tgcagcctaatcaccgc oligo glsrna 17 rv gtgcagggtccgaggt phusion highfidelity dna polymerase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Thermo Fisher tgcagcctaatcaccgc oligo glsrna 17 rv gtgcagggtccgaggt phusion highfidelity dna polymerase
    Tgcagcctaatcaccgc Oligo Glsrna 17 Rv Gtgcagggtccgaggt Phusion Highfidelity Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tgcagcctaatcaccgc oligo glsrna 17 rv gtgcagggtccgaggt phusion highfidelity dna polymerase/product/Thermo Fisher
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    tgcagcctaatcaccgc oligo glsrna 17 rv gtgcagggtccgaggt phusion highfidelity dna polymerase - by Bioz Stars, 2020-04
    92/100 stars

    Images

    Related Articles

    Electrophoresis:

    Article Title: Purification, concentration and recovery of small fragments of DNA from Giardia lamblia and their use for other molecular techniques
    Article Snippet: .. Reagents Oligo TPI Fw: AGGAGCTCGGAGAGTCCAA Oligo TPI Rv: ACACGGGCTCGTAAGCAAT Oligo NADHox Fw: GCACCATATGGCTTCAACGG Oligo NADHox Rv: CAGGCCTGTCCGTGTCATTA) Oligo GlsRNA17 Fw: TGCAGCCTAATCACCGC Oligo GlsRNA 17 Rv: GTGCAGGGTCCGAGGT Phusion HighFidelity DNA polymerase (Thermo scientific) Xho I (Thermo Scientific) Nco I (Thermo Scientific) GelRed (Nucleic Acid Gel, Biotium) 1X TBE buffer (Tris-HCL/Boric Acid/EDTA) TE buffer [10 mM Tris-HCl, pH 8.0 and 1 mM (ethylenedinitrilo)tetraacetic acid (EDTA)] Sodium acetate (3 M, pH 5.2) Ethanol for molecular biology (Sigma-Aldrich) SyberGreen Master Mix kit (Applied Biosystems, CA, USA) GeneJET Plasmid Miniprep Kit (Thermo Scientific) T4 ligase (Thermo Scientific) Agarose (Invitrogen) GeneJET Plasmid Miniprep Kit (Thermo Scientific) Equipment Thermocycler MaxyGene Gradient (Axygen, USA) Thermomixer compact, Eppendorf Centrifuge (minispin Eppendorf centrifuge for 1.5 mL microcentrifuge tubes) Agarose Electrophoresis System (Thermo Scientific) Analyzer ImageJ1.50i, Wayne Rasband National Institutes of Health (USA) StepOne™ Real-Time PCR System and Fast SYBR® MultiDoc-It Digital Imaging System UVP .. Purification of small DNA fragments from agarose gels 1.

    Purification:

    Article Title: Purification, concentration and recovery of small fragments of DNA from Giardia lamblia and their use for other molecular techniques
    Article Snippet: To achieve our goal, we used a classic technique of purification, the freeze-squeeze method, with some modifications , , , . .. Reagents Oligo TPI Fw: AGGAGCTCGGAGAGTCCAA Oligo TPI Rv: ACACGGGCTCGTAAGCAAT Oligo NADHox Fw: GCACCATATGGCTTCAACGG Oligo NADHox Rv: CAGGCCTGTCCGTGTCATTA) Oligo GlsRNA17 Fw: TGCAGCCTAATCACCGC Oligo GlsRNA 17 Rv: GTGCAGGGTCCGAGGT Phusion HighFidelity DNA polymerase (Thermo scientific) Xho I (Thermo Scientific) Nco I (Thermo Scientific) GelRed (Nucleic Acid Gel, Biotium) 1X TBE buffer (Tris-HCL/Boric Acid/EDTA) TE buffer [10 mM Tris-HCl, pH 8.0 and 1 mM (ethylenedinitrilo)tetraacetic acid (EDTA)] Sodium acetate (3 M, pH 5.2) Ethanol for molecular biology (Sigma-Aldrich) SyberGreen Master Mix kit (Applied Biosystems, CA, USA) GeneJET Plasmid Miniprep Kit (Thermo Scientific) T4 ligase (Thermo Scientific) Agarose (Invitrogen) GeneJET Plasmid Miniprep Kit (Thermo Scientific) Equipment Thermocycler MaxyGene Gradient (Axygen, USA) Thermomixer compact, Eppendorf Centrifuge (minispin Eppendorf centrifuge for 1.5 mL microcentrifuge tubes) Agarose Electrophoresis System (Thermo Scientific) Analyzer ImageJ1.50i, Wayne Rasband National Institutes of Health (USA) StepOne™ Real-Time PCR System and Fast SYBR® MultiDoc-It Digital Imaging System UVP

    Real-time Polymerase Chain Reaction:

    Article Title: Purification, concentration and recovery of small fragments of DNA from Giardia lamblia and their use for other molecular techniques
    Article Snippet: .. Reagents Oligo TPI Fw: AGGAGCTCGGAGAGTCCAA Oligo TPI Rv: ACACGGGCTCGTAAGCAAT Oligo NADHox Fw: GCACCATATGGCTTCAACGG Oligo NADHox Rv: CAGGCCTGTCCGTGTCATTA) Oligo GlsRNA17 Fw: TGCAGCCTAATCACCGC Oligo GlsRNA 17 Rv: GTGCAGGGTCCGAGGT Phusion HighFidelity DNA polymerase (Thermo scientific) Xho I (Thermo Scientific) Nco I (Thermo Scientific) GelRed (Nucleic Acid Gel, Biotium) 1X TBE buffer (Tris-HCL/Boric Acid/EDTA) TE buffer [10 mM Tris-HCl, pH 8.0 and 1 mM (ethylenedinitrilo)tetraacetic acid (EDTA)] Sodium acetate (3 M, pH 5.2) Ethanol for molecular biology (Sigma-Aldrich) SyberGreen Master Mix kit (Applied Biosystems, CA, USA) GeneJET Plasmid Miniprep Kit (Thermo Scientific) T4 ligase (Thermo Scientific) Agarose (Invitrogen) GeneJET Plasmid Miniprep Kit (Thermo Scientific) Equipment Thermocycler MaxyGene Gradient (Axygen, USA) Thermomixer compact, Eppendorf Centrifuge (minispin Eppendorf centrifuge for 1.5 mL microcentrifuge tubes) Agarose Electrophoresis System (Thermo Scientific) Analyzer ImageJ1.50i, Wayne Rasband National Institutes of Health (USA) StepOne™ Real-Time PCR System and Fast SYBR® MultiDoc-It Digital Imaging System UVP .. Purification of small DNA fragments from agarose gels 1.

    Concentration Assay:

    Article Title: Purification, concentration and recovery of small fragments of DNA from Giardia lamblia and their use for other molecular techniques
    Article Snippet: Method In this work, a methodological strategy is described, which enabled the purification, recovery and concentration of DNA fragments with length < 100 bp using gene fragments from G. lamblia . .. Reagents Oligo TPI Fw: AGGAGCTCGGAGAGTCCAA Oligo TPI Rv: ACACGGGCTCGTAAGCAAT Oligo NADHox Fw: GCACCATATGGCTTCAACGG Oligo NADHox Rv: CAGGCCTGTCCGTGTCATTA) Oligo GlsRNA17 Fw: TGCAGCCTAATCACCGC Oligo GlsRNA 17 Rv: GTGCAGGGTCCGAGGT Phusion HighFidelity DNA polymerase (Thermo scientific) Xho I (Thermo Scientific) Nco I (Thermo Scientific) GelRed (Nucleic Acid Gel, Biotium) 1X TBE buffer (Tris-HCL/Boric Acid/EDTA) TE buffer [10 mM Tris-HCl, pH 8.0 and 1 mM (ethylenedinitrilo)tetraacetic acid (EDTA)] Sodium acetate (3 M, pH 5.2) Ethanol for molecular biology (Sigma-Aldrich) SyberGreen Master Mix kit (Applied Biosystems, CA, USA) GeneJET Plasmid Miniprep Kit (Thermo Scientific) T4 ligase (Thermo Scientific) Agarose (Invitrogen) GeneJET Plasmid Miniprep Kit (Thermo Scientific) Equipment Thermocycler MaxyGene Gradient (Axygen, USA) Thermomixer compact, Eppendorf Centrifuge (minispin Eppendorf centrifuge for 1.5 mL microcentrifuge tubes) Agarose Electrophoresis System (Thermo Scientific) Analyzer ImageJ1.50i, Wayne Rasband National Institutes of Health (USA) StepOne™ Real-Time PCR System and Fast SYBR® MultiDoc-It Digital Imaging System UVP

    Imaging:

    Article Title: Purification, concentration and recovery of small fragments of DNA from Giardia lamblia and their use for other molecular techniques
    Article Snippet: .. Reagents Oligo TPI Fw: AGGAGCTCGGAGAGTCCAA Oligo TPI Rv: ACACGGGCTCGTAAGCAAT Oligo NADHox Fw: GCACCATATGGCTTCAACGG Oligo NADHox Rv: CAGGCCTGTCCGTGTCATTA) Oligo GlsRNA17 Fw: TGCAGCCTAATCACCGC Oligo GlsRNA 17 Rv: GTGCAGGGTCCGAGGT Phusion HighFidelity DNA polymerase (Thermo scientific) Xho I (Thermo Scientific) Nco I (Thermo Scientific) GelRed (Nucleic Acid Gel, Biotium) 1X TBE buffer (Tris-HCL/Boric Acid/EDTA) TE buffer [10 mM Tris-HCl, pH 8.0 and 1 mM (ethylenedinitrilo)tetraacetic acid (EDTA)] Sodium acetate (3 M, pH 5.2) Ethanol for molecular biology (Sigma-Aldrich) SyberGreen Master Mix kit (Applied Biosystems, CA, USA) GeneJET Plasmid Miniprep Kit (Thermo Scientific) T4 ligase (Thermo Scientific) Agarose (Invitrogen) GeneJET Plasmid Miniprep Kit (Thermo Scientific) Equipment Thermocycler MaxyGene Gradient (Axygen, USA) Thermomixer compact, Eppendorf Centrifuge (minispin Eppendorf centrifuge for 1.5 mL microcentrifuge tubes) Agarose Electrophoresis System (Thermo Scientific) Analyzer ImageJ1.50i, Wayne Rasband National Institutes of Health (USA) StepOne™ Real-Time PCR System and Fast SYBR® MultiDoc-It Digital Imaging System UVP .. Purification of small DNA fragments from agarose gels 1.

    Plasmid Preparation:

    Article Title: Purification, concentration and recovery of small fragments of DNA from Giardia lamblia and their use for other molecular techniques
    Article Snippet: .. Reagents Oligo TPI Fw: AGGAGCTCGGAGAGTCCAA Oligo TPI Rv: ACACGGGCTCGTAAGCAAT Oligo NADHox Fw: GCACCATATGGCTTCAACGG Oligo NADHox Rv: CAGGCCTGTCCGTGTCATTA) Oligo GlsRNA17 Fw: TGCAGCCTAATCACCGC Oligo GlsRNA 17 Rv: GTGCAGGGTCCGAGGT Phusion HighFidelity DNA polymerase (Thermo scientific) Xho I (Thermo Scientific) Nco I (Thermo Scientific) GelRed (Nucleic Acid Gel, Biotium) 1X TBE buffer (Tris-HCL/Boric Acid/EDTA) TE buffer [10 mM Tris-HCl, pH 8.0 and 1 mM (ethylenedinitrilo)tetraacetic acid (EDTA)] Sodium acetate (3 M, pH 5.2) Ethanol for molecular biology (Sigma-Aldrich) SyberGreen Master Mix kit (Applied Biosystems, CA, USA) GeneJET Plasmid Miniprep Kit (Thermo Scientific) T4 ligase (Thermo Scientific) Agarose (Invitrogen) GeneJET Plasmid Miniprep Kit (Thermo Scientific) Equipment Thermocycler MaxyGene Gradient (Axygen, USA) Thermomixer compact, Eppendorf Centrifuge (minispin Eppendorf centrifuge for 1.5 mL microcentrifuge tubes) Agarose Electrophoresis System (Thermo Scientific) Analyzer ImageJ1.50i, Wayne Rasband National Institutes of Health (USA) StepOne™ Real-Time PCR System and Fast SYBR® MultiDoc-It Digital Imaging System UVP .. Purification of small DNA fragments from agarose gels 1.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Thermo Fisher tgcagcctaatcaccgc oligo glsrna 17 rv gtgcagggtccgaggt phusion highfidelity dna polymerase
    Tgcagcctaatcaccgc Oligo Glsrna 17 Rv Gtgcagggtccgaggt Phusion Highfidelity Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tgcagcctaatcaccgc oligo glsrna 17 rv gtgcagggtccgaggt phusion highfidelity dna polymerase/product/Thermo Fisher
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    tgcagcctaatcaccgc oligo glsrna 17 rv gtgcagggtccgaggt phusion highfidelity dna polymerase - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    Image Search Results