thin walled frosted lid  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Name:
    Thin walled frosted lid
    Description:
    The Ambion thin walled flat frosted cap provides a suitable surface for detailed labeling 0 2 mL tubes are provided in a box of 1 000 Each lot of tubes is certified RNAse and DNase free
    Catalog Number:
    am12225
    Price:
    None
    Applications:
    One-Step RT-PCR|PCR|PCR & Real-Time PCR|PCR Tubes, Plates & Accessories|RT-PCR|Real Time PCR (qPCR)|Reverse Transcription|Tubes, Plates & Accessories for Real-Time PCR|Two-Step RT-PCR
    Category:
    Lab Supplies Plastics Glassware
    Buy from Supplier


    Structured Review

    Thermo Fisher thin walled frosted lid
    The Ambion thin walled flat frosted cap provides a suitable surface for detailed labeling 0 2 mL tubes are provided in a box of 1 000 Each lot of tubes is certified RNAse and DNase free
    https://www.bioz.com/result/thin walled frosted lid/product/Thermo Fisher
    Average 92 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    thin walled frosted lid - by Bioz Stars, 2020-08
    92/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Generating Mouse Models Using CRISPR-Cas9 Mediated Genome Editing
    Article Snippet: .. TE buffer: 10 mM Tris-HCl, 0.1 mM EDTA, pH 7.5, DNase and RNase free Cas9 mRNA: 500 ng/μL sgRNA: 500 ng/μL donor oligonucleotide: 500 ng/μL donor plasmid: 500 ng/μL RNase-free PCR tubes (0.2 mL) (Cat. No. AM12225, Life Technologies) RNase-free Microfuge Tubes (0.5 mL) (Catalog No. AM12300, Life Technologies) RNase-free Microfuge Tubes (1.5 mL) (Cat. No. AM12400, Life Technologies) .. Add CRISPR-Cas9 components, including Cas9 mRNA, sgRNA and donor oligonucleotide or plasmid, into an RNase free vial, and bring up to the final volume with TE buffer.

    Article Title: Assaying the Effects of Splice Site Variants by Exon Trapping in a Mammalian Cell Line
    Article Snippet: .. 1.5 ml Eppendorf tubes (VWR, catalog number: 20170-022) Petri dishes, 100 × 15 mm (VWR, catalog number: 25384-302) Whatman GD/X syringe filters, 0.2 μm pore size (Whatman, catalog number: 6901-2502) BD 60 ml syringes, Luer-Lok Tip (BD, catalog number: 309653) Pasteur glass pipettes, 230 mm (for spreading bacteria on plates) (WHEATON, catalog number: 357335) 2 ml cryovial, self-standing (Simport, catalog number: T310-2A) 50 ml polypropylene conical tube, Falcon (Corning, Falcon™, catalog number: 352070) 0.5 ml PCR tubes (Thermo Fisher Scientific, Invitrogen™, catalog number: AM12275) JM109 E. coli competent cells (Promega, catalog number: L2001) pSPL3 vector (Thermo Fisher Scientific, Invitrogen) Restriction endonuclease, Xho I (New England Biolabs, catalog number: R0146S) Restriction endonuclease, Bam HI (New England Biolabs, catalog number: R0136S) QIAquick PCR Purification Kit (QIAGEN, catalog number: 28104) T4 DNA ligase (New England Biolabs, catalog number: M0202S) SOC medium (Thermo Fisher Scientific, Invitrogen™, catalog number: 15544034) Luria Bertani broth (Lennox) powder microbial growth medium (Sigma-Aldrich, catalog number: L3022) Select Agar (Thermo Fisher Scientific, Invitrogen™, catalog number: 30391023) Carbenicillin, disodium salt (Dot Scientific, catalog number: DSC46000-5) Glycerol (Sigma-Aldrich, catalog number: G5516) QIAprep Spin Miniprep Kit (QIAGEN, catalog number: 27104) Carbenicillin antibiotic, 1,000x (see Recipes) LB (Luria-Bertani) medium with carbenicillin antibiotic (see Recipes) LB agar with carbenicillin antibiotic plates (see Recipes) .. Serological pipettes 5 ml (Corning, Costar® , catalog number: 4487) 10 ml (Corning, Costar® , catalog number: 4488) 25 ml (Corning, Costar® , catalog number: 4489) Transfer pipette, polyethylene, general purpose blood bank, bulb draw 1.9 ml, sterile (Sigma-Aldrich, catalog number: Z350699) Pasteur glass pipettes, 5.75” (for aspiration) (VWR, catalog number: 14673-010) 25 cm2 (T25) cell culture flasks with 0.2 μm vent caps (Corning, catalog number: 430639) COS-7 mammalian cells (ATCC, catalog number: CRL-1651) Dulbecco’s modified Eagle’s medium, DMEM, + GlutaMAX-1 cell culture medium (Thermo Fisher Scientific, Gibco™, catalog number: 10569010) Fetal bovine serum, FBS (Thermo Fisher Scientific, Gibco™, catalog number: 10437028) Phosphate-buffered saline, PBS, pH 7.4, 1x (Thermo Fisher Scientific, Gibco™, catalog number: 10010023) Penicillin-streptomycin, 10,000 U/ml (Thermo Fisher Scientific, Gibco™, catalog number: 15140122) Trypsin-EDTA (0.5%), no phenol red (Thermo Fisher Scientific, Gibco™, catalog number: 15400054) FuGENE 6 Transfection Reagent (Promega, catalog number: E2691) Opti-MEM I reduced serum medium (Thermo Fisher Scientific, Gibco™, catalog number: 31985062)

    Article Title: Assaying the Effects of Splice Site Variants by Exon Trapping in a Mammalian Cell Line
    Article Snippet: .. 0.2 ml PCR tubes with caps (Thermo Fisher Scientific, Invitrogen™, catalog number: AM12225) HotStarTaq DNA polymerase (QIAGEN, catalog number: 203203) TE buffer, 10 mM Tris 1 mM EDTA pH 8.0 (Sigma-Aldrich, catalog number: 93283) Vector-specific oligonucleotide primers (Integrated DNA Technologies; ): V1-F: 5’-TCTGAGTCACCTGGACAACC-3’ V2-R: 5’-ATCTCAGTGGTATTTGTGAGC-3’ Note: Resuspend primers and make 10 μM stocks with TE buffer. ..

    Article Title: Multimodal profiling of single-cell morphology, electrophysiology and gene expression using Patch-seq
    Article Snippet: .. 1.16 mm; 10 cm length; without filament; Sutter Instrument, cat. no. B200-116-10) BD 1 mL disposable syringe, tuberculin slip tip (Patterson Veterinary, cat. no. 078821438) Thin-walled, RNase-free 0.2 mL PCR tubes (Thermo Fisher Scientific, cat. no. AM 12225) 13 mm syringe filter with 0.2 μm PTFE membrane (VWR, cat. no. 28145–491) 96-well polypropylene deep well plates (VWR, cat. no. 47743–996) High Sensitivity DNA Kit (Agilent, cat. no. 5067–4626) Superfrost plus gold microscope slides (Thermo Fisher Scientific, cat. no. FT-4981I-GL+) Micro cover glass (VWR, cat. no. 48404–454) .. CRITICAL All glassware, spatulas, stir bars, pipettes and pipette tips should certified RNase-free and/or be cleaned thoroughly with RNase Zap prior to preparing any RNase-free solution.

    Article Title: Assaying the Effects of Splice Site Variants by Exon Trapping in a Mammalian Cell Line
    Article Snippet: .. 0.2 ml PCR tubes with caps (Thermo Fisher Scientific, Invitrogen™, catalog number: AM12225) 1.5 ml conical base screw cap tube (USA Scientific, catalog number: 1415-8399) Human genomic DNA samples with and without splice site variant (20 ng/μl) TE buffer, 10 mM Tris 1 mM EDTA pH 8.0 (Sigma-Aldrich, catalog number: 93283) Custom-synthesized oligonucleotide primers incorporating restriction endonuclease sites to the 5’ end (Integrated DNA Technologies; ): TEK_E5-F: 5’-ctgactga CTCGAG CACAGCTCCAGCCTGTAACCAT -3’ TEK_E5-R: 5’-tcagtcag GGATCC TCGGAACTACTTGGGAGCCTGT -3’ TEK_E22-F: 5’-ctgactga CTCGAG ATTCCAAGGCAAATGCTGCTCT -3’ TEK_E22-R: 5’-tcagtcag GGATCC TTGACTCCCAGATCGGTACAGC -3’ Note: Genome-specific sequences are underlined, restriction sites are shown in BOLD and an extra 8 bp added to the 5’ end are shown in lowercase. .. 5’-CTCGAG-3’ is the recognition sequence for XhoI and 5’-GGATCC-3’ is the recognition sequence for BamHI.

    Variant Assay:

    Article Title: Assaying the Effects of Splice Site Variants by Exon Trapping in a Mammalian Cell Line
    Article Snippet: .. 0.2 ml PCR tubes with caps (Thermo Fisher Scientific, Invitrogen™, catalog number: AM12225) 1.5 ml conical base screw cap tube (USA Scientific, catalog number: 1415-8399) Human genomic DNA samples with and without splice site variant (20 ng/μl) TE buffer, 10 mM Tris 1 mM EDTA pH 8.0 (Sigma-Aldrich, catalog number: 93283) Custom-synthesized oligonucleotide primers incorporating restriction endonuclease sites to the 5’ end (Integrated DNA Technologies; ): TEK_E5-F: 5’-ctgactga CTCGAG CACAGCTCCAGCCTGTAACCAT -3’ TEK_E5-R: 5’-tcagtcag GGATCC TCGGAACTACTTGGGAGCCTGT -3’ TEK_E22-F: 5’-ctgactga CTCGAG ATTCCAAGGCAAATGCTGCTCT -3’ TEK_E22-R: 5’-tcagtcag GGATCC TTGACTCCCAGATCGGTACAGC -3’ Note: Genome-specific sequences are underlined, restriction sites are shown in BOLD and an extra 8 bp added to the 5’ end are shown in lowercase. .. 5’-CTCGAG-3’ is the recognition sequence for XhoI and 5’-GGATCC-3’ is the recognition sequence for BamHI.

    Plasmid Preparation:

    Article Title: Generating Mouse Models Using CRISPR-Cas9 Mediated Genome Editing
    Article Snippet: .. TE buffer: 10 mM Tris-HCl, 0.1 mM EDTA, pH 7.5, DNase and RNase free Cas9 mRNA: 500 ng/μL sgRNA: 500 ng/μL donor oligonucleotide: 500 ng/μL donor plasmid: 500 ng/μL RNase-free PCR tubes (0.2 mL) (Cat. No. AM12225, Life Technologies) RNase-free Microfuge Tubes (0.5 mL) (Catalog No. AM12300, Life Technologies) RNase-free Microfuge Tubes (1.5 mL) (Cat. No. AM12400, Life Technologies) .. Add CRISPR-Cas9 components, including Cas9 mRNA, sgRNA and donor oligonucleotide or plasmid, into an RNase free vial, and bring up to the final volume with TE buffer.

    Article Title: Assaying the Effects of Splice Site Variants by Exon Trapping in a Mammalian Cell Line
    Article Snippet: .. 1.5 ml Eppendorf tubes (VWR, catalog number: 20170-022) Petri dishes, 100 × 15 mm (VWR, catalog number: 25384-302) Whatman GD/X syringe filters, 0.2 μm pore size (Whatman, catalog number: 6901-2502) BD 60 ml syringes, Luer-Lok Tip (BD, catalog number: 309653) Pasteur glass pipettes, 230 mm (for spreading bacteria on plates) (WHEATON, catalog number: 357335) 2 ml cryovial, self-standing (Simport, catalog number: T310-2A) 50 ml polypropylene conical tube, Falcon (Corning, Falcon™, catalog number: 352070) 0.5 ml PCR tubes (Thermo Fisher Scientific, Invitrogen™, catalog number: AM12275) JM109 E. coli competent cells (Promega, catalog number: L2001) pSPL3 vector (Thermo Fisher Scientific, Invitrogen) Restriction endonuclease, Xho I (New England Biolabs, catalog number: R0146S) Restriction endonuclease, Bam HI (New England Biolabs, catalog number: R0136S) QIAquick PCR Purification Kit (QIAGEN, catalog number: 28104) T4 DNA ligase (New England Biolabs, catalog number: M0202S) SOC medium (Thermo Fisher Scientific, Invitrogen™, catalog number: 15544034) Luria Bertani broth (Lennox) powder microbial growth medium (Sigma-Aldrich, catalog number: L3022) Select Agar (Thermo Fisher Scientific, Invitrogen™, catalog number: 30391023) Carbenicillin, disodium salt (Dot Scientific, catalog number: DSC46000-5) Glycerol (Sigma-Aldrich, catalog number: G5516) QIAprep Spin Miniprep Kit (QIAGEN, catalog number: 27104) Carbenicillin antibiotic, 1,000x (see Recipes) LB (Luria-Bertani) medium with carbenicillin antibiotic (see Recipes) LB agar with carbenicillin antibiotic plates (see Recipes) .. Serological pipettes 5 ml (Corning, Costar® , catalog number: 4487) 10 ml (Corning, Costar® , catalog number: 4488) 25 ml (Corning, Costar® , catalog number: 4489) Transfer pipette, polyethylene, general purpose blood bank, bulb draw 1.9 ml, sterile (Sigma-Aldrich, catalog number: Z350699) Pasteur glass pipettes, 5.75” (for aspiration) (VWR, catalog number: 14673-010) 25 cm2 (T25) cell culture flasks with 0.2 μm vent caps (Corning, catalog number: 430639) COS-7 mammalian cells (ATCC, catalog number: CRL-1651) Dulbecco’s modified Eagle’s medium, DMEM, + GlutaMAX-1 cell culture medium (Thermo Fisher Scientific, Gibco™, catalog number: 10569010) Fetal bovine serum, FBS (Thermo Fisher Scientific, Gibco™, catalog number: 10437028) Phosphate-buffered saline, PBS, pH 7.4, 1x (Thermo Fisher Scientific, Gibco™, catalog number: 10010023) Penicillin-streptomycin, 10,000 U/ml (Thermo Fisher Scientific, Gibco™, catalog number: 15140122) Trypsin-EDTA (0.5%), no phenol red (Thermo Fisher Scientific, Gibco™, catalog number: 15400054) FuGENE 6 Transfection Reagent (Promega, catalog number: E2691) Opti-MEM I reduced serum medium (Thermo Fisher Scientific, Gibco™, catalog number: 31985062)

    Article Title: Assaying the Effects of Splice Site Variants by Exon Trapping in a Mammalian Cell Line
    Article Snippet: .. 0.2 ml PCR tubes with caps (Thermo Fisher Scientific, Invitrogen™, catalog number: AM12225) HotStarTaq DNA polymerase (QIAGEN, catalog number: 203203) TE buffer, 10 mM Tris 1 mM EDTA pH 8.0 (Sigma-Aldrich, catalog number: 93283) Vector-specific oligonucleotide primers (Integrated DNA Technologies; ): V1-F: 5’-TCTGAGTCACCTGGACAACC-3’ V2-R: 5’-ATCTCAGTGGTATTTGTGAGC-3’ Note: Resuspend primers and make 10 μM stocks with TE buffer. ..

    Microscopy:

    Article Title: Multimodal profiling of single-cell morphology, electrophysiology and gene expression using Patch-seq
    Article Snippet: .. 1.16 mm; 10 cm length; without filament; Sutter Instrument, cat. no. B200-116-10) BD 1 mL disposable syringe, tuberculin slip tip (Patterson Veterinary, cat. no. 078821438) Thin-walled, RNase-free 0.2 mL PCR tubes (Thermo Fisher Scientific, cat. no. AM 12225) 13 mm syringe filter with 0.2 μm PTFE membrane (VWR, cat. no. 28145–491) 96-well polypropylene deep well plates (VWR, cat. no. 47743–996) High Sensitivity DNA Kit (Agilent, cat. no. 5067–4626) Superfrost plus gold microscope slides (Thermo Fisher Scientific, cat. no. FT-4981I-GL+) Micro cover glass (VWR, cat. no. 48404–454) .. CRITICAL All glassware, spatulas, stir bars, pipettes and pipette tips should certified RNase-free and/or be cleaned thoroughly with RNase Zap prior to preparing any RNase-free solution.

    Purification:

    Article Title: Assaying the Effects of Splice Site Variants by Exon Trapping in a Mammalian Cell Line
    Article Snippet: .. 1.5 ml Eppendorf tubes (VWR, catalog number: 20170-022) Petri dishes, 100 × 15 mm (VWR, catalog number: 25384-302) Whatman GD/X syringe filters, 0.2 μm pore size (Whatman, catalog number: 6901-2502) BD 60 ml syringes, Luer-Lok Tip (BD, catalog number: 309653) Pasteur glass pipettes, 230 mm (for spreading bacteria on plates) (WHEATON, catalog number: 357335) 2 ml cryovial, self-standing (Simport, catalog number: T310-2A) 50 ml polypropylene conical tube, Falcon (Corning, Falcon™, catalog number: 352070) 0.5 ml PCR tubes (Thermo Fisher Scientific, Invitrogen™, catalog number: AM12275) JM109 E. coli competent cells (Promega, catalog number: L2001) pSPL3 vector (Thermo Fisher Scientific, Invitrogen) Restriction endonuclease, Xho I (New England Biolabs, catalog number: R0146S) Restriction endonuclease, Bam HI (New England Biolabs, catalog number: R0136S) QIAquick PCR Purification Kit (QIAGEN, catalog number: 28104) T4 DNA ligase (New England Biolabs, catalog number: M0202S) SOC medium (Thermo Fisher Scientific, Invitrogen™, catalog number: 15544034) Luria Bertani broth (Lennox) powder microbial growth medium (Sigma-Aldrich, catalog number: L3022) Select Agar (Thermo Fisher Scientific, Invitrogen™, catalog number: 30391023) Carbenicillin, disodium salt (Dot Scientific, catalog number: DSC46000-5) Glycerol (Sigma-Aldrich, catalog number: G5516) QIAprep Spin Miniprep Kit (QIAGEN, catalog number: 27104) Carbenicillin antibiotic, 1,000x (see Recipes) LB (Luria-Bertani) medium with carbenicillin antibiotic (see Recipes) LB agar with carbenicillin antibiotic plates (see Recipes) .. Serological pipettes 5 ml (Corning, Costar® , catalog number: 4487) 10 ml (Corning, Costar® , catalog number: 4488) 25 ml (Corning, Costar® , catalog number: 4489) Transfer pipette, polyethylene, general purpose blood bank, bulb draw 1.9 ml, sterile (Sigma-Aldrich, catalog number: Z350699) Pasteur glass pipettes, 5.75” (for aspiration) (VWR, catalog number: 14673-010) 25 cm2 (T25) cell culture flasks with 0.2 μm vent caps (Corning, catalog number: 430639) COS-7 mammalian cells (ATCC, catalog number: CRL-1651) Dulbecco’s modified Eagle’s medium, DMEM, + GlutaMAX-1 cell culture medium (Thermo Fisher Scientific, Gibco™, catalog number: 10569010) Fetal bovine serum, FBS (Thermo Fisher Scientific, Gibco™, catalog number: 10437028) Phosphate-buffered saline, PBS, pH 7.4, 1x (Thermo Fisher Scientific, Gibco™, catalog number: 10010023) Penicillin-streptomycin, 10,000 U/ml (Thermo Fisher Scientific, Gibco™, catalog number: 15140122) Trypsin-EDTA (0.5%), no phenol red (Thermo Fisher Scientific, Gibco™, catalog number: 15400054) FuGENE 6 Transfection Reagent (Promega, catalog number: E2691) Opti-MEM I reduced serum medium (Thermo Fisher Scientific, Gibco™, catalog number: 31985062)

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Thermo Fisher thin walled frosted lid
    Thin Walled Frosted Lid, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/thin walled frosted lid/product/Thermo Fisher
    Average 92 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    thin walled frosted lid - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    Image Search Results