUUGCCU3′Biotin) oligos were synthesized from Integrated DNA Technologies (Iowa, US) and transfected into U2OS cell via lipofectamine 2000 (ThermoFisher Scientific, WA). .. Chromatin was prepared using the truChIP low cell chromatin shearing kit (Covaris) and sheared 200–700 bp fragments.


    Article Title: A Novel t(8;14)(q24;q11) Rearranged Human Cell Line as a Model for Mechanistic and Drug Discovery Studies of NOTCH1-Independent Human T-Cell Leukemia
    Article Snippet: Immunoblot analysis: Total cell lysates were prepared using RadioImmunoprecipitation Assay (RIPA) lysis buffer supplemented with phosphatase inhibitor cocktail set I and II (Sigma) and protease inhibitor cocktail tablets (Roche) and normalized for protein concentration using the Bicinchoninic Acid (BCA) method (Pierce, Pero, Italy). .. Nuclei were isolated and chromatin was purified by chemical lysis (truChIP Chromatin Shearing Reagent KIT, Covaris, Woburn, MA, USA) and processed as previously described [ ].

    Quantitative RT-PCR:

    Article Title: ZFX controls propagation and prevents differentiation of acute T-lymphoblastic and myeloid leukemia
    Article Snippet: Quantitative RT–PCR analysis was performed using open reading frame-specific primers (sequences available upon request) and the ΔΔCT method as described ( ). .. For ChIP, nuclei from 107 formaldehyde-fixed NOMO-1 and RPMI-8402 cells were isolated, lysed and ultrasonically sheared using the TRUChIP High Cell Chromatin Shearing Kit (Covaris).

    Article Title: Nrf1 and Nrf2 Transcription Factors Regulate Androgen Receptor Transactivation in Prostate Cancer Cells
    Article Snippet: Briefly, DHT treated (6 hrs) LNCaP and C4-2B cells were sheared using the Covaris truChIP kit using an E220 focused-ultrasonicator from Covaris. .. Briefly, DHT treated (6 hrs) LNCaP and C4-2B cells were sheared using the Covaris truChIP kit using an E220 focused-ultrasonicator from Covaris.

    Real-time Polymerase Chain Reaction:

    Article Title: Regulation of Age-associated B cells by IRF5 in systemic autoimmunity
    Article Snippet: CD23+ B cells were purified and stimulated in vitro for 48 h. After harvesting, the cells were cross-linked with formaldehyde, and chromatin extracts were prepared using the truChIP Chromatin Shearing Reagent Kit (Covaris) according to manufacturer instructions. .. The DNA–protein complexes were immunoprecipitated with an anti-IRF5 (Abcam, ab21689) or anti-T-bet (Santa Cruz; sc-21749X) specific antibody or a control antibody.

    Article Title: Zfx facilitates tumorigenesis caused by activation of the Hedgehog pathway
    Article Snippet: Sonication-sheared chromatin from DAOY human MB cells was generated and isolated using Covaris truChIP High Cell Chromatin Shearing Kit with SDS Buffer and S2 Sonicator. .. Sonication-sheared chromatin from DAOY human MB cells was generated and isolated using Covaris truChIP High Cell Chromatin Shearing Kit with SDS Buffer and S2 Sonicator.

    Article Title: Tcf1 and Lef1 transcription factors establish CD8+ T cell identity through intrinsic HDAC activity
    Article Snippet: Paragraph title: ChIP and quantitative PCR ... WT CD4+ or CD8+ , Tcf7 −/− Lef1 −/− CD8+ mature thymocytes or splenic CD8+ T cells were sorted and cross-linked with 1% formaldehyde in medium for 5 minutes, processed using truChIP Chromatin Shearing Reagent Kit (Covaris), and sonicated for 5 minutes on Covaris S2 ultrasonicator.

    Article Title: PRMT5 is required for lymphomagenesis triggered by multiple oncogenic drivers
    Article Snippet: Chromatin was prepared using truChIP Low Cell Chromatin Shearing Kit (Covaris) and sheared into 200–700 bp fragments using a Covaris S2 instrument (duty cycle, 2%; intensity, 3; 200 cycles per burst; 4 min). .. Chromatin was prepared using truChIP Low Cell Chromatin Shearing Kit (Covaris) and sheared into 200–700 bp fragments using a Covaris S2 instrument (duty cycle, 2%; intensity, 3; 200 cycles per burst; 4 min).

    Article Title: Prox1 and fibroblast growth factor receptors form a novel regulatory loop controlling lens fiber differentiation and gene expression
    Article Snippet: Nuclei were extracted and processed using the truChIP Chromatin Shearing Kit (Covaris) and chromatin sheared using a Covaris S2 adaptive focused acoustic disrupter. .. ChIP was carried out using 100 µg chromatin per sample, pulling down with 1 µl anti-Prox1 ( ).


    Article Title: Alteration of Gene Expression, DNA Methylation, and Histone Methylation in Free Radical Scavenging Networks in Adult Mouse Hippocampus following Fetal Alcohol Exposure
    Article Snippet: Hippocampal tissue samples were thawed on ice then treated with 1% formaldehyde for five minutes and sonicated with the truChIPTM Tissue Prep Kit for SDS Chromatin Shearing (Covaris) and the Covaris® S2 Sonicator (Woburn, MA, USA) according to the manufacturer’s protocol. .. After sonication, samples were divided and immunoprecipitated with ChIP-grade polyclonal antibodies anti-H3K4me3 (Epigentek cat # A-4033) and anti-H3K27me3 (Millipore cat #07–499).

    Article Title: ZFX controls propagation and prevents differentiation of acute T-lymphoblastic and myeloid leukemia
    Article Snippet: Microarray hybridization, scanning and data extraction using the Expression Console software package was according to the manufacturer's instructions. .. For ChIP, nuclei from 107 formaldehyde-fixed NOMO-1 and RPMI-8402 cells were isolated, lysed and ultrasonically sheared using the TRUChIP High Cell Chromatin Shearing Kit (Covaris).

    Article Title: Zfx facilitates tumorigenesis caused by activation of the Hedgehog pathway
    Article Snippet: Paragraph title: Expression analysis, microarray, and ChIP-seq ... Sonication-sheared chromatin from DAOY human MB cells was generated and isolated using Covaris truChIP High Cell Chromatin Shearing Kit with SDS Buffer and S2 Sonicator.


    Article Title: JunB defines functional and structural integrity of the epidermo-pilosebaceous unit in the skin
    Article Snippet: Briefly, 10 × 106 epidermal progenitor cells were subjected to fixation, nuclei preparation and chromatin fragmentation using truChIP Chromatin Shearing Kit (Covaris). .. Briefly, 10 × 106 epidermal progenitor cells were subjected to fixation, nuclei preparation and chromatin fragmentation using truChIP Chromatin Shearing Kit (Covaris).

    Article Title: Intestinal, but not hepatic, ChREBP is required for fructose tolerance
    Article Snippet: Chromatin was isolated using a truChIP Chromatin Shearing Tissue Kit (Covaris) according to the manufacturer’s protocol, with modifications. .. Chromatin was isolated using a truChIP Chromatin Shearing Tissue Kit (Covaris) according to the manufacturer’s protocol, with modifications.

    Article Title: Site-Specific Association with Host and Viral Chromatin by Kaposi's Sarcoma-Associated Herpesvirus LANA and Its Reversal during Lytic Reactivation
    Article Snippet: Nucleus preparations were done using a truChIP High Cell Chromatin Shearing Kit with SDS from Covaris, and chromatin was sheared with a Covaris E220 Ultrasonicator. .. The average size of chromatin fragments was either ∼200 bp or ∼600 bp for ChIP-seq or ChIP with quantitative PCR (ChIP-qPCR) assays, respectively.

    Article Title: Systems-level identification of PKA-dependent signaling in epithelial cells
    Article Snippet: After treatment with dDAVP (0.1 nM) or vehicle for 24 h, cells were processed for ChIP using the truChIP Chromatin Shearing Reagent Kit (Covaris) following the manufacturer’s protocol. .. Sheared chromatin was used as input control and anti-rabbit IgG was used as negative control in immunoprecipitation.


    Article Title: ZFX controls propagation and prevents differentiation of acute T-lymphoblastic and myeloid leukemia
    Article Snippet: Paragraph title: Expression analysis and ChIP ... For ChIP, nuclei from 107 formaldehyde-fixed NOMO-1 and RPMI-8402 cells were isolated, lysed and ultrasonically sheared using the TRUChIP High Cell Chromatin Shearing Kit (Covaris).

    Article Title: Zfx facilitates tumorigenesis caused by activation of the Hedgehog pathway
    Article Snippet: Paragraph title: Expression analysis, microarray, and ChIP-seq ... Sonication-sheared chromatin from DAOY human MB cells was generated and isolated using Covaris truChIP High Cell Chromatin Shearing Kit with SDS Buffer and S2 Sonicator.

    Genome Wide:

    Article Title: ZFX controls propagation and prevents differentiation of acute T-lymphoblastic and myeloid leukemia
    Article Snippet: Genome-wide expression analysis was done using Mouse Gene 1.0 ST microarrays (Affymetrix). .. For ChIP, nuclei from 107 formaldehyde-fixed NOMO-1 and RPMI-8402 cells were isolated, lysed and ultrasonically sheared using the TRUChIP High Cell Chromatin Shearing Kit (Covaris).

    Western Blot:

    Article Title: A Novel t(8;14)(q24;q11) Rearranged Human Cell Line as a Model for Mechanistic and Drug Discovery Studies of NOTCH1-Independent Human T-Cell Leukemia
    Article Snippet: For Western blotting, protein samples were separated on 4–12% gradient Tris–glycine SDS-PAGE (Invitrogen) and transferred to PVDF membrane (Millipore, Burlington, MA, USA). .. Nuclei were isolated and chromatin was purified by chemical lysis (truChIP Chromatin Shearing Reagent KIT, Covaris, Woburn, MA, USA) and processed as previously described [ ].

    Article Title: PRMT5 is required for lymphomagenesis triggered by multiple oncogenic drivers
    Article Snippet: Paragraph title: Western Blot and Chromatin Immunoprecipitation (CHIP) ... Chromatin was prepared using truChIP Low Cell Chromatin Shearing Kit (Covaris) and sheared into 200–700 bp fragments using a Covaris S2 instrument (duty cycle, 2%; intensity, 3; 200 cycles per burst; 4 min).


    Article Title: ZFX controls propagation and prevents differentiation of acute T-lymphoblastic and myeloid leukemia
    Article Snippet: Microarray hybridization, scanning and data extraction using the Expression Console software package was according to the manufacturer's instructions. .. For ChIP, nuclei from 107 formaldehyde-fixed NOMO-1 and RPMI-8402 cells were isolated, lysed and ultrasonically sheared using the TRUChIP High Cell Chromatin Shearing Kit (Covaris).


    Article Title: A PERK-miR211 axis suppresses circadian regulators and protein synthesis to promote cancer cell survival
    Article Snippet: Wild type miR-211 (5′UUCCCUUUGUCAUCCUUUGCCU3′Biotin) and mutant miR-211 5′UUUGUCGAGUCAUCCUUUGCCU3′Biotin) oligos were synthesized from Integrated DNA Technologies (Iowa, US) and transfected into U2OS cell via lipofectamine 2000 (ThermoFisher Scientific, WA). .. Chromatin was prepared using the truChIP low cell chromatin shearing kit (Covaris) and sheared 200–700 bp fragments.

    Article Title: T Cell Receptor-induced Nuclear Factor κB (NF-κB) Signaling and Transcriptional Activation Are Regulated by STIM1- and Orai1-mediated Calcium Entry
    Article Snippet: Jurkat T cells (10 × 106 ) transfected with either EGFP-shPKCα or control EGFP-pCMS2 vector (48 h) were stimulated with PMA (200 n m ) and ionomycin (1 μ m ) for 30 min at 37 °C. .. Chromatin was prepared using a Covaris truChIP chromatin shearing kit (Covaris Inc., Woburn, MA).


    Article Title: Alteration of Gene Expression, DNA Methylation, and Histone Methylation in Free Radical Scavenging Networks in Adult Mouse Hippocampus following Fetal Alcohol Exposure
    Article Snippet: Hippocampal tissue samples were thawed on ice then treated with 1% formaldehyde for five minutes and sonicated with the truChIPTM Tissue Prep Kit for SDS Chromatin Shearing (Covaris) and the Covaris® S2 Sonicator (Woburn, MA, USA) according to the manufacturer’s protocol. .. Hippocampal tissue samples were thawed on ice then treated with 1% formaldehyde for five minutes and sonicated with the truChIPTM Tissue Prep Kit for SDS Chromatin Shearing (Covaris) and the Covaris® S2 Sonicator (Woburn, MA, USA) according to the manufacturer’s protocol.

    Article Title: Loss of pyruvate kinase M2 limits growth and triggers innate immune signaling in endothelial cells
    Article Snippet: ChIP was performed using the truChIP Chromatin Shearing Reagent kit (Covaris) according to the manufacturer’s instructions. .. ChIP was performed using the truChIP Chromatin Shearing Reagent kit (Covaris) according to the manufacturer’s instructions.

    Article Title: ZFX controls propagation and prevents differentiation of acute T-lymphoblastic and myeloid leukemia
    Article Snippet: For ChIP, nuclei from 107 formaldehyde-fixed NOMO-1 and RPMI-8402 cells were isolated, lysed and ultrasonically sheared using the TRUChIP High Cell Chromatin Shearing Kit (Covaris). .. ChIP was performed using anti-ZFX rabbit polyclonal antibody or non-specific rabbit IgG as described ( ).

    Article Title: Nrf1 and Nrf2 Transcription Factors Regulate Androgen Receptor Transactivation in Prostate Cancer Cells
    Article Snippet: For chromatin immunoprecipitation (ChIP) assays we used two different kits, the Covaris (Woburn, MA) truChIP chromatin shearing kit with non-ionic buffer and the Active Motif (Carlsbad, CA) ChIP-IT High Sensitivity kit. .. The chromatin samples were diluted in ChIP buffer from the Active Motif kit.

    Article Title: Site-Specific Association with Host and Viral Chromatin by Kaposi's Sarcoma-Associated Herpesvirus LANA and Its Reversal during Lytic Reactivation
    Article Snippet: Nucleus preparations were done using a truChIP High Cell Chromatin Shearing Kit with SDS from Covaris, and chromatin was sheared with a Covaris E220 Ultrasonicator. .. The following antibodies were used for ChIP: rat anti-LANA (13-210-100; Advanced Biotechnologies), anti-histone H3 trimethylated at K4 (H3K4me3) (ab8580; Abcam), anti-H3K27me3 (07-449; Millipore), anti-H3K36me3 (ab9050; Abcam), and anti-polymerase II (Pol II) (sc-899X; Santa Cruz Biotechnology).

    Article Title: Systems-level identification of PKA-dependent signaling in epithelial cells
    Article Snippet: After treatment with dDAVP (0.1 nM) or vehicle for 24 h, cells were processed for ChIP using the truChIP Chromatin Shearing Reagent Kit (Covaris) following the manufacturer’s protocol. .. After treatment with dDAVP (0.1 nM) or vehicle for 24 h, cells were processed for ChIP using the truChIP Chromatin Shearing Reagent Kit (Covaris) following the manufacturer’s protocol.

    Article Title: LEF-1 and TCF-1 orchestrate T follicular helper cell differentiation by regulating differentiation circuits upstream of Bcl6
    Article Snippet: Sorted CD4+ T cells were cross-linked with 1% formaldehyde in medium for 5 minutes, processed using truChIP Chromatin Shearing Reagent Kit (Covaris), and sonicated for 5 minutes on Covaris S2 ultrasonicator. .. The sheared chromatin was immunoprecipitated with anti-TCF-1 (C46C7, Cell Signaling Technologies) or control rabbit IgG and washed as previously described.

    Protease Inhibitor:

    Article Title: A Novel t(8;14)(q24;q11) Rearranged Human Cell Line as a Model for Mechanistic and Drug Discovery Studies of NOTCH1-Independent Human T-Cell Leukemia
    Article Snippet: Immunoblot analysis: Total cell lysates were prepared using RadioImmunoprecipitation Assay (RIPA) lysis buffer supplemented with phosphatase inhibitor cocktail set I and II (Sigma) and protease inhibitor cocktail tablets (Roche) and normalized for protein concentration using the Bicinchoninic Acid (BCA) method (Pierce, Pero, Italy). .. Nuclei were isolated and chromatin was purified by chemical lysis (truChIP Chromatin Shearing Reagent KIT, Covaris, Woburn, MA, USA) and processed as previously described [ ].

    Magnetic Beads:

    Article Title: JunB defines functional and structural integrity of the epidermo-pilosebaceous unit in the skin
    Article Snippet: Briefly, 10 × 106 epidermal progenitor cells were subjected to fixation, nuclei preparation and chromatin fragmentation using truChIP Chromatin Shearing Kit (Covaris). .. Briefly, 10 × 106 epidermal progenitor cells were subjected to fixation, nuclei preparation and chromatin fragmentation using truChIP Chromatin Shearing Kit (Covaris).


    Article Title: Zfx facilitates tumorigenesis caused by activation of the Hedgehog pathway
    Article Snippet: Pattern-matching genes following expression profile of Zfx were identified using NIA Array ( ). .. Sonication-sheared chromatin from DAOY human MB cells was generated and isolated using Covaris truChIP High Cell Chromatin Shearing Kit with SDS Buffer and S2 Sonicator. .. ZFX ChIP was performed using rabbit polyclonal antibody ( ) and Protein A Dynabeads (invitrogen), and unprobed sheared chromatin was used as a control (Input).

    Article Title: A PERK-miR211 axis suppresses circadian regulators and protein synthesis to promote cancer cell survival
    Article Snippet: Biotin labeled miR-211 duplexes were generated as previously reported . .. Chromatin was prepared using the truChIP low cell chromatin shearing kit (Covaris) and sheared 200–700 bp fragments.

    Polymerase Chain Reaction:

    Article Title: Loss of pyruvate kinase M2 limits growth and triggers innate immune signaling in endothelial cells
    Article Snippet: ChIP was performed using the truChIP Chromatin Shearing Reagent kit (Covaris) according to the manufacturer’s instructions. .. Immunoprecipitation was performed following a published protocol using the following antibodies: Mouse IgG (2 μg/IP, 5441S, Cell Signaling) and Histone H3 (tri methyl K9) (2 μg/IP, ab8898, Abcam).

    Article Title: Tcf1 and Lef1 transcription factors establish CD8+ T cell identity through intrinsic HDAC activity
    Article Snippet: WT CD4+ or CD8+ , Tcf7 −/− Lef1 −/− CD8+ mature thymocytes or splenic CD8+ T cells were sorted and cross-linked with 1% formaldehyde in medium for 5 minutes, processed using truChIP Chromatin Shearing Reagent Kit (Covaris), and sonicated for 5 minutes on Covaris S2 ultrasonicator. .. WT CD4+ or CD8+ , Tcf7 −/− Lef1 −/− CD8+ mature thymocytes or splenic CD8+ T cells were sorted and cross-linked with 1% formaldehyde in medium for 5 minutes, processed using truChIP Chromatin Shearing Reagent Kit (Covaris), and sonicated for 5 minutes on Covaris S2 ultrasonicator.

    Article Title: LEF-1 and TCF-1 orchestrate T follicular helper cell differentiation by regulating differentiation circuits upstream of Bcl6
    Article Snippet: Sorted CD4+ T cells were cross-linked with 1% formaldehyde in medium for 5 minutes, processed using truChIP Chromatin Shearing Reagent Kit (Covaris), and sonicated for 5 minutes on Covaris S2 ultrasonicator. .. The sheared chromatin was immunoprecipitated with anti-TCF-1 (C46C7, Cell Signaling Technologies) or control rabbit IgG and washed as previously described.

    Protein Concentration:

    Article Title: A Novel t(8;14)(q24;q11) Rearranged Human Cell Line as a Model for Mechanistic and Drug Discovery Studies of NOTCH1-Independent Human T-Cell Leukemia
    Article Snippet: Immunoblot analysis: Total cell lysates were prepared using RadioImmunoprecipitation Assay (RIPA) lysis buffer supplemented with phosphatase inhibitor cocktail set I and II (Sigma) and protease inhibitor cocktail tablets (Roche) and normalized for protein concentration using the Bicinchoninic Acid (BCA) method (Pierce, Pero, Italy). .. Nuclei were isolated and chromatin was purified by chemical lysis (truChIP Chromatin Shearing Reagent KIT, Covaris, Woburn, MA, USA) and processed as previously described [ ].


    Article Title: ZFX controls propagation and prevents differentiation of acute T-lymphoblastic and myeloid leukemia
    Article Snippet: For ChIP, nuclei from 107 formaldehyde-fixed NOMO-1 and RPMI-8402 cells were isolated, lysed and ultrasonically sheared using the TRUChIP High Cell Chromatin Shearing Kit (Covaris). .. After eluting the sheared immunoprecipitated chromatin, crosslinking were reversed and DNA was recovered by phenol-chloroform extraction.

    Article Title: Zfx facilitates tumorigenesis caused by activation of the Hedgehog pathway
    Article Snippet: Sonication-sheared chromatin from DAOY human MB cells was generated and isolated using Covaris truChIP High Cell Chromatin Shearing Kit with SDS Buffer and S2 Sonicator. .. Sonication-sheared chromatin from DAOY human MB cells was generated and isolated using Covaris truChIP High Cell Chromatin Shearing Kit with SDS Buffer and S2 Sonicator.


    Article Title: Intestinal, but not hepatic, ChREBP is required for fructose tolerance
    Article Snippet: Chromatin was isolated using a truChIP Chromatin Shearing Tissue Kit (Covaris) according to the manufacturer’s protocol, with modifications. .. Cross-linked tissue was dounce homogenized in Lysis Buffer with protease inhibitors, incubated for 20 minutes at 4°C with periodic vortexing, and crude nuclei were collected by centrifugation at 1,700 g and washed in Wash Buffer twice.

    Article Title: Alteration of Gene Expression, DNA Methylation, and Histone Methylation in Free Radical Scavenging Networks in Adult Mouse Hippocampus following Fetal Alcohol Exposure
    Article Snippet: The custom primers assayed CpGs at the following positions (mm10): Acaa1 : chr9:119342321, chr9:119342332, chr9:119342352, chr9:119342366, chr9:119342378, chr9:119342386; Pxmp1 : 110285970, chr5110285964, chr5110285959, chr5110285948, chr5110285944, chr5110285940, chr5110285908, chr5110285878; Pex6 : chr17:46706646, chr17:46706654, chr17:46706661, chr17:46706672, chr17:46706678, chr17:46706691, chr17:46706698, chr17:46706715; Mafg : chr11:120625270, chr11:120625264, chr11:120625261, chr11:120625225, chr11:120625205, chr11:120625131; Tcf7l2 : chr19:55745017, chr19:55745023. .. Hippocampal tissue samples were thawed on ice then treated with 1% formaldehyde for five minutes and sonicated with the truChIPTM Tissue Prep Kit for SDS Chromatin Shearing (Covaris) and the Covaris® S2 Sonicator (Woburn, MA, USA) according to the manufacturer’s protocol. .. The EpiQuik™ Tissue Chromatin Immunoprecipitation Kit (Epigentek) was used to perform ChIP.

    Article Title: Zfx facilitates tumorigenesis caused by activation of the Hedgehog pathway
    Article Snippet: Pattern-matching genes following expression profile of Zfx were identified using NIA Array ( ). .. Sonication-sheared chromatin from DAOY human MB cells was generated and isolated using Covaris truChIP High Cell Chromatin Shearing Kit with SDS Buffer and S2 Sonicator. .. ZFX ChIP was performed using rabbit polyclonal antibody ( ) and Protein A Dynabeads (invitrogen), and unprobed sheared chromatin was used as a control (Input).

    Article Title: Tcf1 and Lef1 transcription factors establish CD8+ T cell identity through intrinsic HDAC activity
    Article Snippet: UCSC genes from the iGenome mouse mm9 assembly ( ) were used for gene annotation. .. WT CD4+ or CD8+ , Tcf7 −/− Lef1 −/− CD8+ mature thymocytes or splenic CD8+ T cells were sorted and cross-linked with 1% formaldehyde in medium for 5 minutes, processed using truChIP Chromatin Shearing Reagent Kit (Covaris), and sonicated for 5 minutes on Covaris S2 ultrasonicator. .. The resulting sheared chromatin fragments were in 200–500 bp range and were immunoprecipitated with anti-H3K4me3 (Millipore, 17–614), H3K9Ac (Abcam, ab4441), H3K27me3 (Millipore, 17–622), H3K27Ac (Abcam, ab4729), or control IgG and washed as previously described .

    Article Title: Restoring Tip60 HAT/HDAC2 Balance in the Neurodegenerative Brain Relieves Epigenetic Transcriptional Repression and Reinstates Cognition
    Article Snippet: Chromatin was extracted and sheared from mice hippocampus and liver using truChIP Chromatin Shearing Kit from Covaris following the manufacturer's instructions. .. Cells were lysed and nuclei were prepared using Covaris lysis buffer.

    Article Title: LEF-1 and TCF-1 orchestrate T follicular helper cell differentiation by regulating differentiation circuits upstream of Bcl6
    Article Snippet: Enrichment of genes, which were upregulated in Lef1 -RV+ Th1 cells in comparison to GFP-RV+ TH 1 cells by more than 1.2-fold, was then ranked by the Diff_of_Classes. .. Sorted CD4+ T cells were cross-linked with 1% formaldehyde in medium for 5 minutes, processed using truChIP Chromatin Shearing Reagent Kit (Covaris), and sonicated for 5 minutes on Covaris S2 ultrasonicator. .. The sheared chromatin was immunoprecipitated with anti-TCF-1 (C46C7, Cell Signaling Technologies) or control rabbit IgG and washed as previously described.

    Binding Assay:

    Article Title: LEF-1 and TCF-1 orchestrate T follicular helper cell differentiation by regulating differentiation circuits upstream of Bcl6
    Article Snippet: Sorted CD4+ T cells were cross-linked with 1% formaldehyde in medium for 5 minutes, processed using truChIP Chromatin Shearing Reagent Kit (Covaris), and sonicated for 5 minutes on Covaris S2 ultrasonicator. .. The immunoprecipitated DNA segments were used for PCR quantification.


    Article Title: Zfx facilitates tumorigenesis caused by activation of the Hedgehog pathway
    Article Snippet: Paragraph title: Expression analysis, microarray, and ChIP-seq ... Sonication-sheared chromatin from DAOY human MB cells was generated and isolated using Covaris truChIP High Cell Chromatin Shearing Kit with SDS Buffer and S2 Sonicator.

    Article Title: A Novel t(8;14)(q24;q11) Rearranged Human Cell Line as a Model for Mechanistic and Drug Discovery Studies of NOTCH1-Independent Human T-Cell Leukemia
    Article Snippet: H3K27ac chromatin immunoprecipitation sequencing (ChIP-seq): UP-ALL13 cells (2 × 107 ) were cross-linked with methanol-free formaldehyde (1% final concentration) at room temperature for 7 min and the cross-linking reaction was quenched with glycine (125 mM final concentration, Sigma-Aldrich). .. Nuclei were isolated and chromatin was purified by chemical lysis (truChIP Chromatin Shearing Reagent KIT, Covaris, Woburn, MA, USA) and processed as previously described [ ].

    Article Title: Systems-level identification of PKA-dependent signaling in epithelial cells
    Article Snippet: Paragraph title: ChIP-Seq Analysis for Acetylated Histone H3K27. ... After treatment with dDAVP (0.1 nM) or vehicle for 24 h, cells were processed for ChIP using the truChIP Chromatin Shearing Reagent Kit (Covaris) following the manufacturer’s protocol.

    Article Title: Atopic asthma after rhinovirus‐induced wheezing is associated with DNA methylation change in the SMAD3 gene promoter, et al. Atopic asthma after rhinovirus‐induced wheezing is associated with DNA methylation change in the SMAD3 gene promoter
    Article Snippet: The reduced representation bisulfite sequencing (RRBS) libraries were prepared with a protocol adapted from Boyle et al. , For genomic localization of promoters and enhancers H3K4me1, H3K4me3 and H3K27Ac ChIP‐seq was carried out from peripheral blood mononuclear cells isolated from 2 reference individuals. .. Briefly, the chromatin was prepared (truChIP Low Cell Chromatin Kit, Covaris) and ChIP reactions (Auto Histone ChIP‐seq kit) were carried out with Diagenode IP‐Star SX 8G robot. .. The libraries were sequenced with Illumina HiSeq2000 platform.

    Animal Model:

    Article Title: Restoring Tip60 HAT/HDAC2 Balance in the Neurodegenerative Brain Relieves Epigenetic Transcriptional Repression and Reinstates Cognition
    Article Snippet: Paragraph title: Animal model. ... Chromatin was extracted and sheared from mice hippocampus and liver using truChIP Chromatin Shearing Kit from Covaris following the manufacturer's instructions.

    RNA Sequencing Assay:

    Article Title: Atopic asthma after rhinovirus‐induced wheezing is associated with DNA methylation change in the SMAD3 gene promoter, et al. Atopic asthma after rhinovirus‐induced wheezing is associated with DNA methylation change in the SMAD3 gene promoter
    Article Snippet: The messenger RNA‐seq samples were prepared with Illumina TruSeq RNA Sample Preparation kit v2. .. Briefly, the chromatin was prepared (truChIP Low Cell Chromatin Kit, Covaris) and ChIP reactions (Auto Histone ChIP‐seq kit) were carried out with Diagenode IP‐Star SX 8G robot.


    Article Title: Alteration of Gene Expression, DNA Methylation, and Histone Methylation in Free Radical Scavenging Networks in Adult Mouse Hippocampus following Fetal Alcohol Exposure
    Article Snippet: Hippocampal tissue samples were thawed on ice then treated with 1% formaldehyde for five minutes and sonicated with the truChIPTM Tissue Prep Kit for SDS Chromatin Shearing (Covaris) and the Covaris® S2 Sonicator (Woburn, MA, USA) according to the manufacturer’s protocol. .. After sonication, samples were divided and immunoprecipitated with ChIP-grade polyclonal antibodies anti-H3K4me3 (Epigentek cat # A-4033) and anti-H3K27me3 (Millipore cat #07–499).

    Article Title: Atopic asthma after rhinovirus‐induced wheezing is associated with DNA methylation change in the SMAD3 gene promoter, et al. Atopic asthma after rhinovirus‐induced wheezing is associated with DNA methylation change in the SMAD3 gene promoter
    Article Snippet: Briefly, the chromatin was prepared (truChIP Low Cell Chromatin Kit, Covaris) and ChIP reactions (Auto Histone ChIP‐seq kit) were carried out with Diagenode IP‐Star SX 8G robot. .. Briefly, the chromatin was prepared (truChIP Low Cell Chromatin Kit, Covaris) and ChIP reactions (Auto Histone ChIP‐seq kit) were carried out with Diagenode IP‐Star SX 8G robot.


    Article Title: A PERK-miR211 axis suppresses circadian regulators and protein synthesis to promote cancer cell survival
    Article Snippet: Wild type miR-211 (5′UUCCCUUUGUCAUCCUUUGCCU3′Biotin) and mutant miR-211 5′UUUGUCGAGUCAUCCUUUGCCU3′Biotin) oligos were synthesized from Integrated DNA Technologies (Iowa, US) and transfected into U2OS cell via lipofectamine 2000 (ThermoFisher Scientific, WA). .. Chromatin was prepared using the truChIP low cell chromatin shearing kit (Covaris) and sheared 200–700 bp fragments.


    Article Title: Intestinal, but not hepatic, ChREBP is required for fructose tolerance
    Article Snippet: Each sample was run in duplicate, and normalized to Rplp0 RNA. .. Chromatin was isolated using a truChIP Chromatin Shearing Tissue Kit (Covaris) according to the manufacturer’s protocol, with modifications. .. Briefly, 30 mg of intestine was minced and cross-linked using 2 mM disuccinimidyl glutarate in PBS at room temperature for 45 minutes and washed with PBS.

    Article Title: ZFX controls propagation and prevents differentiation of acute T-lymphoblastic and myeloid leukemia
    Article Snippet: Quantitative RT–PCR analysis was performed using open reading frame-specific primers (sequences available upon request) and the ΔΔCT method as described ( ). .. For ChIP, nuclei from 107 formaldehyde-fixed NOMO-1 and RPMI-8402 cells were isolated, lysed and ultrasonically sheared using the TRUChIP High Cell Chromatin Shearing Kit (Covaris). .. ChIP was performed using anti-ZFX rabbit polyclonal antibody or non-specific rabbit IgG as described ( ).

    Article Title: Zfx facilitates tumorigenesis caused by activation of the Hedgehog pathway
    Article Snippet: Pattern-matching genes following expression profile of Zfx were identified using NIA Array ( ). .. Sonication-sheared chromatin from DAOY human MB cells was generated and isolated using Covaris truChIP High Cell Chromatin Shearing Kit with SDS Buffer and S2 Sonicator. .. ZFX ChIP was performed using rabbit polyclonal antibody ( ) and Protein A Dynabeads (invitrogen), and unprobed sheared chromatin was used as a control (Input).

    Article Title: A Novel t(8;14)(q24;q11) Rearranged Human Cell Line as a Model for Mechanistic and Drug Discovery Studies of NOTCH1-Independent Human T-Cell Leukemia
    Article Snippet: H3K27ac chromatin immunoprecipitation sequencing (ChIP-seq): UP-ALL13 cells (2 × 107 ) were cross-linked with methanol-free formaldehyde (1% final concentration) at room temperature for 7 min and the cross-linking reaction was quenched with glycine (125 mM final concentration, Sigma-Aldrich). .. Nuclei were isolated and chromatin was purified by chemical lysis (truChIP Chromatin Shearing Reagent KIT, Covaris, Woburn, MA, USA) and processed as previously described [ ]. .. Statistical analysis: We performed statistical analysis by Student’s t -test and Mann-Whitney U test where appropriate.

    Article Title: Atopic asthma after rhinovirus‐induced wheezing is associated with DNA methylation change in the SMAD3 gene promoter, et al. Atopic asthma after rhinovirus‐induced wheezing is associated with DNA methylation change in the SMAD3 gene promoter
    Article Snippet: The reduced representation bisulfite sequencing (RRBS) libraries were prepared with a protocol adapted from Boyle et al. , For genomic localization of promoters and enhancers H3K4me1, H3K4me3 and H3K27Ac ChIP‐seq was carried out from peripheral blood mononuclear cells isolated from 2 reference individuals. .. Briefly, the chromatin was prepared (truChIP Low Cell Chromatin Kit, Covaris) and ChIP reactions (Auto Histone ChIP‐seq kit) were carried out with Diagenode IP‐Star SX 8G robot.


    Article Title: Zfx facilitates tumorigenesis caused by activation of the Hedgehog pathway
    Article Snippet: Labeled cDNA was analyzed on Affymetrix Mouse Gene 1.0 ST arrays. .. Sonication-sheared chromatin from DAOY human MB cells was generated and isolated using Covaris truChIP High Cell Chromatin Shearing Kit with SDS Buffer and S2 Sonicator.

    Article Title: A PERK-miR211 axis suppresses circadian regulators and protein synthesis to promote cancer cell survival
    Article Snippet: Biotin labeled miR-211 duplexes were generated as previously reported . .. Chromatin was prepared using the truChIP low cell chromatin shearing kit (Covaris) and sheared 200–700 bp fragments.

    Mouse Assay:

    Article Title: Alteration of Gene Expression, DNA Methylation, and Histone Methylation in Free Radical Scavenging Networks in Adult Mouse Hippocampus following Fetal Alcohol Exposure
    Article Snippet: Hippocampal tissue samples were thawed on ice then treated with 1% formaldehyde for five minutes and sonicated with the truChIPTM Tissue Prep Kit for SDS Chromatin Shearing (Covaris) and the Covaris® S2 Sonicator (Woburn, MA, USA) according to the manufacturer’s protocol. .. After sonication, samples were divided and immunoprecipitated with ChIP-grade polyclonal antibodies anti-H3K4me3 (Epigentek cat # A-4033) and anti-H3K27me3 (Millipore cat #07–499).

    Article Title: Restoring Tip60 HAT/HDAC2 Balance in the Neurodegenerative Brain Relieves Epigenetic Transcriptional Repression and Reinstates Cognition
    Article Snippet: Six dissected hippocampus or tissue specificity control liver tissue samples were obtained from an equal number of mixed male and female C57BL 6-month-old control mice. .. Chromatin was extracted and sheared from mice hippocampus and liver using truChIP Chromatin Shearing Kit from Covaris following the manufacturer's instructions. .. Briefly, protein–DNA cross-links were made at RT for 5 min with 1% formaldehyde and tissue was pulverized using the CryoPrep from Covaris.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Zfx facilitates tumorigenesis caused by activation of the Hedgehog pathway
    Article Snippet: RT-PCR results were calculated by ΔΔCT method and normalized for a housekeeping gene ( Actb or Gapdh ). .. Sonication-sheared chromatin from DAOY human MB cells was generated and isolated using Covaris truChIP High Cell Chromatin Shearing Kit with SDS Buffer and S2 Sonicator.


    Article Title: Zfx facilitates tumorigenesis caused by activation of the Hedgehog pathway
    Article Snippet: RNA for microarray analysis of DAOY human MB cells after ZFX knockdown was obtained 4 days after lentiviral transduction from one culture replicate for each of the ZFX-targeting shRNA constructs (H2, H3, H4) and non-targeting “scrambled” control (SCR). .. Sonication-sheared chromatin from DAOY human MB cells was generated and isolated using Covaris truChIP High Cell Chromatin Shearing Kit with SDS Buffer and S2 Sonicator.


    Article Title: Regulation of Age-associated B cells by IRF5 in systemic autoimmunity
    Article Snippet: The immunoprecipitates were resolved by 8% SDS-PAGE, transferred to a nitrocellulose membrane, and then immunoblotted with either an anti–SWAP-70 (Santa Cruz Biotechnology, Inc.), anti-DEF6 antiserum or anti-HA (Roche Applied Science). .. CD23+ B cells were purified and stimulated in vitro for 48 h. After harvesting, the cells were cross-linked with formaldehyde, and chromatin extracts were prepared using the truChIP Chromatin Shearing Reagent Kit (Covaris) according to manufacturer instructions. .. The DNA–protein complexes were immunoprecipitated with an anti-IRF5 (Abcam, ab21689) or anti-T-bet (Santa Cruz; sc-21749X) specific antibody or a control antibody.

    Article Title: Loss of pyruvate kinase M2 limits growth and triggers innate immune signaling in endothelial cells
    Article Snippet: ChIP was performed using the truChIP Chromatin Shearing Reagent kit (Covaris) according to the manufacturer’s instructions. .. Immunoprecipitation was performed following a published protocol using the following antibodies: Mouse IgG (2 μg/IP, 5441S, Cell Signaling) and Histone H3 (tri methyl K9) (2 μg/IP, ab8898, Abcam).

    Article Title: A Novel t(8;14)(q24;q11) Rearranged Human Cell Line as a Model for Mechanistic and Drug Discovery Studies of NOTCH1-Independent Human T-Cell Leukemia
    Article Snippet: H3K27ac chromatin immunoprecipitation sequencing (ChIP-seq): UP-ALL13 cells (2 × 107 ) were cross-linked with methanol-free formaldehyde (1% final concentration) at room temperature for 7 min and the cross-linking reaction was quenched with glycine (125 mM final concentration, Sigma-Aldrich). .. Nuclei were isolated and chromatin was purified by chemical lysis (truChIP Chromatin Shearing Reagent KIT, Covaris, Woburn, MA, USA) and processed as previously described [ ]. .. Statistical analysis: We performed statistical analysis by Student’s t -test and Mann-Whitney U test where appropriate.

    Chromatin Immunoprecipitation:

    Article Title: JunB defines functional and structural integrity of the epidermo-pilosebaceous unit in the skin
    Article Snippet: Paragraph title: ChIP assay ... Briefly, 10 × 106 epidermal progenitor cells were subjected to fixation, nuclei preparation and chromatin fragmentation using truChIP Chromatin Shearing Kit (Covaris).

    Article Title: Regulation of Age-associated B cells by IRF5 in systemic autoimmunity
    Article Snippet: Paragraph title: ChIP assays. ... CD23+ B cells were purified and stimulated in vitro for 48 h. After harvesting, the cells were cross-linked with formaldehyde, and chromatin extracts were prepared using the truChIP Chromatin Shearing Reagent Kit (Covaris) according to manufacturer instructions.

    Article Title: Intestinal, but not hepatic, ChREBP is required for fructose tolerance
    Article Snippet: Paragraph title: ChIP-PCR. ... Chromatin was isolated using a truChIP Chromatin Shearing Tissue Kit (Covaris) according to the manufacturer’s protocol, with modifications.

    Article Title: Alteration of Gene Expression, DNA Methylation, and Histone Methylation in Free Radical Scavenging Networks in Adult Mouse Hippocampus following Fetal Alcohol Exposure
    Article Snippet: Paragraph title: Chromatin Immunoprecipitation ... Hippocampal tissue samples were thawed on ice then treated with 1% formaldehyde for five minutes and sonicated with the truChIPTM Tissue Prep Kit for SDS Chromatin Shearing (Covaris) and the Covaris® S2 Sonicator (Woburn, MA, USA) according to the manufacturer’s protocol.

    Article Title: Loss of pyruvate kinase M2 limits growth and triggers innate immune signaling in endothelial cells
    Article Snippet: The levels of 5-methylcytosine were measured using the MethylFlash Methylated DNA quantification kit (Epigenetik) according to the instructions of the manufacturer. .. ChIP was performed using the truChIP Chromatin Shearing Reagent kit (Covaris) according to the manufacturer’s instructions. .. Chromatin was sheared (Bioruptor, Diagenode) to generate fragments between 200 and 400 bp.

    Article Title: ZFX controls propagation and prevents differentiation of acute T-lymphoblastic and myeloid leukemia
    Article Snippet: Quantitative RT–PCR analysis was performed using open reading frame-specific primers (sequences available upon request) and the ΔΔCT method as described ( ). .. For ChIP, nuclei from 107 formaldehyde-fixed NOMO-1 and RPMI-8402 cells were isolated, lysed and ultrasonically sheared using the TRUChIP High Cell Chromatin Shearing Kit (Covaris). .. ChIP was performed using anti-ZFX rabbit polyclonal antibody or non-specific rabbit IgG as described ( ).

    Article Title: Nrf1 and Nrf2 Transcription Factors Regulate Androgen Receptor Transactivation in Prostate Cancer Cells
    Article Snippet: Samples were then boiled for 5 mins at 95°C, loaded onto the gel, and immunoblotted (IB) with the indicated antibodies. .. For chromatin immunoprecipitation (ChIP) assays we used two different kits, the Covaris (Woburn, MA) truChIP chromatin shearing kit with non-ionic buffer and the Active Motif (Carlsbad, CA) ChIP-IT High Sensitivity kit. .. The assays were performed according to manufacturer’s protocols, with minor modifications.

    Article Title: Tcf1 and Lef1 transcription factors establish CD8+ T cell identity through intrinsic HDAC activity
    Article Snippet: Paragraph title: ChIP and quantitative PCR ... WT CD4+ or CD8+ , Tcf7 −/− Lef1 −/− CD8+ mature thymocytes or splenic CD8+ T cells were sorted and cross-linked with 1% formaldehyde in medium for 5 minutes, processed using truChIP Chromatin Shearing Reagent Kit (Covaris), and sonicated for 5 minutes on Covaris S2 ultrasonicator.

    Article Title: Site-Specific Association with Host and Viral Chromatin by Kaposi's Sarcoma-Associated Herpesvirus LANA and Its Reversal during Lytic Reactivation
    Article Snippet: Paragraph title: ChIP. ... Nucleus preparations were done using a truChIP High Cell Chromatin Shearing Kit with SDS from Covaris, and chromatin was sheared with a Covaris E220 Ultrasonicator.

    Article Title: PRMT5 is required for lymphomagenesis triggered by multiple oncogenic drivers
    Article Snippet: Paragraph title: Western Blot and Chromatin Immunoprecipitation (CHIP) ... Chromatin was prepared using truChIP Low Cell Chromatin Shearing Kit (Covaris) and sheared into 200–700 bp fragments using a Covaris S2 instrument (duty cycle, 2%; intensity, 3; 200 cycles per burst; 4 min).

    Article Title: Systems-level identification of PKA-dependent signaling in epithelial cells
    Article Snippet: The read counts were filtered (cpm > 4) and analyzed for differential expression between PKA dKO and control using default TMM (trimmed mean of M values) normalization within edgeR (3.10). .. After treatment with dDAVP (0.1 nM) or vehicle for 24 h, cells were processed for ChIP using the truChIP Chromatin Shearing Reagent Kit (Covaris) following the manufacturer’s protocol. .. Immunoprecipitations were carried out (SimpleChIP Chromatin IP Kit; Cell Signaling) using an anti-H3K27Ac antibody (Abcam; ab4729).

    Article Title: Prox1 and fibroblast growth factor receptors form a novel regulatory loop controlling lens fiber differentiation and gene expression
    Article Snippet: Paragraph title: Chromatin immunoprecipitation ... Nuclei were extracted and processed using the truChIP Chromatin Shearing Kit (Covaris) and chromatin sheared using a Covaris S2 adaptive focused acoustic disrupter.

    Article Title: Restoring Tip60 HAT/HDAC2 Balance in the Neurodegenerative Brain Relieves Epigenetic Transcriptional Repression and Reinstates Cognition
    Article Snippet: Chromatin was extracted and sheared from mice hippocampus and liver using truChIP Chromatin Shearing Kit from Covaris following the manufacturer's instructions. .. Chromatin was extracted and sheared from mice hippocampus and liver using truChIP Chromatin Shearing Kit from Covaris following the manufacturer's instructions.

    Article Title: LEF-1 and TCF-1 orchestrate T follicular helper cell differentiation by regulating differentiation circuits upstream of Bcl6
    Article Snippet: Paragraph title: Chromatin immunoprecipitation (ChIP) ... Sorted CD4+ T cells were cross-linked with 1% formaldehyde in medium for 5 minutes, processed using truChIP Chromatin Shearing Reagent Kit (Covaris), and sonicated for 5 minutes on Covaris S2 ultrasonicator.

    Article Title: A PERK-miR211 axis suppresses circadian regulators and protein synthesis to promote cancer cell survival
    Article Snippet: Paragraph title: Chromatin immunoprecipitation assays and Biotin-211 chromatin precipitation ... Chromatin was prepared using the truChIP low cell chromatin shearing kit (Covaris) and sheared 200–700 bp fragments.

    Article Title: Atopic asthma after rhinovirus‐induced wheezing is associated with DNA methylation change in the SMAD3 gene promoter, et al. Atopic asthma after rhinovirus‐induced wheezing is associated with DNA methylation change in the SMAD3 gene promoter
    Article Snippet: The reduced representation bisulfite sequencing (RRBS) libraries were prepared with a protocol adapted from Boyle et al. , For genomic localization of promoters and enhancers H3K4me1, H3K4me3 and H3K27Ac ChIP‐seq was carried out from peripheral blood mononuclear cells isolated from 2 reference individuals. .. Briefly, the chromatin was prepared (truChIP Low Cell Chromatin Kit, Covaris) and ChIP reactions (Auto Histone ChIP‐seq kit) were carried out with Diagenode IP‐Star SX 8G robot. .. The libraries were sequenced with Illumina HiSeq2000 platform.

    Article Title: T Cell Receptor-induced Nuclear Factor κB (NF-κB) Signaling and Transcriptional Activation Are Regulated by STIM1- and Orai1-mediated Calcium Entry
    Article Snippet: Paragraph title: Chromatin Immunoprecipitation ... Chromatin was prepared using a Covaris truChIP chromatin shearing kit (Covaris Inc., Woburn, MA).

    Article Title: Nrf1 and Nrf2 Transcription Factors Regulate Androgen Receptor Transactivation in Prostate Cancer Cells
    Article Snippet: Paragraph title: Chromatin Immunoprecipitation ... Briefly, DHT treated (6 hrs) LNCaP and C4-2B cells were sheared using the Covaris truChIP kit using an E220 focused-ultrasonicator from Covaris.

    SDS Page:

    Article Title: A Novel t(8;14)(q24;q11) Rearranged Human Cell Line as a Model for Mechanistic and Drug Discovery Studies of NOTCH1-Independent Human T-Cell Leukemia
    Article Snippet: For Western blotting, protein samples were separated on 4–12% gradient Tris–glycine SDS-PAGE (Invitrogen) and transferred to PVDF membrane (Millipore, Burlington, MA, USA). .. Nuclei were isolated and chromatin was purified by chemical lysis (truChIP Chromatin Shearing Reagent KIT, Covaris, Woburn, MA, USA) and processed as previously described [ ].

    Plasmid Preparation:

    Article Title: T Cell Receptor-induced Nuclear Factor κB (NF-κB) Signaling and Transcriptional Activation Are Regulated by STIM1- and Orai1-mediated Calcium Entry
    Article Snippet: Jurkat T cells (10 × 106 ) transfected with either EGFP-shPKCα or control EGFP-pCMS2 vector (48 h) were stimulated with PMA (200 n m ) and ionomycin (1 μ m ) for 30 min at 37 °C. .. Chromatin was prepared using a Covaris truChIP chromatin shearing kit (Covaris Inc., Woburn, MA).


    Article Title: ZFX controls propagation and prevents differentiation of acute T-lymphoblastic and myeloid leukemia
    Article Snippet: Microarray hybridization, scanning and data extraction using the Expression Console software package was according to the manufacturer's instructions. .. For ChIP, nuclei from 107 formaldehyde-fixed NOMO-1 and RPMI-8402 cells were isolated, lysed and ultrasonically sheared using the TRUChIP High Cell Chromatin Shearing Kit (Covaris).

    SYBR Green Assay:

    Article Title: PRMT5 is required for lymphomagenesis triggered by multiple oncogenic drivers
    Article Snippet: Chromatin was prepared using truChIP Low Cell Chromatin Shearing Kit (Covaris) and sheared into 200–700 bp fragments using a Covaris S2 instrument (duty cycle, 2%; intensity, 3; 200 cycles per burst; 4 min). .. Immunoprecipitation was performed using the IgG, p53 (FL-393), E2F-1 (C-20) and H4R3 (Abcam) antibodies with a Quick Chip Kit (Imgenex, San Diego, CA).

    Negative Control:

    Article Title: Systems-level identification of PKA-dependent signaling in epithelial cells
    Article Snippet: After treatment with dDAVP (0.1 nM) or vehicle for 24 h, cells were processed for ChIP using the truChIP Chromatin Shearing Reagent Kit (Covaris) following the manufacturer’s protocol. .. Immunoprecipitations were carried out (SimpleChIP Chromatin IP Kit; Cell Signaling) using an anti-H3K27Ac antibody (Abcam; ab4729).


    Article Title: Zfx facilitates tumorigenesis caused by activation of the Hedgehog pathway
    Article Snippet: RNA for microarray analysis of DAOY human MB cells after ZFX knockdown was obtained 4 days after lentiviral transduction from one culture replicate for each of the ZFX-targeting shRNA constructs (H2, H3, H4) and non-targeting “scrambled” control (SCR). .. Sonication-sheared chromatin from DAOY human MB cells was generated and isolated using Covaris truChIP High Cell Chromatin Shearing Kit with SDS Buffer and S2 Sonicator.

    Sample Prep:

    Article Title: Atopic asthma after rhinovirus‐induced wheezing is associated with DNA methylation change in the SMAD3 gene promoter, et al. Atopic asthma after rhinovirus‐induced wheezing is associated with DNA methylation change in the SMAD3 gene promoter
    Article Snippet: The messenger RNA‐seq samples were prepared with Illumina TruSeq RNA Sample Preparation kit v2. .. Briefly, the chromatin was prepared (truChIP Low Cell Chromatin Kit, Covaris) and ChIP reactions (Auto Histone ChIP‐seq kit) were carried out with Diagenode IP‐Star SX 8G robot.

    In Vitro:

    Article Title: Regulation of Age-associated B cells by IRF5 in systemic autoimmunity
    Article Snippet: The immunoprecipitates were resolved by 8% SDS-PAGE, transferred to a nitrocellulose membrane, and then immunoblotted with either an anti–SWAP-70 (Santa Cruz Biotechnology, Inc.), anti-DEF6 antiserum or anti-HA (Roche Applied Science). .. CD23+ B cells were purified and stimulated in vitro for 48 h. After harvesting, the cells were cross-linked with formaldehyde, and chromatin extracts were prepared using the truChIP Chromatin Shearing Reagent Kit (Covaris) according to manufacturer instructions. .. The DNA–protein complexes were immunoprecipitated with an anti-IRF5 (Abcam, ab21689) or anti-T-bet (Santa Cruz; sc-21749X) specific antibody or a control antibody.

    Radio Immunoprecipitation:

    Article Title: A Novel t(8;14)(q24;q11) Rearranged Human Cell Line as a Model for Mechanistic and Drug Discovery Studies of NOTCH1-Independent Human T-Cell Leukemia
    Article Snippet: Immunoblot analysis: Total cell lysates were prepared using RadioImmunoprecipitation Assay (RIPA) lysis buffer supplemented with phosphatase inhibitor cocktail set I and II (Sigma) and protease inhibitor cocktail tablets (Roche) and normalized for protein concentration using the Bicinchoninic Acid (BCA) method (Pierce, Pero, Italy). .. Nuclei were isolated and chromatin was purified by chemical lysis (truChIP Chromatin Shearing Reagent KIT, Covaris, Woburn, MA, USA) and processed as previously described [ ].

    Article Title: Site-Specific Association with Host and Viral Chromatin by Kaposi's Sarcoma-Associated Herpesvirus LANA and Its Reversal during Lytic Reactivation
    Article Snippet: Nucleus preparations were done using a truChIP High Cell Chromatin Shearing Kit with SDS from Covaris, and chromatin was sheared with a Covaris E220 Ultrasonicator. .. The average size of chromatin fragments was either ∼200 bp or ∼600 bp for ChIP-seq or ChIP with quantitative PCR (ChIP-qPCR) assays, respectively.

    Concentration Assay:

    Article Title: A Novel t(8;14)(q24;q11) Rearranged Human Cell Line as a Model for Mechanistic and Drug Discovery Studies of NOTCH1-Independent Human T-Cell Leukemia
    Article Snippet: H3K27ac chromatin immunoprecipitation sequencing (ChIP-seq): UP-ALL13 cells (2 × 107 ) were cross-linked with methanol-free formaldehyde (1% final concentration) at room temperature for 7 min and the cross-linking reaction was quenched with glycine (125 mM final concentration, Sigma-Aldrich). .. Nuclei were isolated and chromatin was purified by chemical lysis (truChIP Chromatin Shearing Reagent KIT, Covaris, Woburn, MA, USA) and processed as previously described [ ].

    Standard Deviation:

    Article Title: A Novel t(8;14)(q24;q11) Rearranged Human Cell Line as a Model for Mechanistic and Drug Discovery Studies of NOTCH1-Independent Human T-Cell Leukemia
    Article Snippet: Nuclei were isolated and chromatin was purified by chemical lysis (truChIP Chromatin Shearing Reagent KIT, Covaris, Woburn, MA, USA) and processed as previously described [ ]. .. Nuclei were isolated and chromatin was purified by chemical lysis (truChIP Chromatin Shearing Reagent KIT, Covaris, Woburn, MA, USA) and processed as previously described [ ].


    Article Title: Intestinal, but not hepatic, ChREBP is required for fructose tolerance
    Article Snippet: Chromatin was isolated using a truChIP Chromatin Shearing Tissue Kit (Covaris) according to the manufacturer’s protocol, with modifications. .. Chromatin was isolated using a truChIP Chromatin Shearing Tissue Kit (Covaris) according to the manufacturer’s protocol, with modifications.

    Article Title: A Novel t(8;14)(q24;q11) Rearranged Human Cell Line as a Model for Mechanistic and Drug Discovery Studies of NOTCH1-Independent Human T-Cell Leukemia
    Article Snippet: H3K27ac chromatin immunoprecipitation sequencing (ChIP-seq): UP-ALL13 cells (2 × 107 ) were cross-linked with methanol-free formaldehyde (1% final concentration) at room temperature for 7 min and the cross-linking reaction was quenched with glycine (125 mM final concentration, Sigma-Aldrich). .. Nuclei were isolated and chromatin was purified by chemical lysis (truChIP Chromatin Shearing Reagent KIT, Covaris, Woburn, MA, USA) and processed as previously described [ ]. .. Statistical analysis: We performed statistical analysis by Student’s t -test and Mann-Whitney U test where appropriate.

    Article Title: Restoring Tip60 HAT/HDAC2 Balance in the Neurodegenerative Brain Relieves Epigenetic Transcriptional Repression and Reinstates Cognition
    Article Snippet: Chromatin was extracted and sheared from mice hippocampus and liver using truChIP Chromatin Shearing Kit from Covaris following the manufacturer's instructions. .. Chromatin was extracted and sheared from mice hippocampus and liver using truChIP Chromatin Shearing Kit from Covaris following the manufacturer's instructions.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Covaris truchip chromatin shearing kit
    Truchip Chromatin Shearing Kit, supplied by Covaris, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more chromatin shearing kit/product/Covaris
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    truchip chromatin shearing kit - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results