transformaid bacterial transformation kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    TransformAid Bacterial Transformation Kit
    Description:
    Thermo Scientific TransformAid Bacterial Transformation Kit sufficient for 20 transformations uses a novel method for rapid preparation of chemically competent E coli cells from overnight bacterial cultures or bacterial colonies The key component of this system is the unique T solution which produces competent cells in a few easy steps The quick and convenient procedure guarantees transformation efficiencies of more than 107 transformants per µg of plasmid DNA ideal for routine cloning experiments The option to use bacterial colonies for preparation of competent cells adds flexibility to any cloning experiment The TransformAid Bacterial Transformation Kit can be used with most E coli strains commonly used for cloning JM107 JM109 XL1 Blue SURE TOPP2 W3110 NM527 AD494 CJ236 GM2163 C600 BL21 M15 NM522 HB101 ER2267 Highlights• Efficient more than 107 transformants per µg of plasmid DNA• Practical E coli competent cells can be prepared from an overnight culture or from bacterial colonies• Fast less than 1 hour from the overnight bacterial culture to cell plating Starting from bacterial colonies the procedure requires only 2 5 hours• Easy all procedures are performed on ice on your bench Brief centrifugations are carried out in regular microcentrifugesApplications• Routine cloning experiments• Blunt end cloning• TA cloningIncludes• C Medium• T Solution A • T Solution B • Detailed ProtocolNoteCompetent cells prepared with TransformAid Bacterial Transformation Kit are suitable for direct use only Freezing down and storage at 70°C is not recommended Related ProductsTransformAid Bacterial Transformation Kit
    Catalog Number:
    k2710
    Price:
    None
    Applications:
    Cloning|Transformation
    Category:
    Competent Cells Strains
    Buy from Supplier


    Structured Review

    Thermo Fisher transformaid bacterial transformation kit
    Thermo Scientific TransformAid Bacterial Transformation Kit sufficient for 20 transformations uses a novel method for rapid preparation of chemically competent E coli cells from overnight bacterial cultures or bacterial colonies The key component of this system is the unique T solution which produces competent cells in a few easy steps The quick and convenient procedure guarantees transformation efficiencies of more than 107 transformants per µg of plasmid DNA ideal for routine cloning experiments The option to use bacterial colonies for preparation of competent cells adds flexibility to any cloning experiment The TransformAid Bacterial Transformation Kit can be used with most E coli strains commonly used for cloning JM107 JM109 XL1 Blue SURE TOPP2 W3110 NM527 AD494 CJ236 GM2163 C600 BL21 M15 NM522 HB101 ER2267 Highlights• Efficient more than 107 transformants per µg of plasmid DNA• Practical E coli competent cells can be prepared from an overnight culture or from bacterial colonies• Fast less than 1 hour from the overnight bacterial culture to cell plating Starting from bacterial colonies the procedure requires only 2 5 hours• Easy all procedures are performed on ice on your bench Brief centrifugations are carried out in regular microcentrifugesApplications• Routine cloning experiments• Blunt end cloning• TA cloningIncludes• C Medium• T Solution A • T Solution B • Detailed ProtocolNoteCompetent cells prepared with TransformAid Bacterial Transformation Kit are suitable for direct use only Freezing down and storage at 70°C is not recommended Related ProductsTransformAid Bacterial Transformation Kit
    https://www.bioz.com/result/transformaid bacterial transformation kit/product/Thermo Fisher
    Average 99 stars, based on 28 article reviews
    Price from $9.99 to $1999.99
    transformaid bacterial transformation kit - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Copper, Zinc-Superoxide Dismutase from Clinically Isolated Escherichia coli: Cloning, Analysis of sodC and Its Possible Role in Pathogenicity
    Article Snippet: .. The TransformAid Bacterial Transformation Kit (MBI, Fermentas) was used for transforming 10 μl of ligation mixture into competent E. coli DH5α cells, spread plated on LB solid medium containing 100 μg/ml ampicillin and incubated at 37°C for 12 h. The recombinant clones were analysed for the presence and orientation of the DNA insert using restriction digestion analysis. .. The plasmid DNA was isolated from an overnight bacterial culture using a convenient plasmid Miniprep method.

    Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India
    Article Snippet: Paragraph title: Cloning and nucleotide sequencing ... The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Transform-aid bacterial transformation kit (Fermentas, Germany) as per manufacturer's protocol.

    Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2
    Article Snippet: Molecular Cloning of Phage Binding Sequence Motifs and Variants Thereof Modification of the phage binding motif was achieved by standard cloning procedures. .. Ligated DNA was transformed into E . coli ER2738 using the TransformAid bacterial transformation kit (Fermentas, St. Leon-Rot, Germany) according to the manufacturer’s instructions.

    Article Title: A connecting hinge represses the activity of endothelial nitric oxide synthase
    Article Snippet: Restriction digestions, cloning, and bacterial growth were performed using standard procedures. .. Transformations were performed using a TransformAid bacterial transformation kit (Fermentas, Hanover, MD).

    Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins
    Article Snippet: Paragraph title: PcP190 and 5S rDNA isolation, cloning and sequencing ... The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the TransformationAid Bacterial Transformation Kit (Fermentas), following the manufacturer’s instructions.

    Article Title: Low Prevalence of Rotavirus and High Prevalence of Norovirus in Hospital and Community Wastewater after Introduction of Rotavirus Vaccine in Nicaragua
    Article Snippet: .. The NoV NS capsid fragment was cloned into pJET1.2 vector and transformed into E.coli cells using CloneJet™ PCR Cloning and TransformAid™ Bacterial Transformation kits (Fermentas, St. Leon-Rot, Germany) according to the manufacturer's instructions. .. Ten separate colonies from each transformation reaction were screened by PCR for the correct gene insert.

    Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma
    Article Snippet: The mIL-12 expression cassette was cloned into the pCRBluntpsiCat plasmid using NotI , SwaI , and PmlI restriction enzymes, and the antibiotic resistance-free plasmid was produced using the X-mark™ technology and antibiotic-free maintenance system ORT® (Cobra Biologics). .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and TransformAid Bacterial Transformation Kit together with the E. coli strain JM107 were all purchased from Thermo Fisher Scientific (Waltham, MA, USA).

    Article Title: A cross-domain charge interaction governs the activity of NO synthase
    Article Snippet: Restriction digestions, cloning, and bacterial growth were performed using standard procedures. .. Transformations were performed using a TransformAid bacterial transformation kit (Fermentas-Thermo Scientific, Hanover, MD).

    Amplification:

    Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2
    Article Snippet: Ligated DNA was transformed into E . coli ER2738 using the TransformAid bacterial transformation kit (Fermentas, St. Leon-Rot, Germany) according to the manufacturer’s instructions. .. Following amplification, phage DNA was extracted using the E.Z.N.A. plasmid miniprep kit I (peqLab, Erlangen, Germany) and inserts were verified by DNA sequencing.

    Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins
    Article Snippet: .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the TransformationAid Bacterial Transformation Kit (Fermentas), following the manufacturer’s instructions. .. Recombinant colonies were identified and plasmid extraction was performed using the mini-prep method described by Sambrook and Russel [ ].

    Article Title: Low Prevalence of Rotavirus and High Prevalence of Norovirus in Hospital and Community Wastewater after Introduction of Rotavirus Vaccine in Nicaragua
    Article Snippet: Paragraph title: PCR amplification and cloning of the NoV N-terminal and shell (NS) region ... The NoV NS capsid fragment was cloned into pJET1.2 vector and transformed into E.coli cells using CloneJet™ PCR Cloning and TransformAid™ Bacterial Transformation kits (Fermentas, St. Leon-Rot, Germany) according to the manufacturer's instructions.

    Binding Assay:

    Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2
    Article Snippet: Paragraph title: Molecular Cloning of Phage Binding Sequence Motifs and Variants Thereof ... Ligated DNA was transformed into E . coli ER2738 using the TransformAid bacterial transformation kit (Fermentas, St. Leon-Rot, Germany) according to the manufacturer’s instructions.

    DNA Ligation:

    Article Title: Engineering the Production of Major Catechins by Escherichia coli Carrying Metabolite Genes of Camellia sinensis
    Article Snippet: .. The restriction enzymes, DNA ligation kit, genomic DNA purification kit, GeneJET plasmid Miniprep kit, bacterial transformation kit, and IPTG were purchased from Fermentas, whereas KOD Hot Start DNA polymerase was purchased from Novagen. .. All other Chemicals were purchased from Merck (Darmstadt, Germany) and are either of analytical or HPLC grade.

    Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide
    Article Snippet: Synthetic gene and the bacterial expression vector (pET-15b) were digested with Nde I and Bam HI enzymes (Fermentas, EU), and the ligation step was performed using Rapid DNA Ligation Kit (Fermentas, EU). .. Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using TransformAid TM Bacterial Transformation Kit (Fermentas, EU).

    Polymerase Chain Reaction:

    Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India
    Article Snippet: .. The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Transform-aid bacterial transformation kit (Fermentas, Germany) as per manufacturer's protocol. .. Positive transformants were selected by colony PCR with the above mentioned primers and restriction enzyme digestion of recombinant plasmid with Eco RI.

    Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins
    Article Snippet: .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the TransformationAid Bacterial Transformation Kit (Fermentas), following the manufacturer’s instructions. .. Recombinant colonies were identified and plasmid extraction was performed using the mini-prep method described by Sambrook and Russel [ ].

    Article Title: Low Prevalence of Rotavirus and High Prevalence of Norovirus in Hospital and Community Wastewater after Introduction of Rotavirus Vaccine in Nicaragua
    Article Snippet: .. The NoV NS capsid fragment was cloned into pJET1.2 vector and transformed into E.coli cells using CloneJet™ PCR Cloning and TransformAid™ Bacterial Transformation kits (Fermentas, St. Leon-Rot, Germany) according to the manufacturer's instructions. .. Ten separate colonies from each transformation reaction were screened by PCR for the correct gene insert.

    Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide
    Article Snippet: Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using TransformAid TM Bacterial Transformation Kit (Fermentas, EU). .. After extraction of recombinant plasmids from transformed E. coli , PCR analysis was applied to check the proper insertion of the gene in the recombinant plasmid using T7 promoter-specific primers.

    Construct:

    Article Title: A connecting hinge represses the activity of endothelial nitric oxide synthase
    Article Snippet: Transformations were performed using a TransformAid bacterial transformation kit (Fermentas, Hanover, MD). .. Oligonucleotides used to construct site-directed mutants in nNOS were obtained from Integrated DNA Technologies (Coralville, IA).

    Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma
    Article Snippet: To construct pORF-mIL-12-ORT, standard cloning methods and operator-repressor titration (ORT) technology [ , ] were used, followed by transformation into competent (E. coli ) cells ( ). .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and TransformAid Bacterial Transformation Kit together with the E. coli strain JM107 were all purchased from Thermo Fisher Scientific (Waltham, MA, USA).

    Article Title: A cross-domain charge interaction governs the activity of NO synthase
    Article Snippet: Transformations were performed using a TransformAid bacterial transformation kit (Fermentas-Thermo Scientific, Hanover, MD). .. Oligonucleotides used to construct mutants in nNOS were obtained from Integrated DNA Technologies (Coralville, IA).

    Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide
    Article Snippet: Codon-optimized synthetic hGH containing L-asparaginase II signal sequence was prepared from Generay Biotech (Shanghai, China), after embedding the Nde I and Bam HI restriction endonuclease cut sites in the N- and C-terminal of the gene construct, respectively. .. Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using TransformAid TM Bacterial Transformation Kit (Fermentas, EU).

    Electrophoresis:

    Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins
    Article Snippet: .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the TransformationAid Bacterial Transformation Kit (Fermentas), following the manufacturer’s instructions. .. Recombinant colonies were identified and plasmid extraction was performed using the mini-prep method described by Sambrook and Russel [ ].

    Incubation:

    Article Title: Copper, Zinc-Superoxide Dismutase from Clinically Isolated Escherichia coli: Cloning, Analysis of sodC and Its Possible Role in Pathogenicity
    Article Snippet: .. The TransformAid Bacterial Transformation Kit (MBI, Fermentas) was used for transforming 10 μl of ligation mixture into competent E. coli DH5α cells, spread plated on LB solid medium containing 100 μg/ml ampicillin and incubated at 37°C for 12 h. The recombinant clones were analysed for the presence and orientation of the DNA insert using restriction digestion analysis. .. The plasmid DNA was isolated from an overnight bacterial culture using a convenient plasmid Miniprep method.

    Article Title: Low Prevalence of Rotavirus and High Prevalence of Norovirus in Hospital and Community Wastewater after Introduction of Rotavirus Vaccine in Nicaragua
    Article Snippet: The NoV NS capsid fragment was cloned into pJET1.2 vector and transformed into E.coli cells using CloneJet™ PCR Cloning and TransformAid™ Bacterial Transformation kits (Fermentas, St. Leon-Rot, Germany) according to the manufacturer's instructions. .. After overnight incubation of positive colonies, plasmid DNA was extracted and purified using GeneJET™ Plasmid Miniprep Kit (Fermentas, St. Leon-Rot, Germany) according to the manufacturer's instructions.

    Expressing:

    Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞
    Article Snippet: Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the TransformAid bacterial transformation kit (Fermentas, Hanover, MD). .. Protein Expression and Purification —The Δ65iNOSoxy W188H mutant with a His6 tag at the C terminus was overexpressed in E. coli strain BL21(DE3) using a modified pCWori vector.

    Article Title: Characterization of Calmodulin-Free Murine Inducible Nitric-Oxide Synthase
    Article Snippet: .. Bacterial transformation The TransformAid Bacterial Transformation Kit (Fermentas, USA) was used to transform Escherichia coli (E .coli ) strains BL21(DE3) and DH5α with iNOS and CaM plasmid DNAs either separately or together using the expression vector pCW through standard procedures [ ]. .. The transformed bacteria were then grown overnight in cultures and stored at -80°C as glycerol stocks for further use.

    Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma
    Article Snippet: The mIL-12 expression cassette was cloned into the pCRBluntpsiCat plasmid using NotI , SwaI , and PmlI restriction enzymes, and the antibiotic resistance-free plasmid was produced using the X-mark™ technology and antibiotic-free maintenance system ORT® (Cobra Biologics). .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and TransformAid Bacterial Transformation Kit together with the E. coli strain JM107 were all purchased from Thermo Fisher Scientific (Waltham, MA, USA).

    Article Title: A cross-domain charge interaction governs the activity of NO synthase
    Article Snippet: Paragraph title: Preparation of nNOS expression plasmids ... Transformations were performed using a TransformAid bacterial transformation kit (Fermentas-Thermo Scientific, Hanover, MD).

    Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide
    Article Snippet: Paragraph title: Design and construction of hGH secretory expression plasmid ... Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using TransformAid TM Bacterial Transformation Kit (Fermentas, EU).

    Modification:

    Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞
    Article Snippet: Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the TransformAid bacterial transformation kit (Fermentas, Hanover, MD). .. Protein Expression and Purification —The Δ65iNOSoxy W188H mutant with a His6 tag at the C terminus was overexpressed in E. coli strain BL21(DE3) using a modified pCWori vector.

    Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2
    Article Snippet: Molecular Cloning of Phage Binding Sequence Motifs and Variants Thereof Modification of the phage binding motif was achieved by standard cloning procedures. .. Ligated DNA was transformed into E . coli ER2738 using the TransformAid bacterial transformation kit (Fermentas, St. Leon-Rot, Germany) according to the manufacturer’s instructions.

    Article Title: A cross-domain charge interaction governs the activity of NO synthase
    Article Snippet: Wildtype and mutant rat nNOS proteins containing a His6 tag attached to their N termini were overexpressed in E. coli strain BL21(DE3) using a modified pCWori vector as described ( , ). .. Transformations were performed using a TransformAid bacterial transformation kit (Fermentas-Thermo Scientific, Hanover, MD).

    Transformation Assay:

    Article Title: Copper, Zinc-Superoxide Dismutase from Clinically Isolated Escherichia coli: Cloning, Analysis of sodC and Its Possible Role in Pathogenicity
    Article Snippet: Paragraph title: Transformation of sodC Cloned pTZ57R into E. coli DH5α ... The TransformAid Bacterial Transformation Kit (MBI, Fermentas) was used for transforming 10 μl of ligation mixture into competent E. coli DH5α cells, spread plated on LB solid medium containing 100 μg/ml ampicillin and incubated at 37°C for 12 h. The recombinant clones were analysed for the presence and orientation of the DNA insert using restriction digestion analysis.

    Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India
    Article Snippet: .. The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Transform-aid bacterial transformation kit (Fermentas, Germany) as per manufacturer's protocol. .. Positive transformants were selected by colony PCR with the above mentioned primers and restriction enzyme digestion of recombinant plasmid with Eco RI.

    Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞
    Article Snippet: .. Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the TransformAid bacterial transformation kit (Fermentas, Hanover, MD). .. Protein Expression and Purification —The Δ65iNOSoxy W188H mutant with a His6 tag at the C terminus was overexpressed in E. coli strain BL21(DE3) using a modified pCWori vector.

    Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2
    Article Snippet: .. Ligated DNA was transformed into E . coli ER2738 using the TransformAid bacterial transformation kit (Fermentas, St. Leon-Rot, Germany) according to the manufacturer’s instructions. .. Positive clones were identified using LB/S-Gal/IPTG-plates.

    Article Title: Characterization of Calmodulin-Free Murine Inducible Nitric-Oxide Synthase
    Article Snippet: Bacterial transformation The TransformAid Bacterial Transformation Kit (Fermentas, USA) was used to transform Escherichia coli (E .coli ) strains BL21(DE3) and DH5α with iNOS and CaM plasmid DNAs either separately or together using the expression vector pCW through standard procedures [ ]. .. The transformed bacteria were then grown overnight in cultures and stored at -80°C as glycerol stocks for further use.

    Article Title: Low Prevalence of Rotavirus and High Prevalence of Norovirus in Hospital and Community Wastewater after Introduction of Rotavirus Vaccine in Nicaragua
    Article Snippet: .. The NoV NS capsid fragment was cloned into pJET1.2 vector and transformed into E.coli cells using CloneJet™ PCR Cloning and TransformAid™ Bacterial Transformation kits (Fermentas, St. Leon-Rot, Germany) according to the manufacturer's instructions. .. Ten separate colonies from each transformation reaction were screened by PCR for the correct gene insert.

    Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma
    Article Snippet: To construct pORF-mIL-12-ORT, standard cloning methods and operator-repressor titration (ORT) technology [ , ] were used, followed by transformation into competent (E. coli ) cells ( ). .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and TransformAid Bacterial Transformation Kit together with the E. coli strain JM107 were all purchased from Thermo Fisher Scientific (Waltham, MA, USA).

    Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide
    Article Snippet: .. Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using TransformAid TM Bacterial Transformation Kit (Fermentas, EU). .. After extraction of recombinant plasmids from transformed E. coli , PCR analysis was applied to check the proper insertion of the gene in the recombinant plasmid using T7 promoter-specific primers.

    Derivative Assay:

    Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins
    Article Snippet: Because the PcP190 satellite DNA is derived from 5S rDNA [ ], we analyzed 5S rDNA sequences from Pseudis tocantins , which were isolated by PCR with the primers 5S-A (5’-TACGCCCGATCTCGTCCGATC-3’) and 5S-B (5’–CAGGCTGGTATGGCCGTAAGC–3’) [ ]. .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the TransformationAid Bacterial Transformation Kit (Fermentas), following the manufacturer’s instructions.

    High Performance Liquid Chromatography:

    Article Title: Engineering the Production of Major Catechins by Escherichia coli Carrying Metabolite Genes of Camellia sinensis
    Article Snippet: The restriction enzymes, DNA ligation kit, genomic DNA purification kit, GeneJET plasmid Miniprep kit, bacterial transformation kit, and IPTG were purchased from Fermentas, whereas KOD Hot Start DNA polymerase was purchased from Novagen. .. All other Chemicals were purchased from Merck (Darmstadt, Germany) and are either of analytical or HPLC grade.

    Ligation:

    Article Title: Copper, Zinc-Superoxide Dismutase from Clinically Isolated Escherichia coli: Cloning, Analysis of sodC and Its Possible Role in Pathogenicity
    Article Snippet: .. The TransformAid Bacterial Transformation Kit (MBI, Fermentas) was used for transforming 10 μl of ligation mixture into competent E. coli DH5α cells, spread plated on LB solid medium containing 100 μg/ml ampicillin and incubated at 37°C for 12 h. The recombinant clones were analysed for the presence and orientation of the DNA insert using restriction digestion analysis. .. The plasmid DNA was isolated from an overnight bacterial culture using a convenient plasmid Miniprep method.

    Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma
    Article Snippet: .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and TransformAid Bacterial Transformation Kit together with the E. coli strain JM107 were all purchased from Thermo Fisher Scientific (Waltham, MA, USA). ..

    Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide
    Article Snippet: .. Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using TransformAid TM Bacterial Transformation Kit (Fermentas, EU). .. After extraction of recombinant plasmids from transformed E. coli , PCR analysis was applied to check the proper insertion of the gene in the recombinant plasmid using T7 promoter-specific primers.

    Generated:

    Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India
    Article Snippet: Viral RNA from JEV-infected PS cells was reverse-transcribed using reverse primer and Stratascript reverse transcriptase. cDNA copies were generated by PCR using Dream Taq PCR mix (Fermentas, Germany). .. The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Transform-aid bacterial transformation kit (Fermentas, Germany) as per manufacturer's protocol.

    DNA Sequencing:

    Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India
    Article Snippet: The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Transform-aid bacterial transformation kit (Fermentas, Germany) as per manufacturer's protocol. .. Double-stranded DNA sequencing of the recombinant clone was performed by primer-walking at the National Facility for DNA Sequencing, University of Delhi South Campus, India and Sequence Analyzer 3730 (Applied Biosystems, USA).

    Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2
    Article Snippet: Ligated DNA was transformed into E . coli ER2738 using the TransformAid bacterial transformation kit (Fermentas, St. Leon-Rot, Germany) according to the manufacturer’s instructions. .. Following amplification, phage DNA was extracted using the E.Z.N.A. plasmid miniprep kit I (peqLab, Erlangen, Germany) and inserts were verified by DNA sequencing.

    Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins
    Article Snippet: The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the TransformationAid Bacterial Transformation Kit (Fermentas), following the manufacturer’s instructions. .. The products were resuspended in loading dye, denatured and then sequenced on an automated sequencer (ABI PRISM® 3100 Genetic Analyzer-Hitachi), using the DNA sequencing facility of the Chemistry Institute at the University of São Paulo.

    Article Title: A cross-domain charge interaction governs the activity of NO synthase
    Article Snippet: Transformations were performed using a TransformAid bacterial transformation kit (Fermentas-Thermo Scientific, Hanover, MD). .. All mutated constructs were confirmed by DNA sequencing at the Cleveland Clinic Genomics Core.

    Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide
    Article Snippet: Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using TransformAid TM Bacterial Transformation Kit (Fermentas, EU). .. The nucleotide sequence of recombinant insert was verified by automated DNA sequencing (SinaClon BioScience Co., Iran).

    Sequencing:

    Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India
    Article Snippet: Paragraph title: Cloning and nucleotide sequencing ... The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Transform-aid bacterial transformation kit (Fermentas, Germany) as per manufacturer's protocol.

    Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2
    Article Snippet: Paragraph title: Molecular Cloning of Phage Binding Sequence Motifs and Variants Thereof ... Ligated DNA was transformed into E . coli ER2738 using the TransformAid bacterial transformation kit (Fermentas, St. Leon-Rot, Germany) according to the manufacturer’s instructions.

    Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins
    Article Snippet: Paragraph title: PcP190 and 5S rDNA isolation, cloning and sequencing ... The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the TransformationAid Bacterial Transformation Kit (Fermentas), following the manufacturer’s instructions.

    Article Title: Low Prevalence of Rotavirus and High Prevalence of Norovirus in Hospital and Community Wastewater after Introduction of Rotavirus Vaccine in Nicaragua
    Article Snippet: The NoV NS capsid fragment was cloned into pJET1.2 vector and transformed into E.coli cells using CloneJet™ PCR Cloning and TransformAid™ Bacterial Transformation kits (Fermentas, St. Leon-Rot, Germany) according to the manufacturer's instructions. .. Nucleotide sequencing was performed by Macrogen Inc. (Seoul, South Korea), using the BigDye chemistry with pJET1.2 forward and reverse sequencing primers.

    Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide
    Article Snippet: Codon-optimized synthetic hGH containing L-asparaginase II signal sequence was prepared from Generay Biotech (Shanghai, China), after embedding the Nde I and Bam HI restriction endonuclease cut sites in the N- and C-terminal of the gene construct, respectively. .. Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using TransformAid TM Bacterial Transformation Kit (Fermentas, EU).

    Recombinant:

    Article Title: Copper, Zinc-Superoxide Dismutase from Clinically Isolated Escherichia coli: Cloning, Analysis of sodC and Its Possible Role in Pathogenicity
    Article Snippet: .. The TransformAid Bacterial Transformation Kit (MBI, Fermentas) was used for transforming 10 μl of ligation mixture into competent E. coli DH5α cells, spread plated on LB solid medium containing 100 μg/ml ampicillin and incubated at 37°C for 12 h. The recombinant clones were analysed for the presence and orientation of the DNA insert using restriction digestion analysis. .. The plasmid DNA was isolated from an overnight bacterial culture using a convenient plasmid Miniprep method.

    Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India
    Article Snippet: The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Transform-aid bacterial transformation kit (Fermentas, Germany) as per manufacturer's protocol. .. Positive transformants were selected by colony PCR with the above mentioned primers and restriction enzyme digestion of recombinant plasmid with Eco RI.

    Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins
    Article Snippet: The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the TransformationAid Bacterial Transformation Kit (Fermentas), following the manufacturer’s instructions. .. Recombinant colonies were identified and plasmid extraction was performed using the mini-prep method described by Sambrook and Russel [ ].

    Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide
    Article Snippet: Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using TransformAid TM Bacterial Transformation Kit (Fermentas, EU). .. After extraction of recombinant plasmids from transformed E. coli , PCR analysis was applied to check the proper insertion of the gene in the recombinant plasmid using T7 promoter-specific primers.

    Molecular Cloning:

    Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2
    Article Snippet: Paragraph title: Molecular Cloning of Phage Binding Sequence Motifs and Variants Thereof ... Ligated DNA was transformed into E . coli ER2738 using the TransformAid bacterial transformation kit (Fermentas, St. Leon-Rot, Germany) according to the manufacturer’s instructions.

    Mutagenesis:

    Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞
    Article Snippet: Mutations were introduced with the primers: W188H forward, 5′-CAA GAT GGC C CA T AG GAA TGC CCC TCG CTG CAT CGG CAG AAT CCA GTG GTC-3′; W188H reverse, 5′-GAC CAC TGG ATT CTG CCG ATG CAG CGA GGG GCA TTC CT A TG G GCC ATC TTG-3′, the mutation sites are underlined. .. Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the TransformAid bacterial transformation kit (Fermentas, Hanover, MD).

    Article Title: A connecting hinge represses the activity of endothelial nitric oxide synthase
    Article Snippet: Transformations were performed using a TransformAid bacterial transformation kit (Fermentas, Hanover, MD). .. Site-directed mutagenesis was performed using a QuikChange XL site-directed mutagenesis kit (Stratagene, La Jolla, CA).

    Article Title: A cross-domain charge interaction governs the activity of NO synthase
    Article Snippet: Wildtype and mutant rat nNOS proteins containing a His6 tag attached to their N termini were overexpressed in E. coli strain BL21(DE3) using a modified pCWori vector as described ( , ). .. Transformations were performed using a TransformAid bacterial transformation kit (Fermentas-Thermo Scientific, Hanover, MD).

    Isolation:

    Article Title: Copper, Zinc-Superoxide Dismutase from Clinically Isolated Escherichia coli: Cloning, Analysis of sodC and Its Possible Role in Pathogenicity
    Article Snippet: The TransformAid Bacterial Transformation Kit (MBI, Fermentas) was used for transforming 10 μl of ligation mixture into competent E. coli DH5α cells, spread plated on LB solid medium containing 100 μg/ml ampicillin and incubated at 37°C for 12 h. The recombinant clones were analysed for the presence and orientation of the DNA insert using restriction digestion analysis. .. The plasmid DNA was isolated from an overnight bacterial culture using a convenient plasmid Miniprep method.

    Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins
    Article Snippet: Paragraph title: PcP190 and 5S rDNA isolation, cloning and sequencing ... The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the TransformationAid Bacterial Transformation Kit (Fermentas), following the manufacturer’s instructions.

    Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma
    Article Snippet: The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and TransformAid Bacterial Transformation Kit together with the E. coli strain JM107 were all purchased from Thermo Fisher Scientific (Waltham, MA, USA). .. All plasmids were isolated and purified using an EndoFree Plasmid Mega Kit (Qiagen, Hilden, Germany) according to the instructions provided with the kit.

    Purification:

    Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞
    Article Snippet: Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the TransformAid bacterial transformation kit (Fermentas, Hanover, MD). .. Protein Expression and Purification —The Δ65iNOSoxy W188H mutant with a His6 tag at the C terminus was overexpressed in E. coli strain BL21(DE3) using a modified pCWori vector.

    Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins
    Article Snippet: .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the TransformationAid Bacterial Transformation Kit (Fermentas), following the manufacturer’s instructions. .. Recombinant colonies were identified and plasmid extraction was performed using the mini-prep method described by Sambrook and Russel [ ].

    Article Title: Low Prevalence of Rotavirus and High Prevalence of Norovirus in Hospital and Community Wastewater after Introduction of Rotavirus Vaccine in Nicaragua
    Article Snippet: The NoV NS capsid fragment was cloned into pJET1.2 vector and transformed into E.coli cells using CloneJet™ PCR Cloning and TransformAid™ Bacterial Transformation kits (Fermentas, St. Leon-Rot, Germany) according to the manufacturer's instructions. .. After overnight incubation of positive colonies, plasmid DNA was extracted and purified using GeneJET™ Plasmid Miniprep Kit (Fermentas, St. Leon-Rot, Germany) according to the manufacturer's instructions.

    Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma
    Article Snippet: The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and TransformAid Bacterial Transformation Kit together with the E. coli strain JM107 were all purchased from Thermo Fisher Scientific (Waltham, MA, USA). .. All plasmids were isolated and purified using an EndoFree Plasmid Mega Kit (Qiagen, Hilden, Germany) according to the instructions provided with the kit.

    Electroporation Bacterial Transformation:

    Article Title: Engineering the Production of Major Catechins by Escherichia coli Carrying Metabolite Genes of Camellia sinensis
    Article Snippet: .. The restriction enzymes, DNA ligation kit, genomic DNA purification kit, GeneJET plasmid Miniprep kit, bacterial transformation kit, and IPTG were purchased from Fermentas, whereas KOD Hot Start DNA polymerase was purchased from Novagen. .. All other Chemicals were purchased from Merck (Darmstadt, Germany) and are either of analytical or HPLC grade.

    Article Title: Copper, Zinc-Superoxide Dismutase from Clinically Isolated Escherichia coli: Cloning, Analysis of sodC and Its Possible Role in Pathogenicity
    Article Snippet: .. The TransformAid Bacterial Transformation Kit (MBI, Fermentas) was used for transforming 10 μl of ligation mixture into competent E. coli DH5α cells, spread plated on LB solid medium containing 100 μg/ml ampicillin and incubated at 37°C for 12 h. The recombinant clones were analysed for the presence and orientation of the DNA insert using restriction digestion analysis. .. The plasmid DNA was isolated from an overnight bacterial culture using a convenient plasmid Miniprep method.

    Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India
    Article Snippet: .. The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Transform-aid bacterial transformation kit (Fermentas, Germany) as per manufacturer's protocol. .. Positive transformants were selected by colony PCR with the above mentioned primers and restriction enzyme digestion of recombinant plasmid with Eco RI.

    Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞
    Article Snippet: .. Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the TransformAid bacterial transformation kit (Fermentas, Hanover, MD). .. Protein Expression and Purification —The Δ65iNOSoxy W188H mutant with a His6 tag at the C terminus was overexpressed in E. coli strain BL21(DE3) using a modified pCWori vector.

    Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2
    Article Snippet: .. Ligated DNA was transformed into E . coli ER2738 using the TransformAid bacterial transformation kit (Fermentas, St. Leon-Rot, Germany) according to the manufacturer’s instructions. .. Positive clones were identified using LB/S-Gal/IPTG-plates.

    Article Title: Characterization of Calmodulin-Free Murine Inducible Nitric-Oxide Synthase
    Article Snippet: .. Bacterial transformation The TransformAid Bacterial Transformation Kit (Fermentas, USA) was used to transform Escherichia coli (E .coli ) strains BL21(DE3) and DH5α with iNOS and CaM plasmid DNAs either separately or together using the expression vector pCW through standard procedures [ ]. .. The transformed bacteria were then grown overnight in cultures and stored at -80°C as glycerol stocks for further use.

    Article Title: A connecting hinge represses the activity of endothelial nitric oxide synthase
    Article Snippet: .. Transformations were performed using a TransformAid bacterial transformation kit (Fermentas, Hanover, MD). .. Oligonucleotides used to construct site-directed mutants in nNOS were obtained from Integrated DNA Technologies (Coralville, IA).

    Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins
    Article Snippet: .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the TransformationAid Bacterial Transformation Kit (Fermentas), following the manufacturer’s instructions. .. Recombinant colonies were identified and plasmid extraction was performed using the mini-prep method described by Sambrook and Russel [ ].

    Article Title: Low Prevalence of Rotavirus and High Prevalence of Norovirus in Hospital and Community Wastewater after Introduction of Rotavirus Vaccine in Nicaragua
    Article Snippet: .. The NoV NS capsid fragment was cloned into pJET1.2 vector and transformed into E.coli cells using CloneJet™ PCR Cloning and TransformAid™ Bacterial Transformation kits (Fermentas, St. Leon-Rot, Germany) according to the manufacturer's instructions. .. Ten separate colonies from each transformation reaction were screened by PCR for the correct gene insert.

    Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma
    Article Snippet: .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and TransformAid Bacterial Transformation Kit together with the E. coli strain JM107 were all purchased from Thermo Fisher Scientific (Waltham, MA, USA). ..

    Article Title: A cross-domain charge interaction governs the activity of NO synthase
    Article Snippet: .. Transformations were performed using a TransformAid bacterial transformation kit (Fermentas-Thermo Scientific, Hanover, MD). .. Oligonucleotides used to construct mutants in nNOS were obtained from Integrated DNA Technologies (Coralville, IA).

    Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide
    Article Snippet: .. Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using TransformAid TM Bacterial Transformation Kit (Fermentas, EU). .. After extraction of recombinant plasmids from transformed E. coli , PCR analysis was applied to check the proper insertion of the gene in the recombinant plasmid using T7 promoter-specific primers.

    Staining:

    Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins
    Article Snippet: Chromosome preparations were stained with 10% Giemsa and microdissection was performed using a PALM laser system (Zeiss) equipped with an oil immersion 100x objective. .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the TransformationAid Bacterial Transformation Kit (Fermentas), following the manufacturer’s instructions.

    IA:

    Article Title: A connecting hinge represses the activity of endothelial nitric oxide synthase
    Article Snippet: Transformations were performed using a TransformAid bacterial transformation kit (Fermentas, Hanover, MD). .. Oligonucleotides used to construct site-directed mutants in nNOS were obtained from Integrated DNA Technologies (Coralville, IA).

    Article Title: A cross-domain charge interaction governs the activity of NO synthase
    Article Snippet: Transformations were performed using a TransformAid bacterial transformation kit (Fermentas-Thermo Scientific, Hanover, MD). .. Oligonucleotides used to construct mutants in nNOS were obtained from Integrated DNA Technologies (Coralville, IA).

    Agarose Gel Electrophoresis:

    Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins
    Article Snippet: .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the TransformationAid Bacterial Transformation Kit (Fermentas), following the manufacturer’s instructions. .. Recombinant colonies were identified and plasmid extraction was performed using the mini-prep method described by Sambrook and Russel [ ].

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞
    Article Snippet: Mutations were introduced with the primers: W188H forward, 5′-CAA GAT GGC C CA T AG GAA TGC CCC TCG CTG CAT CGG CAG AAT CCA GTG GTC-3′; W188H reverse, 5′-GAC CAC TGG ATT CTG CCG ATG CAG CGA GGG GCA TTC CT A TG G GCC ATC TTG-3′, the mutation sites are underlined. .. Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the TransformAid bacterial transformation kit (Fermentas, Hanover, MD).

    Countercurrent Chromatography:

    Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞
    Article Snippet: Mutations were introduced with the primers: W188H forward, 5′-CAA GAT GGC C CA T AG GAA TGC CCC TCG CTG CAT CGG CAG AAT CCA GTG GTC-3′; W188H reverse, 5′-GAC CAC TGG ATT CTG CCG ATG CAG CGA GGG GCA TTC CT A TG G GCC ATC TTG-3′, the mutation sites are underlined. .. Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the TransformAid bacterial transformation kit (Fermentas, Hanover, MD).

    Plasmid Preparation:

    Article Title: Engineering the Production of Major Catechins by Escherichia coli Carrying Metabolite Genes of Camellia sinensis
    Article Snippet: .. The restriction enzymes, DNA ligation kit, genomic DNA purification kit, GeneJET plasmid Miniprep kit, bacterial transformation kit, and IPTG were purchased from Fermentas, whereas KOD Hot Start DNA polymerase was purchased from Novagen. .. All other Chemicals were purchased from Merck (Darmstadt, Germany) and are either of analytical or HPLC grade.

    Article Title: Copper, Zinc-Superoxide Dismutase from Clinically Isolated Escherichia coli: Cloning, Analysis of sodC and Its Possible Role in Pathogenicity
    Article Snippet: The TransformAid Bacterial Transformation Kit (MBI, Fermentas) was used for transforming 10 μl of ligation mixture into competent E. coli DH5α cells, spread plated on LB solid medium containing 100 μg/ml ampicillin and incubated at 37°C for 12 h. The recombinant clones were analysed for the presence and orientation of the DNA insert using restriction digestion analysis. .. The plasmid DNA was isolated from an overnight bacterial culture using a convenient plasmid Miniprep method.

    Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India
    Article Snippet: .. The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Transform-aid bacterial transformation kit (Fermentas, Germany) as per manufacturer's protocol. .. Positive transformants were selected by colony PCR with the above mentioned primers and restriction enzyme digestion of recombinant plasmid with Eco RI.

    Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞
    Article Snippet: Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the TransformAid bacterial transformation kit (Fermentas, Hanover, MD). .. Protein Expression and Purification —The Δ65iNOSoxy W188H mutant with a His6 tag at the C terminus was overexpressed in E. coli strain BL21(DE3) using a modified pCWori vector.

    Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2
    Article Snippet: Ligated DNA was transformed into E . coli ER2738 using the TransformAid bacterial transformation kit (Fermentas, St. Leon-Rot, Germany) according to the manufacturer’s instructions. .. Following amplification, phage DNA was extracted using the E.Z.N.A. plasmid miniprep kit I (peqLab, Erlangen, Germany) and inserts were verified by DNA sequencing.

    Article Title: Characterization of Calmodulin-Free Murine Inducible Nitric-Oxide Synthase
    Article Snippet: .. Bacterial transformation The TransformAid Bacterial Transformation Kit (Fermentas, USA) was used to transform Escherichia coli (E .coli ) strains BL21(DE3) and DH5α with iNOS and CaM plasmid DNAs either separately or together using the expression vector pCW through standard procedures [ ]. .. The transformed bacteria were then grown overnight in cultures and stored at -80°C as glycerol stocks for further use.

    Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins
    Article Snippet: .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the TransformationAid Bacterial Transformation Kit (Fermentas), following the manufacturer’s instructions. .. Recombinant colonies were identified and plasmid extraction was performed using the mini-prep method described by Sambrook and Russel [ ].

    Article Title: Low Prevalence of Rotavirus and High Prevalence of Norovirus in Hospital and Community Wastewater after Introduction of Rotavirus Vaccine in Nicaragua
    Article Snippet: .. The NoV NS capsid fragment was cloned into pJET1.2 vector and transformed into E.coli cells using CloneJet™ PCR Cloning and TransformAid™ Bacterial Transformation kits (Fermentas, St. Leon-Rot, Germany) according to the manufacturer's instructions. .. Ten separate colonies from each transformation reaction were screened by PCR for the correct gene insert.

    Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma
    Article Snippet: .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and TransformAid Bacterial Transformation Kit together with the E. coli strain JM107 were all purchased from Thermo Fisher Scientific (Waltham, MA, USA). ..

    Article Title: A cross-domain charge interaction governs the activity of NO synthase
    Article Snippet: Wildtype and mutant rat nNOS proteins containing a His6 tag attached to their N termini were overexpressed in E. coli strain BL21(DE3) using a modified pCWori vector as described ( , ). .. Transformations were performed using a TransformAid bacterial transformation kit (Fermentas-Thermo Scientific, Hanover, MD).

    Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide
    Article Snippet: Paragraph title: Design and construction of hGH secretory expression plasmid ... Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using TransformAid TM Bacterial Transformation Kit (Fermentas, EU).

    Positron Emission Tomography:

    Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide
    Article Snippet: Synthetic gene and the bacterial expression vector (pET-15b) were digested with Nde I and Bam HI enzymes (Fermentas, EU), and the ligation step was performed using Rapid DNA Ligation Kit (Fermentas, EU). .. Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using TransformAid TM Bacterial Transformation Kit (Fermentas, EU).

    Titration:

    Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma
    Article Snippet: To construct pORF-mIL-12-ORT, standard cloning methods and operator-repressor titration (ORT) technology [ , ] were used, followed by transformation into competent (E. coli ) cells ( ). .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and TransformAid Bacterial Transformation Kit together with the E. coli strain JM107 were all purchased from Thermo Fisher Scientific (Waltham, MA, USA).

    Chromosome Walking:

    Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India
    Article Snippet: The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Transform-aid bacterial transformation kit (Fermentas, Germany) as per manufacturer's protocol. .. Double-stranded DNA sequencing of the recombinant clone was performed by primer-walking at the National Facility for DNA Sequencing, University of Delhi South Campus, India and Sequence Analyzer 3730 (Applied Biosystems, USA).

    Produced:

    Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma
    Article Snippet: The mIL-12 expression cassette was cloned into the pCRBluntpsiCat plasmid using NotI , SwaI , and PmlI restriction enzymes, and the antibiotic resistance-free plasmid was produced using the X-mark™ technology and antibiotic-free maintenance system ORT® (Cobra Biologics). .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and TransformAid Bacterial Transformation Kit together with the E. coli strain JM107 were all purchased from Thermo Fisher Scientific (Waltham, MA, USA).

    DNA Purification:

    Article Title: Engineering the Production of Major Catechins by Escherichia coli Carrying Metabolite Genes of Camellia sinensis
    Article Snippet: .. The restriction enzymes, DNA ligation kit, genomic DNA purification kit, GeneJET plasmid Miniprep kit, bacterial transformation kit, and IPTG were purchased from Fermentas, whereas KOD Hot Start DNA polymerase was purchased from Novagen. .. All other Chemicals were purchased from Merck (Darmstadt, Germany) and are either of analytical or HPLC grade.

    CTG Assay:

    Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞
    Article Snippet: Mutations were introduced with the primers: W188H forward, 5′-CAA GAT GGC C CA T AG GAA TGC CCC TCG CTG CAT CGG CAG AAT CCA GTG GTC-3′; W188H reverse, 5′-GAC CAC TGG ATT CTG CCG ATG CAG CGA GGG GCA TTC CT A TG G GCC ATC TTG-3′, the mutation sites are underlined. .. Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the TransformAid bacterial transformation kit (Fermentas, Hanover, MD).

    Gel Extraction:

    Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma
    Article Snippet: .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and TransformAid Bacterial Transformation Kit together with the E. coli strain JM107 were all purchased from Thermo Fisher Scientific (Waltham, MA, USA). ..

    Chick Chorioallantoic Membrane Assay:

    Article Title: Characterization of Calmodulin-Free Murine Inducible Nitric-Oxide Synthase
    Article Snippet: .. Bacterial transformation The TransformAid Bacterial Transformation Kit (Fermentas, USA) was used to transform Escherichia coli (E .coli ) strains BL21(DE3) and DH5α with iNOS and CaM plasmid DNAs either separately or together using the expression vector pCW through standard procedures [ ]. .. The transformed bacteria were then grown overnight in cultures and stored at -80°C as glycerol stocks for further use.

    Laser Capture Microdissection:

    Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins
    Article Snippet: Chromosome preparations were stained with 10% Giemsa and microdissection was performed using a PALM laser system (Zeiss) equipped with an oil immersion 100x objective. .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the TransformationAid Bacterial Transformation Kit (Fermentas), following the manufacturer’s instructions.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher transformaid bacterial transformation kit
    Transformaid Bacterial Transformation Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transformaid bacterial transformation kit/product/Thermo Fisher
    Average 99 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    transformaid bacterial transformation kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results