Structured Review

PerkinElmer thermocycler
Thermocycler, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 99/100, based on 207 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/thermocycler/product/PerkinElmer
Average 99 stars, based on 207 article reviews
Price from $9.99 to $1999.99
thermocycler - by Bioz Stars, 2020-02
99/100 stars

Images

Related Articles

Amplification:

Article Title: Ileocolitis Associated with Anaerobiospirillum in Cats †
Article Snippet: .. The primers were used for PCR amplification of DNA obtained from each specimen with a thermocycler (Perkin-Elmer Cetus, Norwalk, Conn.) in a total volume of 50 μl containing 1.5 mM MgCl2 , 1× PCR buffer, 0.2 mM each dATP, dTTP, dGTP, and dCTP, 1.0 μM primer, and 1.5 U of Taq DNA polymerase (USB Corp., Cleveland, Ohio) in filtered, autoclaved water. ..

Article Title: Investigation of Deletion of 22pb in KIR2DS4 Gene in a Population of Southern Brazil
Article Snippet: .. Gene amplification was performed in a thermocycler (Perkin‐Elmer 9600) and the amplified DNA fragments were separated by electrophoresis (tank model DYCP‐34A, Labmachine®, Curitiba, Brazil) on a 2.5% agarose gel, at 70 V for 30 min and then at 100 V for 2 hr. .. The visualisation of the bands when exposed to ultraviolet light was performed by staining with SYBR Safe DNA gel stain (Invitrogen®) and the interpretation of the results was based on the difference in molecular weight (22 base pairs) between the full‐length and deleted forms of KIR2DS4 .

Article Title: Expression of Xanthophyll Biosynthetic Genes during Light-Dependent Chloroplast Differentiation 1
Article Snippet: A 707-bp-labeled DNA fragment of β-carotene hydroxylase was obtained after PCR amplification using upstream primer AGA GGATCC TGAAATGAAAATTGAGGAGC (includes an inserted Bam HI restriction site, underlined) and downstream primer CGAAGCTTCATGATCCCCTGG. .. PCR was carried out in a thermocycler (PTC-100 Perkin Elmer, Biozym, Hess.

Article Title: Detection of Occult Lymph Node Metastases in Esophageal Cancer by Minimally Invasive Staging Combined with Molecular Diagnostic Techniques
Article Snippet: .. Twenty rounds of amplification were performed in a thermocycler (DNA Thermocycler 480, Perkin Elmer) under the following cycling conditions: 95° C (1 min) denaturation, 72° C (1 min) annealing, 72° C (1 min) extension, followed by a final extension of 72° C (10 min). .. Two ul of the Step 1 reaction product was transferred to another tube containing primers B and C, PCR buffer, dNTPs, and Taq DNA polymerase in the same concentrations as in Step 1.

Article Title: Presumed Virus-Induced Punctal Occlusion
Article Snippet: .. Amplification in a thermocycler (Perkin-Elmer 9600) consisted of an initial round at 94°C for 7 min, 55°C for 1 min, and 72°C for 1.5 min, followed by 40 cycles at 94°C for 1 min, 55°C for 1 min, and 72°C for 1.5 min. .. Detection was done by separating the products using electrophoresis in a 4% (wt/vol) NuSieve agarose gel, stained with ethidium bromide, and photographed with UV trans illumination.

Article Title: Extracellular Signal-Regulated Kinase 7 (ERK7), a Novel ERK with a C-Terminal Domain That Regulates Its Activity, Its Cellular Localization, and Cell Growth
Article Snippet: Paragraph title: Degenerate-primed PCR amplification. ... PCR was performed in a thermocycler (Perkin-Elmer) for 5 min at 97°C followed by 35 cycles of 30 s at 94°C, 60 s at 50°C, and 60 s at 72°C, and a final extension at 72°C for 5 min.

Article Title: Gene Expression and Biochemical Analysis of Cheese-Ripening Yeasts: Focus on Catabolism of l-Methionine, Lactate, and Lactose ▿-Methionine, Lactate, and Lactose ▿ †
Article Snippet: External RNA controls ( A. thaliana mRNA spikes; SpotReport oligo array validation system, Stratagen) were added into total RNA samples (i) prior to cDNA synthesis, to control all of the downstream steps, and (ii) at different concentrations, to cover the entire range of expression levels of mRNAs of interest. mRNA of A. thaliana and mRNA of biological samples were then reverse transcribed and simultaneously cyanine 3 labeled with a CyScribe first-strand cDNA labeling kit (Amersham Biosciences, Piscataway, NJ), without any amplification. .. Reverse transcription-labeling reactions were performed at 42°C for 90 min in a thermocycler (GeneAmp PCR system 9700; Perkin-Elmer Applied Biosystems, Foster City, CA) by direct incorporation of dCTP-Cy3 (Amersham Biosciences) according to the manufacturer's instructions.

Article Title: Frequent Loss of Heterozygosity for Chromosome 10 in Uterine Leiomyosarcoma in Contrast to Leiomyoma
Article Snippet: .. Twenty-nine cycles of amplification were performed in a thermocycler (DNA Thermocycler 480, Perkin-Elmer) with the following profile: denaturation at 95°C for 30 seconds, annealing at 55°C for 45 seconds, extension at 72°C for 1.5 minutes. ..

Article Title: Highly Tissue Substructure-Specific Effects of Human Papilloma Virus in Mucosa of HIV-Infected Patients Revealed by Laser-Dissection Microscopy-Assisted Gene Expression Profiling
Article Snippet: .. This cDNA/outer primer mix was amplified in a thermocycler (Perkin Elmer Applied Biosystems, Foster City, CA): 1 cycle at 94°C for 1 minute, 25 cycles at 94°C for 15 seconds, 55°C for 15 seconds, 70°C for 40 seconds, and 1 cycle at 70°C for 5 minutes. .. Second, individual real-time RT-PCR reactions were set up using individual sets of “inner” primers.

Article Title: Interleukin-18 Facilitates the Early Antimicrobial Host Response to Escherichia coli Peritonitis
Article Snippet: .. The PCR amplifications were performed in a thermocycler (Gene Amp PCR System 9700 [Perkin-Elmer]) under the following conditions: 94°C for 5 min (1 cycle) followed immediately by 95°C for 1 min, 58°C for 1 min, and 72°C for 1 min (with different numbers of cycles), and a final extension phase of 72°C for 10 min. For semiquantitative assessment of IL-18 mRNA, different numbers of cycles were used to ensure that amplification occurred in the linear phase. .. To exclude the possibility of finding differences between tubes as a result of unequal concentrations of cDNA in the PCR mixture, a PCR amplification using β-actin as the internal standard was performed on each sample. β-Actin was found to be linear at 27 amplification cycles, and IL-18 was found to be linear at 29 amplification cycles.

Synthesized:

Article Title: Extracellular Signal-Regulated Kinase 7 (ERK7), a Novel ERK with a C-Terminal Domain That Regulates Its Activity, Its Cellular Localization, and Cell Growth
Article Snippet: Degenerate upstream and downstream oligonucleotide primers were synthesized based on regions of highly conserved amino acid sequences within MAP kinase subdomains II (VAIKKIS) [5′-CTG GAA TTC GTN GCN AT(T/A/C) AA(A/G) AA(A/G) AT-3′] and VII (TRWYRAP) [5′-GC TCT AGA TGG (A/G)GC NC(T/G) (A/G)TA CCA NC(T/G) NGT-3′], respectively. .. PCR was performed in a thermocycler (Perkin-Elmer) for 5 min at 97°C followed by 35 cycles of 30 s at 94°C, 60 s at 50°C, and 60 s at 72°C, and a final extension at 72°C for 5 min.

Article Title: Oligoclonally expanding ?? T lymphocytes induce IgA switching in IgA nephropathy
Article Snippet: Briefly, the internal standard for β-actin, which was about 50 bp shorter than the target sequence, was synthesized as described elsewhere [ ]. .. Thirty-five cycles of denaturation (94°C for 45 s), annealing (60°C for 45 s), and elongation (75°C for 1·5 min) were performed in a thermocycler (Perkin-Elmer, Norwalk, CT).

Neutralization:

Article Title: Gene Expression and Biochemical Analysis of Cheese-Ripening Yeasts: Focus on Catabolism of l-Methionine, Lactate, and Lactose ▿-Methionine, Lactate, and Lactose ▿ †
Article Snippet: Reverse transcription-labeling reactions were performed at 42°C for 90 min in a thermocycler (GeneAmp PCR system 9700; Perkin-Elmer Applied Biosystems, Foster City, CA) by direct incorporation of dCTP-Cy3 (Amersham Biosciences) according to the manufacturer's instructions. .. After neutralization with 2 M HEPES (pH 6.8) (Sigma-Aldrich), labeled cDNA was purified on GFX columns (CyScribe GFX purification kit; Amersham Biosciences) and then concentrated using a Microcon YM-30 filter (Millipore, Bedford, MA).

Autoradiography:

Article Title: Frequent Loss of Heterozygosity for Chromosome 10 in Uterine Leiomyosarcoma in Contrast to Leiomyoma
Article Snippet: Twenty-nine cycles of amplification were performed in a thermocycler (DNA Thermocycler 480, Perkin-Elmer) with the following profile: denaturation at 95°C for 30 seconds, annealing at 55°C for 45 seconds, extension at 72°C for 1.5 minutes. .. PCR products were separated on 7% polyacrylamide gels and visualized by autoradiography.

Quantitative RT-PCR:

Article Title: Highly Tissue Substructure-Specific Effects of Human Papilloma Virus in Mucosa of HIV-Infected Patients Revealed by Laser-Dissection Microscopy-Assisted Gene Expression Profiling
Article Snippet: This cDNA/outer primer mix was amplified in a thermocycler (Perkin Elmer Applied Biosystems, Foster City, CA): 1 cycle at 94°C for 1 minute, 25 cycles at 94°C for 15 seconds, 55°C for 15 seconds, 70°C for 40 seconds, and 1 cycle at 70°C for 5 minutes. .. Second, individual real-time RT-PCR reactions were set up using individual sets of “inner” primers.

Electrophoresis:

Article Title: Ileocolitis Associated with Anaerobiospirillum in Cats †
Article Snippet: The primers were used for PCR amplification of DNA obtained from each specimen with a thermocycler (Perkin-Elmer Cetus, Norwalk, Conn.) in a total volume of 50 μl containing 1.5 mM MgCl2 , 1× PCR buffer, 0.2 mM each dATP, dTTP, dGTP, and dCTP, 1.0 μM primer, and 1.5 U of Taq DNA polymerase (USB Corp., Cleveland, Ohio) in filtered, autoclaved water. .. The ethidium bromide-stained PCR products were visualized under UV light after electrophoresis in a 1.5% agarose gel.

Article Title: Investigation of Deletion of 22pb in KIR2DS4 Gene in a Population of Southern Brazil
Article Snippet: .. Gene amplification was performed in a thermocycler (Perkin‐Elmer 9600) and the amplified DNA fragments were separated by electrophoresis (tank model DYCP‐34A, Labmachine®, Curitiba, Brazil) on a 2.5% agarose gel, at 70 V for 30 min and then at 100 V for 2 hr. .. The visualisation of the bands when exposed to ultraviolet light was performed by staining with SYBR Safe DNA gel stain (Invitrogen®) and the interpretation of the results was based on the difference in molecular weight (22 base pairs) between the full‐length and deleted forms of KIR2DS4 .

Article Title: Presumed Virus-Induced Punctal Occlusion
Article Snippet: Amplification in a thermocycler (Perkin-Elmer 9600) consisted of an initial round at 94°C for 7 min, 55°C for 1 min, and 72°C for 1.5 min, followed by 40 cycles at 94°C for 1 min, 55°C for 1 min, and 72°C for 1.5 min. .. Detection was done by separating the products using electrophoresis in a 4% (wt/vol) NuSieve agarose gel, stained with ethidium bromide, and photographed with UV trans illumination.

Article Title: Oligoclonally expanding ?? T lymphocytes induce IgA switching in IgA nephropathy
Article Snippet: Thirty-five cycles of denaturation (94°C for 45 s), annealing (60°C for 45 s), and elongation (75°C for 1·5 min) were performed in a thermocycler (Perkin-Elmer, Norwalk, CT). .. PCR products were separated by electrophoresis on 2% agarose gels and visualized by ethidium bromide staining.

Incubation:

Article Title: Presumed Virus-Induced Punctal Occlusion
Article Snippet: 50 μ L of processed sediment was added to 200 μ L of 5% (wt/vol) Chelex 100; the mixture was then incubated at 55°C for 15 min, vortexed, boiled for 8 min, and spun for 2 min at 14,000 ×g. .. Amplification in a thermocycler (Perkin-Elmer 9600) consisted of an initial round at 94°C for 7 min, 55°C for 1 min, and 72°C for 1.5 min, followed by 40 cycles at 94°C for 1 min, 55°C for 1 min, and 72°C for 1.5 min.

Article Title: Frequent Loss of Heterozygosity for Chromosome 10 in Uterine Leiomyosarcoma in Contrast to Leiomyoma
Article Snippet: DNA was extracted from paraffin fragments by incubation at 62°C in 300 μl of extraction buffer (50 mmol/L Tris-HCl, pH 8.5; 1 mmol/L EDTA; 0.5% Tween-20; and 0.2 μg/μl proteinase K) for 36 hours. .. Twenty-nine cycles of amplification were performed in a thermocycler (DNA Thermocycler 480, Perkin-Elmer) with the following profile: denaturation at 95°C for 30 seconds, annealing at 55°C for 45 seconds, extension at 72°C for 1.5 minutes.

Article Title: Tandem Repeat Deletion in the Alpha C Protein of Group B Streptococcus Is recA Independent
Article Snippet: Bacterial cultures were grown to an approximate optical density at 650 nm of 0.400 in THB, pelleted, and resuspended in 25% glucose–Tris-EDTA (pH 8.0) containing 2.5 mg of lysozyme/ml and 167 μg of mutanolysin/ml, and incubated at room temperature for 10 min. .. All reactions were carried out with a 0.6 μM primer concentration in a thermocycler (Perkin-Elmer) using a cycle program as follows: reverse transcription at 50°C for 30 min and denaturation at 95°C for 15 min, followed by 35 cycles as described above for PCRs.

Article Title: Interleukin-18 Facilitates the Early Antimicrobial Host Response to Escherichia coli Peritonitis
Article Snippet: The mixture was incubated at 72°C for 10 min. Then 8 μl of a solution containing 4 μl of 5x First Strand buffer (Life Technologies), 10 mM dithiothreitol (Life Technologies), 1.25 mM each deoxynucleoside triphosphate (Amersham Pharmacia Biotech, Little Chalfont, U.K.), and 100 U of Superscript reverse transcriptase (Life Technologies) was added, and the mixture was incubated at 42°C for 1 h. Finally, the tubes were heated to 72°C for 10 min, after which 180 μl of H2 O was added to the reaction mixture. .. The PCR amplifications were performed in a thermocycler (Gene Amp PCR System 9700 [Perkin-Elmer]) under the following conditions: 94°C for 5 min (1 cycle) followed immediately by 95°C for 1 min, 58°C for 1 min, and 72°C for 1 min (with different numbers of cycles), and a final extension phase of 72°C for 10 min. For semiquantitative assessment of IL-18 mRNA, different numbers of cycles were used to ensure that amplification occurred in the linear phase.

Expressing:

Article Title: Gene Expression and Biochemical Analysis of Cheese-Ripening Yeasts: Focus on Catabolism of l-Methionine, Lactate, and Lactose ▿-Methionine, Lactate, and Lactose ▿ †
Article Snippet: External RNA controls ( A. thaliana mRNA spikes; SpotReport oligo array validation system, Stratagen) were added into total RNA samples (i) prior to cDNA synthesis, to control all of the downstream steps, and (ii) at different concentrations, to cover the entire range of expression levels of mRNAs of interest. mRNA of A. thaliana and mRNA of biological samples were then reverse transcribed and simultaneously cyanine 3 labeled with a CyScribe first-strand cDNA labeling kit (Amersham Biosciences, Piscataway, NJ), without any amplification. .. Reverse transcription-labeling reactions were performed at 42°C for 90 min in a thermocycler (GeneAmp PCR system 9700; Perkin-Elmer Applied Biosystems, Foster City, CA) by direct incorporation of dCTP-Cy3 (Amersham Biosciences) according to the manufacturer's instructions.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Tandem Repeat Deletion in the Alpha C Protein of Group B Streptococcus Is recA Independent
Article Snippet: Paragraph title: Reverse transcriptase PCR (RT-PCR). ... All reactions were carried out with a 0.6 μM primer concentration in a thermocycler (Perkin-Elmer) using a cycle program as follows: reverse transcription at 50°C for 30 min and denaturation at 95°C for 15 min, followed by 35 cycles as described above for PCRs.

Article Title: Interleukin-18 Facilitates the Early Antimicrobial Host Response to Escherichia coli Peritonitis
Article Snippet: Paragraph title: Reverse transcription-PCR (RT-PCR). ... The PCR amplifications were performed in a thermocycler (Gene Amp PCR System 9700 [Perkin-Elmer]) under the following conditions: 94°C for 5 min (1 cycle) followed immediately by 95°C for 1 min, 58°C for 1 min, and 72°C for 1 min (with different numbers of cycles), and a final extension phase of 72°C for 10 min. For semiquantitative assessment of IL-18 mRNA, different numbers of cycles were used to ensure that amplification occurred in the linear phase.

Generated:

Article Title: Expression of Xanthophyll Biosynthetic Genes during Light-Dependent Chloroplast Differentiation 1
Article Snippet: A 605-bp probe for the plastidic ppox was generated by PCR with the upstream primer GCAGGAATTAGTGGCCTCTGC and downstream primer AGGTAAACGCGGATCGCGGGGCGC from the corresponding tobacco cDNA ( ) as template. .. PCR was carried out in a thermocycler (PTC-100 Perkin Elmer, Biozym, Hess.

DNA Sequencing:

Article Title: Comparison and Application of a Novel Genotyping Method, Semiautomated Primer-Specific and Mispair Extension Analysis, and Four Other Genotyping Assays for Detection of Hepatitis C Virus Mixed-Genotype Infections
Article Snippet: Primer extensions were performed in a 25-μl reaction volume in a thermocycler (GeneAmp 9600; Perkin-Elmer). .. One microliter of the primer extension products was mixed with 1 μl of the sequencing stop solution (Visible Genetics, Toronto, Ontario, Canada), and the mixture was electrophoresed on 6% polyacrylamide–8 M urea–Tris-borate-EDTA minigels for 10 min. Extension products were analyzed with automated DNA fragment length polymorphism analysis (FLPA) software in the OpenGene automated DNA sequencing system (Visible Genetics).

DNA Labeling:

Article Title: Expression of Xanthophyll Biosynthetic Genes during Light-Dependent Chloroplast Differentiation 1
Article Snippet: Paragraph title: DNA Labeling ... PCR was carried out in a thermocycler (PTC-100 Perkin Elmer, Biozym, Hess.

Sequencing:

Article Title: Comparison and Application of a Novel Genotyping Method, Semiautomated Primer-Specific and Mispair Extension Analysis, and Four Other Genotyping Assays for Detection of Hepatitis C Virus Mixed-Genotype Infections
Article Snippet: Primer extensions were performed in a 25-μl reaction volume in a thermocycler (GeneAmp 9600; Perkin-Elmer). .. One microliter of the primer extension products was mixed with 1 μl of the sequencing stop solution (Visible Genetics, Toronto, Ontario, Canada), and the mixture was electrophoresed on 6% polyacrylamide–8 M urea–Tris-borate-EDTA minigels for 10 min. Extension products were analyzed with automated DNA fragment length polymorphism analysis (FLPA) software in the OpenGene automated DNA sequencing system (Visible Genetics).

Article Title: Investigation of Deletion of 22pb in KIR2DS4 Gene in a Population of Southern Brazil
Article Snippet: The two major full‐length subtype and deleted forms of KIR2DS4 were analysed by an in‐house method optimised by Rudnick et al. using PCR with sequence‐specific primers, which were prepared following the recommendations by Martin and Carrington . .. Gene amplification was performed in a thermocycler (Perkin‐Elmer 9600) and the amplified DNA fragments were separated by electrophoresis (tank model DYCP‐34A, Labmachine®, Curitiba, Brazil) on a 2.5% agarose gel, at 70 V for 30 min and then at 100 V for 2 hr.

Article Title: Relationships between Angiotensin I Converting Enzyme Gene Polymorphism and Renal Complications in Korean IDDM Patients*
Article Snippet: The sequence of the sense primer and anti-sense primer were 5′-GCC CTG CAG GTG TCT GCA GC-3′ and 3′-TGC CCA TAA CAG TGC TTC ATA-5′, respectively. .. Amplication was carried out in a thermocycler (Perkin Elmer Cetus, UK) for 35 cycles with steps of denaturation at 94°C for 1 min, annealing at 60°C for 1 min and extension at 72°C for 2 min.

Article Title: Oligoclonally expanding ?? T lymphocytes induce IgA switching in IgA nephropathy
Article Snippet: Briefly, the internal standard for β-actin, which was about 50 bp shorter than the target sequence, was synthesized as described elsewhere [ ]. .. Thirty-five cycles of denaturation (94°C for 45 s), annealing (60°C for 45 s), and elongation (75°C for 1·5 min) were performed in a thermocycler (Perkin-Elmer, Norwalk, CT).

Cellular Antioxidant Activity Assay:

Article Title: Oligoclonally expanding ?? T lymphocytes induce IgA switching in IgA nephropathy
Article Snippet: Varying amounts of internal control were coamplified with a fixed quantity of cDNA using specific primers (sense primer, 5′-CGT GAC ATC AAA GAG AAG CTG TG-3′; antisense primer, GCT CAG GAG GAG CAA TGA TCT TGA-3′). .. Thirty-five cycles of denaturation (94°C for 45 s), annealing (60°C for 45 s), and elongation (75°C for 1·5 min) were performed in a thermocycler (Perkin-Elmer, Norwalk, CT).

Molecular Weight:

Article Title: Investigation of Deletion of 22pb in KIR2DS4 Gene in a Population of Southern Brazil
Article Snippet: Gene amplification was performed in a thermocycler (Perkin‐Elmer 9600) and the amplified DNA fragments were separated by electrophoresis (tank model DYCP‐34A, Labmachine®, Curitiba, Brazil) on a 2.5% agarose gel, at 70 V for 30 min and then at 100 V for 2 hr. .. The visualisation of the bands when exposed to ultraviolet light was performed by staining with SYBR Safe DNA gel stain (Invitrogen®) and the interpretation of the results was based on the difference in molecular weight (22 base pairs) between the full‐length and deleted forms of KIR2DS4 .

Isolation:

Article Title: Expression of Xanthophyll Biosynthetic Genes during Light-Dependent Chloroplast Differentiation 1
Article Snippet: A β-carotene hydroxylase cDNA (100 ng; S. Römer, unpublished results) isolated from a tobacco cDNA library (λ Zap II, Stratagene, La Jolla, CA; kindly provided by Dr. Grimm [IPK, Gatersleben, Germany]) was added as a template to the PCR reaction. .. PCR was carried out in a thermocycler (PTC-100 Perkin Elmer, Biozym, Hess.

Article Title: Tandem Repeat Deletion in the Alpha C Protein of Group B Streptococcus Is recA Independent
Article Snippet: The bacteria were then pelleted, and total RNA isolation was carried out using the RNeasy kit (Qiagen). .. All reactions were carried out with a 0.6 μM primer concentration in a thermocycler (Perkin-Elmer) using a cycle program as follows: reverse transcription at 50°C for 30 min and denaturation at 95°C for 15 min, followed by 35 cycles as described above for PCRs.

Article Title: Interleukin-18 Facilitates the Early Antimicrobial Host Response to Escherichia coli Peritonitis
Article Snippet: Then total RNA was isolated using chloroform extraction and isopropanol precipitation. .. The PCR amplifications were performed in a thermocycler (Gene Amp PCR System 9700 [Perkin-Elmer]) under the following conditions: 94°C for 5 min (1 cycle) followed immediately by 95°C for 1 min, 58°C for 1 min, and 72°C for 1 min (with different numbers of cycles), and a final extension phase of 72°C for 10 min. For semiquantitative assessment of IL-18 mRNA, different numbers of cycles were used to ensure that amplification occurred in the linear phase.

Subcloning:

Article Title: Extracellular Signal-Regulated Kinase 7 (ERK7), a Novel ERK with a C-Terminal Domain That Regulates Its Activity, Its Cellular Localization, and Cell Growth
Article Snippet: An Eco RI site (underlined) was attached to the 5′ end of the sense oligonucleotide and an Xba I site (underlined) was attached to 5′ end of the antisense oligonucleotide to allow subcloning of the PCR products into an Escherichia coli phagemid vector, pGEM-7Z(+) (Promega). .. PCR was performed in a thermocycler (Perkin-Elmer) for 5 min at 97°C followed by 35 cycles of 30 s at 94°C, 60 s at 50°C, and 60 s at 72°C, and a final extension at 72°C for 5 min.

Labeling:

Article Title: Expression of Xanthophyll Biosynthetic Genes during Light-Dependent Chloroplast Differentiation 1
Article Snippet: All other gene probes were labeled by PCR amplification. .. PCR was carried out in a thermocycler (PTC-100 Perkin Elmer, Biozym, Hess.

Article Title: Gene Expression and Biochemical Analysis of Cheese-Ripening Yeasts: Focus on Catabolism of l-Methionine, Lactate, and Lactose ▿-Methionine, Lactate, and Lactose ▿ †
Article Snippet: Paragraph title: Labeling of cDNA targets. ... Reverse transcription-labeling reactions were performed at 42°C for 90 min in a thermocycler (GeneAmp PCR system 9700; Perkin-Elmer Applied Biosystems, Foster City, CA) by direct incorporation of dCTP-Cy3 (Amersham Biosciences) according to the manufacturer's instructions.

Purification:

Article Title: Extracellular Signal-Regulated Kinase 7 (ERK7), a Novel ERK with a C-Terminal Domain That Regulates Its Activity, Its Cellular Localization, and Cell Growth
Article Snippet: PCR was performed in a thermocycler (Perkin-Elmer) for 5 min at 97°C followed by 35 cycles of 30 s at 94°C, 60 s at 50°C, and 60 s at 72°C, and a final extension at 72°C for 5 min. .. The PCR product was purified with the Wizard PCR prep DNA purification system as specified by the manufacturer (Promega) and subcloned into pGEM-7Z(+) with the Eco RI and Xba I restriction sites.

Article Title: Gene Expression and Biochemical Analysis of Cheese-Ripening Yeasts: Focus on Catabolism of l-Methionine, Lactate, and Lactose ▿-Methionine, Lactate, and Lactose ▿ †
Article Snippet: Reverse transcription-labeling reactions were performed at 42°C for 90 min in a thermocycler (GeneAmp PCR system 9700; Perkin-Elmer Applied Biosystems, Foster City, CA) by direct incorporation of dCTP-Cy3 (Amersham Biosciences) according to the manufacturer's instructions. .. After neutralization with 2 M HEPES (pH 6.8) (Sigma-Aldrich), labeled cDNA was purified on GFX columns (CyScribe GFX purification kit; Amersham Biosciences) and then concentrated using a Microcon YM-30 filter (Millipore, Bedford, MA).

Article Title: Highly Tissue Substructure-Specific Effects of Human Papilloma Virus in Mucosa of HIV-Infected Patients Revealed by Laser-Dissection Microscopy-Assisted Gene Expression Profiling
Article Snippet: Purified RNA (one-third of total obtained) was reverse transcribed in 20-μl volume following the manufacturer’s instructions (80 U RNase H- Superscript II (Invitrogen, Carlsbad, CA), 250 ng random hexamers (Invitrogen), 20 nmoles dNTPs each (10 nm for oral biopsies; Clontech, BD Biosciences, Palo Alto, CA), 20 U RNase inhibitor (Superase In, Ambion)). .. This cDNA/outer primer mix was amplified in a thermocycler (Perkin Elmer Applied Biosystems, Foster City, CA): 1 cycle at 94°C for 1 minute, 25 cycles at 94°C for 15 seconds, 55°C for 15 seconds, 70°C for 40 seconds, and 1 cycle at 70°C for 5 minutes.

Polymerase Chain Reaction:

Article Title: Enhanced Surfactant Protein and Defensin mRNA Levels and Reduced Viral Replication during Parainfluenza Virus Type 3 Pneumonia in Neonatal Lambs
Article Snippet: .. Prior to cDNA syntheses, each total-RNA isolate was subjected to DNase treatment using a commercially available kit (RQ1 RNase-free DNase reagents; Promega) and a thermocycler (GeneAmp PCR System 2400; Perkin-Elmer LLC, Norwalk, Conn.). .. DNase treatments of total-RNA isolates were performed in 200-μl MicroAmp optical tubes (ABI) using GeneAmp 2400 thermocycling conditions of 30 min at 37°C, followed immediately by manually pausing the program in order to add RQ1 DNase stop solution (Promega); 1 μl of stop solution per μg of RNA present in each DNase reaction mixture was added to each tube, after which the mixture was gently vortexed and then quickly returned to the 2400 thermocycler to resume and finish the program with a 10-min hold at 65°C and a final safety hold at 4°C.

Article Title: Comparison and Application of a Novel Genotyping Method, Semiautomated Primer-Specific and Mispair Extension Analysis, and Four Other Genotyping Assays for Detection of Hepatitis C Virus Mixed-Genotype Infections
Article Snippet: Primer extension reaction mixtures contained 5 ng of 5′-end Cy 5.5 dye-labeled primer, 5 to 7 ng of PCR product, each required deoxynucleoside triphosphate (dNTP) at a concentration of 20 μM, 0.3 U of Pfu ( Pyrococcus furiosus ) DNA polymerase, and 2.5 μl of 10× Pfu reaction buffer (Stratagene, La Jolla, Calif.). .. Primer extensions were performed in a 25-μl reaction volume in a thermocycler (GeneAmp 9600; Perkin-Elmer).

Article Title: Ileocolitis Associated with Anaerobiospirillum in Cats †
Article Snippet: .. The primers were used for PCR amplification of DNA obtained from each specimen with a thermocycler (Perkin-Elmer Cetus, Norwalk, Conn.) in a total volume of 50 μl containing 1.5 mM MgCl2 , 1× PCR buffer, 0.2 mM each dATP, dTTP, dGTP, and dCTP, 1.0 μM primer, and 1.5 U of Taq DNA polymerase (USB Corp., Cleveland, Ohio) in filtered, autoclaved water. ..

Article Title: Investigation of Deletion of 22pb in KIR2DS4 Gene in a Population of Southern Brazil
Article Snippet: Paragraph title: KIR Genotyping by PCR‐SSP ... Gene amplification was performed in a thermocycler (Perkin‐Elmer 9600) and the amplified DNA fragments were separated by electrophoresis (tank model DYCP‐34A, Labmachine®, Curitiba, Brazil) on a 2.5% agarose gel, at 70 V for 30 min and then at 100 V for 2 hr.

Article Title: Expression of Xanthophyll Biosynthetic Genes during Light-Dependent Chloroplast Differentiation 1
Article Snippet: .. PCR was carried out in a thermocycler (PTC-100 Perkin Elmer, Biozym, Hess. .. PCR cycle programs were as follows: 25 cycles for amplification of β-carotene hydroxylase (1 min at 94°C, 25 s at 56°C, and 45 s at 72°C), 35 cycles for amplification of zeaxanthin epoxidase (1 min at 94°C, 45 s at 52°C, and 90 s at 72°C), 35 cycles for amplification of violaxanthin de-epoxidase (1 min at 94°C, 45 s at 54°C, and 90 s at 72°C), and 25 cycles for amplification of ppox (1 min at 94°C,25 s at 57°C, and 45 s at 72°C).

Article Title: Detection of Occult Lymph Node Metastases in Esophageal Cancer by Minimally Invasive Staging Combined with Molecular Diagnostic Techniques
Article Snippet: Paragraph title: Polymerase Chain Reaction ... Twenty rounds of amplification were performed in a thermocycler (DNA Thermocycler 480, Perkin Elmer) under the following cycling conditions: 95° C (1 min) denaturation, 72° C (1 min) annealing, 72° C (1 min) extension, followed by a final extension of 72° C (10 min).

Article Title: Extracellular Signal-Regulated Kinase 7 (ERK7), a Novel ERK with a C-Terminal Domain That Regulates Its Activity, Its Cellular Localization, and Cell Growth
Article Snippet: .. PCR was performed in a thermocycler (Perkin-Elmer) for 5 min at 97°C followed by 35 cycles of 30 s at 94°C, 60 s at 50°C, and 60 s at 72°C, and a final extension at 72°C for 5 min. .. The PCR product was purified with the Wizard PCR prep DNA purification system as specified by the manufacturer (Promega) and subcloned into pGEM-7Z(+) with the Eco RI and Xba I restriction sites.

Article Title: Gene Expression and Biochemical Analysis of Cheese-Ripening Yeasts: Focus on Catabolism of l-Methionine, Lactate, and Lactose ▿-Methionine, Lactate, and Lactose ▿ †
Article Snippet: .. Reverse transcription-labeling reactions were performed at 42°C for 90 min in a thermocycler (GeneAmp PCR system 9700; Perkin-Elmer Applied Biosystems, Foster City, CA) by direct incorporation of dCTP-Cy3 (Amersham Biosciences) according to the manufacturer's instructions. ..

Article Title: Frequent Loss of Heterozygosity for Chromosome 10 in Uterine Leiomyosarcoma in Contrast to Leiomyoma
Article Snippet: Paragraph title: Microsatellite Analysis by the Polymerase Chain Reaction ... Twenty-nine cycles of amplification were performed in a thermocycler (DNA Thermocycler 480, Perkin-Elmer) with the following profile: denaturation at 95°C for 30 seconds, annealing at 55°C for 45 seconds, extension at 72°C for 1.5 minutes.

Article Title: Relationships between Angiotensin I Converting Enzyme Gene Polymorphism and Renal Complications in Korean IDDM Patients*
Article Snippet: PCR was performed in a final volume of 40 μ l which contained 1.0 ug of genomic DNA, 10 pmol of each primer, 200 uM each of the. four dNTP, 1.5 mM MgCl2 , 40 mM KCl, 10 mM Tris-HCl, pH 8.0 and 2.0 unit of Taq polymerase (Korea Biotech. .. Amplication was carried out in a thermocycler (Perkin Elmer Cetus, UK) for 35 cycles with steps of denaturation at 94°C for 1 min, annealing at 60°C for 1 min and extension at 72°C for 2 min.

Article Title: Tandem Repeat Deletion in the Alpha C Protein of Group B Streptococcus Is recA Independent
Article Snippet: Paragraph title: Reverse transcriptase PCR (RT-PCR). ... All reactions were carried out with a 0.6 μM primer concentration in a thermocycler (Perkin-Elmer) using a cycle program as follows: reverse transcription at 50°C for 30 min and denaturation at 95°C for 15 min, followed by 35 cycles as described above for PCRs.

Article Title: Interleukin-18 Facilitates the Early Antimicrobial Host Response to Escherichia coli Peritonitis
Article Snippet: .. The PCR amplifications were performed in a thermocycler (Gene Amp PCR System 9700 [Perkin-Elmer]) under the following conditions: 94°C for 5 min (1 cycle) followed immediately by 95°C for 1 min, 58°C for 1 min, and 72°C for 1 min (with different numbers of cycles), and a final extension phase of 72°C for 10 min. For semiquantitative assessment of IL-18 mRNA, different numbers of cycles were used to ensure that amplification occurred in the linear phase. .. To exclude the possibility of finding differences between tubes as a result of unequal concentrations of cDNA in the PCR mixture, a PCR amplification using β-actin as the internal standard was performed on each sample. β-Actin was found to be linear at 27 amplification cycles, and IL-18 was found to be linear at 29 amplification cycles.

Article Title: Oligoclonally expanding ?? T lymphocytes induce IgA switching in IgA nephropathy
Article Snippet: The β-actin cDNA were semiquantified by competitive PCR. .. Thirty-five cycles of denaturation (94°C for 45 s), annealing (60°C for 45 s), and elongation (75°C for 1·5 min) were performed in a thermocycler (Perkin-Elmer, Norwalk, CT).

Salting Out:

Article Title: Relationships between Angiotensin I Converting Enzyme Gene Polymorphism and Renal Complications in Korean IDDM Patients*
Article Snippet: Methods DNA was extracted from peripheral blood leukocytes by the salting out method. .. Amplication was carried out in a thermocycler (Perkin Elmer Cetus, UK) for 35 cycles with steps of denaturation at 94°C for 1 min, annealing at 60°C for 1 min and extension at 72°C for 2 min.

cDNA Library Assay:

Article Title: Expression of Xanthophyll Biosynthetic Genes during Light-Dependent Chloroplast Differentiation 1
Article Snippet: A β-carotene hydroxylase cDNA (100 ng; S. Römer, unpublished results) isolated from a tobacco cDNA library (λ Zap II, Stratagene, La Jolla, CA; kindly provided by Dr. Grimm [IPK, Gatersleben, Germany]) was added as a template to the PCR reaction. .. PCR was carried out in a thermocycler (PTC-100 Perkin Elmer, Biozym, Hess.

Article Title: Extracellular Signal-Regulated Kinase 7 (ERK7), a Novel ERK with a C-Terminal Domain That Regulates Its Activity, Its Cellular Localization, and Cell Growth
Article Snippet: The template for amplification was a 6-day-old rat brain cDNA library in λpCEV29 ( ). .. PCR was performed in a thermocycler (Perkin-Elmer) for 5 min at 97°C followed by 35 cycles of 30 s at 94°C, 60 s at 50°C, and 60 s at 72°C, and a final extension at 72°C for 5 min.

Plasmid Preparation:

Article Title: Extracellular Signal-Regulated Kinase 7 (ERK7), a Novel ERK with a C-Terminal Domain That Regulates Its Activity, Its Cellular Localization, and Cell Growth
Article Snippet: An Eco RI site (underlined) was attached to the 5′ end of the sense oligonucleotide and an Xba I site (underlined) was attached to 5′ end of the antisense oligonucleotide to allow subcloning of the PCR products into an Escherichia coli phagemid vector, pGEM-7Z(+) (Promega). .. PCR was performed in a thermocycler (Perkin-Elmer) for 5 min at 97°C followed by 35 cycles of 30 s at 94°C, 60 s at 50°C, and 60 s at 72°C, and a final extension at 72°C for 5 min.

Software:

Article Title: Comparison and Application of a Novel Genotyping Method, Semiautomated Primer-Specific and Mispair Extension Analysis, and Four Other Genotyping Assays for Detection of Hepatitis C Virus Mixed-Genotype Infections
Article Snippet: Primer extensions were performed in a 25-μl reaction volume in a thermocycler (GeneAmp 9600; Perkin-Elmer). .. One microliter of the primer extension products was mixed with 1 μl of the sequencing stop solution (Visible Genetics, Toronto, Ontario, Canada), and the mixture was electrophoresed on 6% polyacrylamide–8 M urea–Tris-borate-EDTA minigels for 10 min. Extension products were analyzed with automated DNA fragment length polymorphism analysis (FLPA) software in the OpenGene automated DNA sequencing system (Visible Genetics).

Real-time Polymerase Chain Reaction:

Article Title: Highly Tissue Substructure-Specific Effects of Human Papilloma Virus in Mucosa of HIV-Infected Patients Revealed by Laser-Dissection Microscopy-Assisted Gene Expression Profiling
Article Snippet: This cDNA/outer primer mix was amplified in a thermocycler (Perkin Elmer Applied Biosystems, Foster City, CA): 1 cycle at 94°C for 1 minute, 25 cycles at 94°C for 15 seconds, 55°C for 15 seconds, 70°C for 40 seconds, and 1 cycle at 70°C for 5 minutes. .. Preliminary experiments established that for the amount of RNA obtained by LDM in the experiments involving oral biopsies, addition of between 0.1 to 0.5 μl of pre-amplification material to 25 μl total real-time PCR mix (for oral biopsies 10 μl reactions) containing universal master mix (Applied Biosystems), primers (300 nmol each), and a 6-FAM and BHQ-1-labeled probe (100 nmol, Biosearch Technologies, Novato, CA) would result in linear second-round amplification (see and data not shown).

Multiplex Assay:

Article Title: Presumed Virus-Induced Punctal Occlusion
Article Snippet: The multiplex PCR step provided mass amplification using these common primers, which increased markedly the sensitivity of the test. .. Amplification in a thermocycler (Perkin-Elmer 9600) consisted of an initial round at 94°C for 7 min, 55°C for 1 min, and 72°C for 1.5 min, followed by 40 cycles at 94°C for 1 min, 55°C for 1 min, and 72°C for 1.5 min.

Article Title: Highly Tissue Substructure-Specific Effects of Human Papilloma Virus in Mucosa of HIV-Infected Patients Revealed by Laser-Dissection Microscopy-Assisted Gene Expression Profiling
Article Snippet: First, half of the cDNA obtained from the reverse-transcription step was used for a multiplex pre-amplification step in a volume of 50 μl. .. This cDNA/outer primer mix was amplified in a thermocycler (Perkin Elmer Applied Biosystems, Foster City, CA): 1 cycle at 94°C for 1 minute, 25 cycles at 94°C for 15 seconds, 55°C for 15 seconds, 70°C for 40 seconds, and 1 cycle at 70°C for 5 minutes.

Agarose Gel Electrophoresis:

Article Title: Ileocolitis Associated with Anaerobiospirillum in Cats †
Article Snippet: The primers were used for PCR amplification of DNA obtained from each specimen with a thermocycler (Perkin-Elmer Cetus, Norwalk, Conn.) in a total volume of 50 μl containing 1.5 mM MgCl2 , 1× PCR buffer, 0.2 mM each dATP, dTTP, dGTP, and dCTP, 1.0 μM primer, and 1.5 U of Taq DNA polymerase (USB Corp., Cleveland, Ohio) in filtered, autoclaved water. .. The ethidium bromide-stained PCR products were visualized under UV light after electrophoresis in a 1.5% agarose gel.

Article Title: Investigation of Deletion of 22pb in KIR2DS4 Gene in a Population of Southern Brazil
Article Snippet: .. Gene amplification was performed in a thermocycler (Perkin‐Elmer 9600) and the amplified DNA fragments were separated by electrophoresis (tank model DYCP‐34A, Labmachine®, Curitiba, Brazil) on a 2.5% agarose gel, at 70 V for 30 min and then at 100 V for 2 hr. .. The visualisation of the bands when exposed to ultraviolet light was performed by staining with SYBR Safe DNA gel stain (Invitrogen®) and the interpretation of the results was based on the difference in molecular weight (22 base pairs) between the full‐length and deleted forms of KIR2DS4 .

Article Title: Presumed Virus-Induced Punctal Occlusion
Article Snippet: Amplification in a thermocycler (Perkin-Elmer 9600) consisted of an initial round at 94°C for 7 min, 55°C for 1 min, and 72°C for 1.5 min, followed by 40 cycles at 94°C for 1 min, 55°C for 1 min, and 72°C for 1.5 min. .. Detection was done by separating the products using electrophoresis in a 4% (wt/vol) NuSieve agarose gel, stained with ethidium bromide, and photographed with UV trans illumination.

Article Title: Tandem Repeat Deletion in the Alpha C Protein of Group B Streptococcus Is recA Independent
Article Snippet: After treatment with DNase I (Gibco-BRL), the integrity of the RNA was assessed by denaturing agarose gel to ensure that no significant degradation of the RNA had occurred. .. All reactions were carried out with a 0.6 μM primer concentration in a thermocycler (Perkin-Elmer) using a cycle program as follows: reverse transcription at 50°C for 30 min and denaturation at 95°C for 15 min, followed by 35 cycles as described above for PCRs.

Spectrophotometry:

Article Title: Interleukin-18 Facilitates the Early Antimicrobial Host Response to Escherichia coli Peritonitis
Article Snippet: The RNA pellet was dissolved in 100 μl of diethylpyrocarbonate-treated water and quantified by spectrophotometry. .. The PCR amplifications were performed in a thermocycler (Gene Amp PCR System 9700 [Perkin-Elmer]) under the following conditions: 94°C for 5 min (1 cycle) followed immediately by 95°C for 1 min, 58°C for 1 min, and 72°C for 1 min (with different numbers of cycles), and a final extension phase of 72°C for 10 min. For semiquantitative assessment of IL-18 mRNA, different numbers of cycles were used to ensure that amplification occurred in the linear phase.

Concentration Assay:

Article Title: Comparison and Application of a Novel Genotyping Method, Semiautomated Primer-Specific and Mispair Extension Analysis, and Four Other Genotyping Assays for Detection of Hepatitis C Virus Mixed-Genotype Infections
Article Snippet: Primer extension reaction mixtures contained 5 ng of 5′-end Cy 5.5 dye-labeled primer, 5 to 7 ng of PCR product, each required deoxynucleoside triphosphate (dNTP) at a concentration of 20 μM, 0.3 U of Pfu ( Pyrococcus furiosus ) DNA polymerase, and 2.5 μl of 10× Pfu reaction buffer (Stratagene, La Jolla, Calif.). .. Primer extensions were performed in a 25-μl reaction volume in a thermocycler (GeneAmp 9600; Perkin-Elmer).

Article Title: Tandem Repeat Deletion in the Alpha C Protein of Group B Streptococcus Is recA Independent
Article Snippet: .. All reactions were carried out with a 0.6 μM primer concentration in a thermocycler (Perkin-Elmer) using a cycle program as follows: reverse transcription at 50°C for 30 min and denaturation at 95°C for 15 min, followed by 35 cycles as described above for PCRs. .. Direct sequencing from pooled PCR product or sequencing from cloned DNA was performed with an automated fluorescent dideoxy sequencing system (Applied Biosystems) through the Brigham and Women's Hospital Automatic Sequencing and Genotyping Facility and the Beth Israel-Deaconess Medical Center Molecular Medicine Sequencing Facility.

Article Title: Oligoclonally expanding ?? T lymphocytes induce IgA switching in IgA nephropathy
Article Snippet: Thirty-five cycles of denaturation (94°C for 45 s), annealing (60°C for 45 s), and elongation (75°C for 1·5 min) were performed in a thermocycler (Perkin-Elmer, Norwalk, CT). .. The point of equivalence in intensity of the competitor and wild-type band was designated the concentration of each cDNA.

DNA Purification:

Article Title: Extracellular Signal-Regulated Kinase 7 (ERK7), a Novel ERK with a C-Terminal Domain That Regulates Its Activity, Its Cellular Localization, and Cell Growth
Article Snippet: PCR was performed in a thermocycler (Perkin-Elmer) for 5 min at 97°C followed by 35 cycles of 30 s at 94°C, 60 s at 50°C, and 60 s at 72°C, and a final extension at 72°C for 5 min. .. The PCR product was purified with the Wizard PCR prep DNA purification system as specified by the manufacturer (Promega) and subcloned into pGEM-7Z(+) with the Eco RI and Xba I restriction sites.

CTG Assay:

Article Title: Relationships between Angiotensin I Converting Enzyme Gene Polymorphism and Renal Complications in Korean IDDM Patients*
Article Snippet: The sequence of the sense primer and anti-sense primer were 5′-GCC CTG CAG GTG TCT GCA GC-3′ and 3′-TGC CCA TAA CAG TGC TTC ATA-5′, respectively. .. Amplication was carried out in a thermocycler (Perkin Elmer Cetus, UK) for 35 cycles with steps of denaturation at 94°C for 1 min, annealing at 60°C for 1 min and extension at 72°C for 2 min.

Article Title: Oligoclonally expanding ?? T lymphocytes induce IgA switching in IgA nephropathy
Article Snippet: Varying amounts of internal control were coamplified with a fixed quantity of cDNA using specific primers (sense primer, 5′-CGT GAC ATC AAA GAG AAG CTG TG-3′; antisense primer, GCT CAG GAG GAG CAA TGA TCT TGA-3′). .. Thirty-five cycles of denaturation (94°C for 45 s), annealing (60°C for 45 s), and elongation (75°C for 1·5 min) were performed in a thermocycler (Perkin-Elmer, Norwalk, CT).

Staining:

Article Title: Investigation of Deletion of 22pb in KIR2DS4 Gene in a Population of Southern Brazil
Article Snippet: Gene amplification was performed in a thermocycler (Perkin‐Elmer 9600) and the amplified DNA fragments were separated by electrophoresis (tank model DYCP‐34A, Labmachine®, Curitiba, Brazil) on a 2.5% agarose gel, at 70 V for 30 min and then at 100 V for 2 hr. .. The visualisation of the bands when exposed to ultraviolet light was performed by staining with SYBR Safe DNA gel stain (Invitrogen®) and the interpretation of the results was based on the difference in molecular weight (22 base pairs) between the full‐length and deleted forms of KIR2DS4 .

Article Title: Presumed Virus-Induced Punctal Occlusion
Article Snippet: Amplification in a thermocycler (Perkin-Elmer 9600) consisted of an initial round at 94°C for 7 min, 55°C for 1 min, and 72°C for 1.5 min, followed by 40 cycles at 94°C for 1 min, 55°C for 1 min, and 72°C for 1.5 min. .. Detection was done by separating the products using electrophoresis in a 4% (wt/vol) NuSieve agarose gel, stained with ethidium bromide, and photographed with UV trans illumination.

Article Title: Relationships between Angiotensin I Converting Enzyme Gene Polymorphism and Renal Complications in Korean IDDM Patients*
Article Snippet: Amplication was carried out in a thermocycler (Perkin Elmer Cetus, UK) for 35 cycles with steps of denaturation at 94°C for 1 min, annealing at 60°C for 1 min and extension at 72°C for 2 min. .. The PCR products were electrophoresed in 2% agarose gels, and DNA was visualized directly with ethidium bromide staining.

Article Title: Oligoclonally expanding ?? T lymphocytes induce IgA switching in IgA nephropathy
Article Snippet: Thirty-five cycles of denaturation (94°C for 45 s), annealing (60°C for 45 s), and elongation (75°C for 1·5 min) were performed in a thermocycler (Perkin-Elmer, Norwalk, CT). .. PCR products were separated by electrophoresis on 2% agarose gels and visualized by ethidium bromide staining.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    PerkinElmer perkin elmer 9600 thermocycler
    Perkin Elmer 9600 Thermocycler, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 95/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/perkin elmer 9600 thermocycler/product/PerkinElmer
    Average 95 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    perkin elmer 9600 thermocycler - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    77
    PerkinElmer cetus dna thermocycler 480
    Cetus Dna Thermocycler 480, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cetus dna thermocycler 480/product/PerkinElmer
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cetus dna thermocycler 480 - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    98
    PerkinElmer geneamp pcr system 2400 thermocycler
    Geneamp Pcr System 2400 Thermocycler, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 98/100, based on 62 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/geneamp pcr system 2400 thermocycler/product/PerkinElmer
    Average 98 stars, based on 62 article reviews
    Price from $9.99 to $1999.99
    geneamp pcr system 2400 thermocycler - by Bioz Stars, 2020-02
    98/100 stars
      Buy from Supplier

    Image Search Results