transformaid bacterial transformation kit (Thermo Fisher)
Thermo Fisher is a verified supplier 
99
|
Name:
TransformAid Bacterial Transformation Kit
Description:
Thermo Scientific TransformAid Bacterial Transformation Kit sufficient for 20 transformations uses a novel method for rapid preparation of chemically competent E coli cells from overnight bacterial cultures or bacterial colonies The key component of this system is the unique T solution which produces competent cells in a few easy steps The quick and convenient procedure guarantees transformation efficiencies of more than 107 transformants per µg of plasmid DNA ideal for routine cloning experiments The option to use bacterial colonies for preparation of competent cells adds flexibility to any cloning experiment The TransformAid Bacterial Transformation Kit can be used with most E coli strains commonly used for cloning JM107 JM109 XL1 Blue SURE TOPP2 W3110 NM527 AD494 CJ236 GM2163 C600 BL21 M15 NM522 HB101 ER2267 Highlights• Efficient more than 107 transformants per µg of plasmid DNA• Practical E coli competent cells can be prepared from an overnight culture or from bacterial colonies• Fast less than 1 hour from the overnight bacterial culture to cell plating Starting from bacterial colonies the procedure requires only 2 5 hours• Easy all procedures are performed on ice on your bench Brief centrifugations are carried out in regular microcentrifugesApplications• Routine cloning experiments• Blunt end cloning• TA cloningIncludes• C Medium• T Solution A • T Solution B • Detailed ProtocolNoteCompetent cells prepared with TransformAid Bacterial Transformation Kit are suitable for direct use only Freezing down and storage at 70°C is not recommended Related ProductsTransformAid Bacterial Transformation Kit
Catalog Number:
k2710
Price:
None
Applications:
Cloning|Transformation
Category:
Competent Cells Strains
|
Buy from Supplier |
Structured Review
Thermo Fisher
transformaid bacterial transformation kit
Thermo Scientific TransformAid Bacterial Transformation Kit sufficient for 20 transformations uses a novel method for rapid preparation of chemically competent E coli cells from overnight bacterial cultures or bacterial colonies The key component of this system is the unique T solution which produces competent cells in a few easy steps The quick and convenient procedure guarantees transformation efficiencies of more than 107 transformants per µg of plasmid DNA ideal for routine cloning experiments The option to use bacterial colonies for preparation of competent cells adds flexibility to any cloning experiment The TransformAid Bacterial Transformation Kit can be used with most E coli strains commonly used for cloning JM107 JM109 XL1 Blue SURE TOPP2 W3110 NM527 AD494 CJ236 GM2163 C600 BL21 M15 NM522 HB101 ER2267 Highlights• Efficient more than 107 transformants per µg of plasmid DNA• Practical E coli competent cells can be prepared from an overnight culture or from bacterial colonies• Fast less than 1 hour from the overnight bacterial culture to cell plating Starting from bacterial colonies the procedure requires only 2 5 hours• Easy all procedures are performed on ice on your bench Brief centrifugations are carried out in regular microcentrifugesApplications• Routine cloning experiments• Blunt end cloning• TA cloningIncludes• C Medium• T Solution A • T Solution B • Detailed ProtocolNoteCompetent cells prepared with TransformAid Bacterial Transformation Kit are suitable for direct use only Freezing down and storage at 70°C is not recommended Related ProductsTransformAid Bacterial Transformation Kit
https://www.bioz.com/result/transformaid bacterial transformation kit/product/Thermo Fisher
Average 99 stars, based on 28 article reviews
Price from $9.99 to $1999.99
Thermo Scientific TransformAid Bacterial Transformation Kit sufficient for 20 transformations uses a novel method for rapid preparation of chemically competent E coli cells from overnight bacterial cultures or bacterial colonies The key component of this system is the unique T solution which produces competent cells in a few easy steps The quick and convenient procedure guarantees transformation efficiencies of more than 107 transformants per µg of plasmid DNA ideal for routine cloning experiments The option to use bacterial colonies for preparation of competent cells adds flexibility to any cloning experiment The TransformAid Bacterial Transformation Kit can be used with most E coli strains commonly used for cloning JM107 JM109 XL1 Blue SURE TOPP2 W3110 NM527 AD494 CJ236 GM2163 C600 BL21 M15 NM522 HB101 ER2267 Highlights• Efficient more than 107 transformants per µg of plasmid DNA• Practical E coli competent cells can be prepared from an overnight culture or from bacterial colonies• Fast less than 1 hour from the overnight bacterial culture to cell plating Starting from bacterial colonies the procedure requires only 2 5 hours• Easy all procedures are performed on ice on your bench Brief centrifugations are carried out in regular microcentrifugesApplications• Routine cloning experiments• Blunt end cloning• TA cloningIncludes• C Medium• T Solution A • T Solution B • Detailed ProtocolNoteCompetent cells prepared with TransformAid Bacterial Transformation Kit are suitable for direct use only Freezing down and storage at 70°C is not recommended Related ProductsTransformAid Bacterial Transformation Kit
https://www.bioz.com/result/transformaid bacterial transformation kit/product/Thermo Fisher
Average 99 stars, based on 28 article reviews
Price from $9.99 to $1999.99
transformaid bacterial transformation kit - by Bioz Stars,
2020-04
99/100 stars
Related Products / Commonly Used Together
Images
Related Articles
Clone Assay:Article Title: Copper, Zinc-Superoxide Dismutase from Clinically Isolated Escherichia coli: Cloning, Analysis of sodC and Its Possible Role in Pathogenicity Article Snippet: .. The Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India Article Snippet: Paragraph title: Cloning and nucleotide sequencing ... The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2 Article Snippet: Molecular Cloning of Phage Binding Sequence Motifs and Variants Thereof Modification of the phage binding motif was achieved by standard cloning procedures. .. Ligated DNA was transformed into E . coli ER2738 using the Article Title: A connecting hinge represses the activity of endothelial nitric oxide synthase Article Snippet: Restriction digestions, cloning, and bacterial growth were performed using standard procedures. .. Transformations were performed using a Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins Article Snippet: Paragraph title: PcP190 and 5S rDNA isolation, cloning and sequencing ... The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the Article Title: Low Prevalence of Rotavirus and High Prevalence of Norovirus in Hospital and Community Wastewater after Introduction of Rotavirus Vaccine in Nicaragua Article Snippet: .. The NoV NS capsid fragment was cloned into pJET1.2 vector and transformed into E.coli cells using CloneJet™ PCR Cloning and Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma Article Snippet: The mIL-12 expression cassette was cloned into the pCRBluntpsiCat plasmid using NotI , SwaI , and PmlI restriction enzymes, and the antibiotic resistance-free plasmid was produced using the X-mark™ technology and antibiotic-free maintenance system ORT® (Cobra Biologics). .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and Article Title: A cross-domain charge interaction governs the activity of NO synthase Article Snippet: Restriction digestions, cloning, and bacterial growth were performed using standard procedures. .. Transformations were performed using a Amplification:Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2 Article Snippet: Ligated DNA was transformed into E . coli ER2738 using the Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins Article Snippet: .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the Article Title: Low Prevalence of Rotavirus and High Prevalence of Norovirus in Hospital and Community Wastewater after Introduction of Rotavirus Vaccine in Nicaragua Article Snippet: Paragraph title: PCR amplification and cloning of the NoV N-terminal and shell (NS) region ... The NoV NS capsid fragment was cloned into pJET1.2 vector and transformed into E.coli cells using CloneJet™ PCR Cloning and Binding Assay:Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2 Article Snippet: Paragraph title: Molecular Cloning of Phage Binding Sequence Motifs and Variants Thereof ... Ligated DNA was transformed into E . coli ER2738 using the DNA Ligation:Article Title: Engineering the Production of Major Catechins by Escherichia coli Carrying Metabolite Genes of Camellia sinensis Article Snippet: .. The restriction enzymes, DNA ligation kit, genomic DNA purification kit, GeneJET plasmid Miniprep kit, Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide Article Snippet: Synthetic gene and the bacterial expression vector (pET-15b) were digested with Nde I and Bam HI enzymes (Fermentas, EU), and the ligation step was performed using Rapid DNA Ligation Kit (Fermentas, EU). .. Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using Polymerase Chain Reaction:Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India Article Snippet: .. The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins Article Snippet: .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the Article Title: Low Prevalence of Rotavirus and High Prevalence of Norovirus in Hospital and Community Wastewater after Introduction of Rotavirus Vaccine in Nicaragua Article Snippet: .. The NoV NS capsid fragment was cloned into pJET1.2 vector and transformed into E.coli cells using CloneJet™ PCR Cloning and Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide Article Snippet: Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using Construct:Article Title: A connecting hinge represses the activity of endothelial nitric oxide synthase Article Snippet: Transformations were performed using a Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma Article Snippet: To construct pORF-mIL-12-ORT, standard cloning methods and operator-repressor titration (ORT) technology [ , ] were used, followed by transformation into competent (E. coli ) cells ( ). .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and Article Title: A cross-domain charge interaction governs the activity of NO synthase Article Snippet: Transformations were performed using a Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide Article Snippet: Codon-optimized synthetic hGH containing L-asparaginase II signal sequence was prepared from Generay Biotech (Shanghai, China), after embedding the Nde I and Bam HI restriction endonuclease cut sites in the N- and C-terminal of the gene construct, respectively. .. Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using Electrophoresis:Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins Article Snippet: .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the Incubation:Article Title: Copper, Zinc-Superoxide Dismutase from Clinically Isolated Escherichia coli: Cloning, Analysis of sodC and Its Possible Role in Pathogenicity Article Snippet: .. The Article Title: Low Prevalence of Rotavirus and High Prevalence of Norovirus in Hospital and Community Wastewater after Introduction of Rotavirus Vaccine in Nicaragua Article Snippet: The NoV NS capsid fragment was cloned into pJET1.2 vector and transformed into E.coli cells using CloneJet™ PCR Cloning and Expressing:Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞ Article Snippet: Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the Article Title: Characterization of Calmodulin-Free Murine Inducible Nitric-Oxide Synthase Article Snippet: .. Bacterial transformation The Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma Article Snippet: The mIL-12 expression cassette was cloned into the pCRBluntpsiCat plasmid using NotI , SwaI , and PmlI restriction enzymes, and the antibiotic resistance-free plasmid was produced using the X-mark™ technology and antibiotic-free maintenance system ORT® (Cobra Biologics). .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and Article Title: A cross-domain charge interaction governs the activity of NO synthase Article Snippet: Paragraph title: Preparation of nNOS expression plasmids ... Transformations were performed using a Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide Article Snippet: Paragraph title: Design and construction of hGH secretory expression plasmid ... Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using Modification:Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞ Article Snippet: Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2 Article Snippet: Molecular Cloning of Phage Binding Sequence Motifs and Variants Thereof Modification of the phage binding motif was achieved by standard cloning procedures. .. Ligated DNA was transformed into E . coli ER2738 using the Article Title: A cross-domain charge interaction governs the activity of NO synthase Article Snippet: Wildtype and mutant rat nNOS proteins containing a His6 tag attached to their N termini were overexpressed in E. coli strain BL21(DE3) using a modified pCWori vector as described ( , ). .. Transformations were performed using a Transformation Assay:Article Title: Copper, Zinc-Superoxide Dismutase from Clinically Isolated Escherichia coli: Cloning, Analysis of sodC and Its Possible Role in Pathogenicity Article Snippet: Paragraph title: Transformation of sodC Cloned pTZ57R into E. coli DH5α ... The Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India Article Snippet: .. The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞ Article Snippet: .. Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2 Article Snippet: .. Ligated DNA was transformed into E . coli ER2738 using the Article Title: Characterization of Calmodulin-Free Murine Inducible Nitric-Oxide Synthase Article Snippet: Bacterial transformation The Article Title: Low Prevalence of Rotavirus and High Prevalence of Norovirus in Hospital and Community Wastewater after Introduction of Rotavirus Vaccine in Nicaragua Article Snippet: .. The NoV NS capsid fragment was cloned into pJET1.2 vector and transformed into E.coli cells using CloneJet™ PCR Cloning and Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma Article Snippet: To construct pORF-mIL-12-ORT, standard cloning methods and operator-repressor titration (ORT) technology [ , ] were used, followed by transformation into competent (E. coli ) cells ( ). .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide Article Snippet: .. Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using Derivative Assay:Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins Article Snippet: Because the PcP190 satellite DNA is derived from 5S rDNA [ ], we analyzed 5S rDNA sequences from Pseudis tocantins , which were isolated by PCR with the primers 5S-A (5’-TACGCCCGATCTCGTCCGATC-3’) and 5S-B (5’–CAGGCTGGTATGGCCGTAAGC–3’) [ ]. .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the High Performance Liquid Chromatography:Article Title: Engineering the Production of Major Catechins by Escherichia coli Carrying Metabolite Genes of Camellia sinensis Article Snippet: The restriction enzymes, DNA ligation kit, genomic DNA purification kit, GeneJET plasmid Miniprep kit, Ligation:Article Title: Copper, Zinc-Superoxide Dismutase from Clinically Isolated Escherichia coli: Cloning, Analysis of sodC and Its Possible Role in Pathogenicity Article Snippet: .. The Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma Article Snippet: .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide Article Snippet: .. Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using Generated:Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India Article Snippet: Viral RNA from JEV-infected PS cells was reverse-transcribed using reverse primer and Stratascript reverse transcriptase. cDNA copies were generated by PCR using Dream Taq PCR mix (Fermentas, Germany). .. The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using DNA Sequencing:Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India Article Snippet: The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2 Article Snippet: Ligated DNA was transformed into E . coli ER2738 using the Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins Article Snippet: The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the Article Title: A cross-domain charge interaction governs the activity of NO synthase Article Snippet: Transformations were performed using a Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide Article Snippet: Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using Sequencing:Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India Article Snippet: Paragraph title: Cloning and nucleotide sequencing ... The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2 Article Snippet: Paragraph title: Molecular Cloning of Phage Binding Sequence Motifs and Variants Thereof ... Ligated DNA was transformed into E . coli ER2738 using the Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins Article Snippet: Paragraph title: PcP190 and 5S rDNA isolation, cloning and sequencing ... The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the Article Title: Low Prevalence of Rotavirus and High Prevalence of Norovirus in Hospital and Community Wastewater after Introduction of Rotavirus Vaccine in Nicaragua Article Snippet: The NoV NS capsid fragment was cloned into pJET1.2 vector and transformed into E.coli cells using CloneJet™ PCR Cloning and Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide Article Snippet: Codon-optimized synthetic hGH containing L-asparaginase II signal sequence was prepared from Generay Biotech (Shanghai, China), after embedding the Nde I and Bam HI restriction endonuclease cut sites in the N- and C-terminal of the gene construct, respectively. .. Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using Recombinant:Article Title: Copper, Zinc-Superoxide Dismutase from Clinically Isolated Escherichia coli: Cloning, Analysis of sodC and Its Possible Role in Pathogenicity Article Snippet: .. The Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India Article Snippet: The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins Article Snippet: The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide Article Snippet: Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using Molecular Cloning:Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2 Article Snippet: Paragraph title: Molecular Cloning of Phage Binding Sequence Motifs and Variants Thereof ... Ligated DNA was transformed into E . coli ER2738 using the Mutagenesis:Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞ Article Snippet: Mutations were introduced with the primers: W188H forward, 5′-CAA GAT GGC C CA T AG GAA TGC CCC TCG CTG CAT CGG CAG AAT CCA GTG GTC-3′; W188H reverse, 5′-GAC CAC TGG ATT CTG CCG ATG CAG CGA GGG GCA TTC CT A TG G GCC ATC TTG-3′, the mutation sites are underlined. .. Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the Article Title: A connecting hinge represses the activity of endothelial nitric oxide synthase Article Snippet: Transformations were performed using a Article Title: A cross-domain charge interaction governs the activity of NO synthase Article Snippet: Wildtype and mutant rat nNOS proteins containing a His6 tag attached to their N termini were overexpressed in E. coli strain BL21(DE3) using a modified pCWori vector as described ( , ). .. Transformations were performed using a Isolation:Article Title: Copper, Zinc-Superoxide Dismutase from Clinically Isolated Escherichia coli: Cloning, Analysis of sodC and Its Possible Role in Pathogenicity Article Snippet: The Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins Article Snippet: Paragraph title: PcP190 and 5S rDNA isolation, cloning and sequencing ... The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma Article Snippet: The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and Purification:Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞ Article Snippet: Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins Article Snippet: .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the Article Title: Low Prevalence of Rotavirus and High Prevalence of Norovirus in Hospital and Community Wastewater after Introduction of Rotavirus Vaccine in Nicaragua Article Snippet: The NoV NS capsid fragment was cloned into pJET1.2 vector and transformed into E.coli cells using CloneJet™ PCR Cloning and Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma Article Snippet: The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and Electroporation Bacterial Transformation:Article Title: Engineering the Production of Major Catechins by Escherichia coli Carrying Metabolite Genes of Camellia sinensis Article Snippet: .. The restriction enzymes, DNA ligation kit, genomic DNA purification kit, GeneJET plasmid Miniprep kit, Article Title: Copper, Zinc-Superoxide Dismutase from Clinically Isolated Escherichia coli: Cloning, Analysis of sodC and Its Possible Role in Pathogenicity Article Snippet: .. The Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India Article Snippet: .. The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞ Article Snippet: .. Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2 Article Snippet: .. Ligated DNA was transformed into E . coli ER2738 using the Article Title: Characterization of Calmodulin-Free Murine Inducible Nitric-Oxide Synthase Article Snippet: .. Bacterial transformation The Article Title: A connecting hinge represses the activity of endothelial nitric oxide synthase Article Snippet: .. Transformations were performed using a Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins Article Snippet: .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the Article Title: Low Prevalence of Rotavirus and High Prevalence of Norovirus in Hospital and Community Wastewater after Introduction of Rotavirus Vaccine in Nicaragua Article Snippet: .. The NoV NS capsid fragment was cloned into pJET1.2 vector and transformed into E.coli cells using CloneJet™ PCR Cloning and Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma Article Snippet: .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and Article Title: A cross-domain charge interaction governs the activity of NO synthase Article Snippet: .. Transformations were performed using a Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide Article Snippet: .. Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using Staining:Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins Article Snippet: Chromosome preparations were stained with 10% Giemsa and microdissection was performed using a PALM laser system (Zeiss) equipped with an oil immersion 100x objective. .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the IA:Article Title: A connecting hinge represses the activity of endothelial nitric oxide synthase Article Snippet: Transformations were performed using a Article Title: A cross-domain charge interaction governs the activity of NO synthase Article Snippet: Transformations were performed using a Agarose Gel Electrophoresis:Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins Article Snippet: .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the Chloramphenicol Acetyltransferase Assay:Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞ Article Snippet: Mutations were introduced with the primers: W188H forward, 5′-CAA GAT GGC C CA T AG GAA TGC CCC TCG CTG CAT CGG CAG AAT CCA GTG GTC-3′; W188H reverse, 5′-GAC CAC TGG ATT CTG CCG ATG CAG CGA GGG GCA TTC CT A TG G GCC ATC TTG-3′, the mutation sites are underlined. .. Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the Countercurrent Chromatography:Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞ Article Snippet: Mutations were introduced with the primers: W188H forward, 5′-CAA GAT GGC C CA T AG GAA TGC CCC TCG CTG CAT CGG CAG AAT CCA GTG GTC-3′; W188H reverse, 5′-GAC CAC TGG ATT CTG CCG ATG CAG CGA GGG GCA TTC CT A TG G GCC ATC TTG-3′, the mutation sites are underlined. .. Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the Plasmid Preparation:Article Title: Engineering the Production of Major Catechins by Escherichia coli Carrying Metabolite Genes of Camellia sinensis Article Snippet: .. The restriction enzymes, DNA ligation kit, genomic DNA purification kit, GeneJET plasmid Miniprep kit, Article Title: Copper, Zinc-Superoxide Dismutase from Clinically Isolated Escherichia coli: Cloning, Analysis of sodC and Its Possible Role in Pathogenicity Article Snippet: The Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India Article Snippet: .. The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞ Article Snippet: Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the Article Title: Identification and Tumour-Binding Properties of a Peptide with High Affinity to the Disialoganglioside GD2 Article Snippet: Ligated DNA was transformed into E . coli ER2738 using the Article Title: Characterization of Calmodulin-Free Murine Inducible Nitric-Oxide Synthase Article Snippet: .. Bacterial transformation The Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins Article Snippet: .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the Article Title: Low Prevalence of Rotavirus and High Prevalence of Norovirus in Hospital and Community Wastewater after Introduction of Rotavirus Vaccine in Nicaragua Article Snippet: .. The NoV NS capsid fragment was cloned into pJET1.2 vector and transformed into E.coli cells using CloneJet™ PCR Cloning and Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma Article Snippet: .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and Article Title: A cross-domain charge interaction governs the activity of NO synthase Article Snippet: Wildtype and mutant rat nNOS proteins containing a His6 tag attached to their N termini were overexpressed in E. coli strain BL21(DE3) using a modified pCWori vector as described ( , ). .. Transformations were performed using a Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide Article Snippet: Paragraph title: Design and construction of hGH secretory expression plasmid ... Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using Positron Emission Tomography:Article Title: Evaluation of Recombinant Human Growth Hormone Secretion in E. coli using the L-asparaginase II Signal Peptide Article Snippet: Synthetic gene and the bacterial expression vector (pET-15b) were digested with Nde I and Bam HI enzymes (Fermentas, EU), and the ligation step was performed using Rapid DNA Ligation Kit (Fermentas, EU). .. Competent E. coil BL21 (DE3) cells were transformed with ligation mixture using Titration:Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma Article Snippet: To construct pORF-mIL-12-ORT, standard cloning methods and operator-repressor titration (ORT) technology [ , ] were used, followed by transformation into competent (E. coli ) cells ( ). .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and Chromosome Walking:Article Title: Isolation and genetic characterization of Japanese encephalitis virus from equines in India Article Snippet: The PCR products were ligated into a pGEMT-Easy vector (Promega, USA) and transformed into E. coli JM109 cells (Promega, USA) using Produced:Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma Article Snippet: The mIL-12 expression cassette was cloned into the pCRBluntpsiCat plasmid using NotI , SwaI , and PmlI restriction enzymes, and the antibiotic resistance-free plasmid was produced using the X-mark™ technology and antibiotic-free maintenance system ORT® (Cobra Biologics). .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and DNA Purification:Article Title: Engineering the Production of Major Catechins by Escherichia coli Carrying Metabolite Genes of Camellia sinensis Article Snippet: .. The restriction enzymes, DNA ligation kit, genomic DNA purification kit, GeneJET plasmid Miniprep kit, CTG Assay:Article Title: Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase *Stabilization and Characterization of a Heme-Oxy Reaction Intermediate in Inducible Nitric-oxide Synthase * S⃞ Article Snippet: Mutations were introduced with the primers: W188H forward, 5′-CAA GAT GGC C CA T AG GAA TGC CCC TCG CTG CAT CGG CAG AAT CCA GTG GTC-3′; W188H reverse, 5′-GAC CAC TGG ATT CTG CCG ATG CAG CGA GGG GCA TTC CT A TG G GCC ATC TTG-3′, the mutation sites are underlined. .. Mutated plasmids were transformed into BL21(DE3) Escherichia coli cells using the Gel Extraction:Article Title: Gene Electrotransfer of Plasmid-Encoding IL-12 Recruits the M1 Macrophages and Antigen-Presenting Cells Inducing the Eradication of Aggressive B16F10 Murine Melanoma Article Snippet: .. The restriction enzymes, Ligation Kit, Gel Extraction Kit, Plasmid Miniprep Kit, and Chick Chorioallantoic Membrane Assay:Article Title: Characterization of Calmodulin-Free Murine Inducible Nitric-Oxide Synthase Article Snippet: .. Bacterial transformation The Laser Capture Microdissection:Article Title: Unraveling the Sex Chromosome Heteromorphism of the Paradoxical Frog Pseudis tocantins Article Snippet: Chromosome preparations were stained with 10% Giemsa and microdissection was performed using a PALM laser system (Zeiss) equipped with an oil immersion 100x objective. .. The amplified fragments of the PcP190 and 5S rDNA sequences were analyzed by electrophoresis in 1% agarose gel, purified using the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T Easy Vector (Promega) and introduced into an E . coli JM109 strain employing the |