tcgcagagcaaaaattaaagggtgc  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 79

    Structured Review

    Thermo Fisher tcgcagagcaaaaattaaagggtgc
    Tcgcagagcaaaaattaaagggtgc, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tcgcagagcaaaaattaaagggtgc/product/Thermo Fisher
    Average 79 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    tcgcagagcaaaaattaaagggtgc - by Bioz Stars, 2020-02
    79/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: Differential Roles of Hath1, MUC2 and P27Kip1 in Relation with Gamma-Secretase Inhibition in Human Colonic Carcinomas: A Translational Study
    Article Snippet: .. Sequencing The ATOH1 open reading frame from 2 samples was amplified with PCR using AATAAGACGTTGCAGAAGAG and TCGCAGAGCAAAAATTAAAGGGTGC and Platinium Taq DNA polymerase and the GeneAmp PCR System 9700 (Applied Biosystems). .. The PCR products were purified and sequenced on a 3130 Genetic Analyser (Applied Biosystems).

    Article Title: Atonal homolog 1 Is a Tumor Suppressor GeneThe Atonal Proneural Transcription Factor Links Differentiation and Tumor Formation inDrosophila
    Article Snippet: Paragraph title: Sequencing. ... The ATOH1 open reading frame was amplified with PCR using AATAAGACGTTGCAGAAGAG and TCGCAGAGCAAAAATTAAAGGGTGC and AmpliTaq Gold DNA polymerase and the GeneAmp PCR System 2400 (Applied Biosystems).

    Polymerase Chain Reaction:

    Article Title: Differential Roles of Hath1, MUC2 and P27Kip1 in Relation with Gamma-Secretase Inhibition in Human Colonic Carcinomas: A Translational Study
    Article Snippet: .. Sequencing The ATOH1 open reading frame from 2 samples was amplified with PCR using AATAAGACGTTGCAGAAGAG and TCGCAGAGCAAAAATTAAAGGGTGC and Platinium Taq DNA polymerase and the GeneAmp PCR System 9700 (Applied Biosystems). .. The PCR products were purified and sequenced on a 3130 Genetic Analyser (Applied Biosystems).

    Article Title: Atonal homolog 1 Is a Tumor Suppressor GeneThe Atonal Proneural Transcription Factor Links Differentiation and Tumor Formation inDrosophila
    Article Snippet: .. The ATOH1 open reading frame was amplified with PCR using AATAAGACGTTGCAGAAGAG and TCGCAGAGCAAAAATTAAAGGGTGC and AmpliTaq Gold DNA polymerase and the GeneAmp PCR System 2400 (Applied Biosystems). .. The PCR products were purified and sequenced in both directions on the ABI Prism BigDye (Terminator Cycle Sequencing Kit version 1.1) on an ABI PRISM 3100 Genetic Analyser (Applied Biosystems).

    Amplification:

    Article Title: Differential Roles of Hath1, MUC2 and P27Kip1 in Relation with Gamma-Secretase Inhibition in Human Colonic Carcinomas: A Translational Study
    Article Snippet: .. Sequencing The ATOH1 open reading frame from 2 samples was amplified with PCR using AATAAGACGTTGCAGAAGAG and TCGCAGAGCAAAAATTAAAGGGTGC and Platinium Taq DNA polymerase and the GeneAmp PCR System 9700 (Applied Biosystems). .. The PCR products were purified and sequenced on a 3130 Genetic Analyser (Applied Biosystems).

    Article Title: Atonal homolog 1 Is a Tumor Suppressor GeneThe Atonal Proneural Transcription Factor Links Differentiation and Tumor Formation inDrosophila
    Article Snippet: .. The ATOH1 open reading frame was amplified with PCR using AATAAGACGTTGCAGAAGAG and TCGCAGAGCAAAAATTAAAGGGTGC and AmpliTaq Gold DNA polymerase and the GeneAmp PCR System 2400 (Applied Biosystems). .. The PCR products were purified and sequenced in both directions on the ABI Prism BigDye (Terminator Cycle Sequencing Kit version 1.1) on an ABI PRISM 3100 Genetic Analyser (Applied Biosystems).

    Purification:

    Article Title: Differential Roles of Hath1, MUC2 and P27Kip1 in Relation with Gamma-Secretase Inhibition in Human Colonic Carcinomas: A Translational Study
    Article Snippet: Sequencing The ATOH1 open reading frame from 2 samples was amplified with PCR using AATAAGACGTTGCAGAAGAG and TCGCAGAGCAAAAATTAAAGGGTGC and Platinium Taq DNA polymerase and the GeneAmp PCR System 9700 (Applied Biosystems). .. The PCR products were purified and sequenced on a 3130 Genetic Analyser (Applied Biosystems).

    Article Title: Atonal homolog 1 Is a Tumor Suppressor GeneThe Atonal Proneural Transcription Factor Links Differentiation and Tumor Formation inDrosophila
    Article Snippet: The ATOH1 open reading frame was amplified with PCR using AATAAGACGTTGCAGAAGAG and TCGCAGAGCAAAAATTAAAGGGTGC and AmpliTaq Gold DNA polymerase and the GeneAmp PCR System 2400 (Applied Biosystems). .. The PCR products were purified and sequenced in both directions on the ABI Prism BigDye (Terminator Cycle Sequencing Kit version 1.1) on an ABI PRISM 3100 Genetic Analyser (Applied Biosystems).