Structured Review

Fisher Bioreagents tris base
Tris Base, supplied by Fisher Bioreagents, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tris base/product/Fisher Bioreagents
Average 92 stars, based on 4 article reviews
Price from $9.99 to $1999.99
tris base - by Bioz Stars, 2020-08
92/100 stars

Images

Related Articles

SYBR Green Assay:

Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

other:

Article Title: A Crude Extract Preparation and Optimization from a Genomically Engineered Escherichia coli for the Cell-Free Protein Synthesis System: Practical Laboratory Guideline
Article Snippet: Cell Disruption and Extract Preparation: Buffer A and Dialysis 1,4-Dithio-DL-threitol (DTT) (Sigma-Aldrich, St. Louis, MO, USA) Potassium acetate (Fisher Bioreagents) Magnesium acetate tetrahydrate (Fisher Bioreagents) Tris base (Fisher Bioreagents) Potassium hydroxide (Fisher Bioreagents) Slide-A-Lyzer™ G2 dialysis cassette, 10K MWCO, 3 mL (Thermo Fisher Scientific, Waltham, MA, USA) for dialysis (if necessary)

Article Title: Reference Transcriptome for Deriving Marmoset Induced Pluripotent Stem Cells
Article Snippet: Tris base (Fisher Bioreagents, Pittsburgh, PA, USA).

Article Title: Reference Transcriptome for Deriving Marmoset Induced Pluripotent Stem Cells
Article Snippet: Preparation of 10 mM Tris (25 mL) : Dissolve 30.35 milligrams of Tris base (F.Wt, 121.4) in 15 mL of double-distilled water and adjust the pH to 7.6.

Western Blot:

Article Title: A signature of enhanced lipid metabolism, lipid peroxidation and aldehyde stress in therapy-induced senescence
Article Snippet: .. Western blotting Cells were pelleted following FACS and immediately lysed in ice-cold RIPA buffer consisting of 150 mM NaCl (Fisher Bioreagents, Asheville, NC, USA), 50 mM Tris base (Fisher Bioreagents), 1% Triton-X-100 (Sigma-Aldrich), 0.5% sodium deoxycholate (Sigma-Aldrich), 0.1% SDS (Sigma-Aldrich), adjusted to pH 8.0. .. Lysis was conducted for 30 min on ice with rapid vortexing every 10 min.

Sequencing:

Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

FACS:

Article Title: A signature of enhanced lipid metabolism, lipid peroxidation and aldehyde stress in therapy-induced senescence
Article Snippet: .. Western blotting Cells were pelleted following FACS and immediately lysed in ice-cold RIPA buffer consisting of 150 mM NaCl (Fisher Bioreagents, Asheville, NC, USA), 50 mM Tris base (Fisher Bioreagents), 1% Triton-X-100 (Sigma-Aldrich), 0.5% sodium deoxycholate (Sigma-Aldrich), 0.1% SDS (Sigma-Aldrich), adjusted to pH 8.0. .. Lysis was conducted for 30 min on ice with rapid vortexing every 10 min.

Plasmid Preparation:

Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

Software:

Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Fisher Bioreagents tris base
    Tris Base, supplied by Fisher Bioreagents, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tris base/product/Fisher Bioreagents
    Average 92 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    tris base - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    Image Search Results