taq dnapol  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Taq I
    Description:
    IsoschizomersThe enzyme is an isoschizomer to TthHB8 I Methylation sensitivityTaq I is inhibited by overlapping dam methylation at the indicated site on the recognition sequence
    Catalog Number:
    taqi-ro
    Price:
    None
    Applications:
    Taq I has been used in restriction site mapping analysis and in polymerase chain reaction.
    Buy from Supplier


    Structured Review

    Millipore taq dnapol
    IsoschizomersThe enzyme is an isoschizomer to TthHB8 I Methylation sensitivityTaq I is inhibited by overlapping dam methylation at the indicated site on the recognition sequence
    https://www.bioz.com/result/taq dnapol/product/Millipore
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    taq dnapol - by Bioz Stars, 2020-08
    95/100 stars

    Related Products / Commonly Used Together

    mgcl
    dntps
    pfuturbo cx hotstart dnapol
    pcr mix

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Assessment of Heat Shock Protein 70 Induction by Heat in Alfalfa Varieties and Constitutive Overexpression in Transgenic Plants
    Article Snippet: .. PCR amplification was performed using 1X Buffer, 1.5 mM MgCl2 , 0.2 mM dNTPs, 0.4 μM primers, 1U Taq (Sigma), final volume 25μl. .. Thermal cycling was: 94°C for 1 min, 35 cycles at 94°C for 20 s, 65°C for 20 s, and 72°C for 20 s, final extension at 72°C for 10 min. Progeny plants were scored positive or negative for the two genes after agarose gel electrophoresis.

    Article Title: Genome-Scale Cloning and Expression of Individual Open Reading Frames Using Topoisomerase I-Mediated Ligation
    Article Snippet: .. Cycling parameters were 1 cycle of 94°C for 4 min; 35 cycles of 94°C for 45 sec, 55°C for 45 sec, and 72°C for 3 min; followed by 1 cycle of 72°C for 4 min. Each reaction was performed in 50 μl total volume and included 2 units of a 50:1 (unit/unit) mixture of Taq I (Sigma, St. Louis, MO) and Pfu I (Stratagene, San Diego, CA) polymerases, 2.0 μl of 50 m m dNTPs, 2–20 ng first-strand cDNA, and 5 μl of TA 10× PCR buffer (Invitrogen, Carlsbad, CA). ..

    Article Title: Secreted Protein Acidic and Rich in Cysteine (SPARC) in Human Skeletal Muscle
    Article Snippet: .. PCR reactions were run in 20 μl volume: 20 ng cDNA sample, 2 μl Taq 10× PCR buffer (Sigma-Aldrich), 0.2 μl Taq DNA polymerase (Sigma-Aldrich), 200 μM dNTP (Sigma-Aldrich), and 10 pmol of each primer. .. To the SPARC PCR reaction 1.5 M betaine was added as an enhancing agent to facilitate strand separation by equalizing the melting temperature of the individual base pairs in the template DNA (Sigma-Aldrich).

    Article Title: Only a Subset of Phosphoantigen-responsive ?9?2 T cells Mediate Protective TB Immunity 1
    Article Snippet: .. PCR was performed with the same primer sequences as above utilizing Taq polymerase (Sigma) to incorporate an adenosine at the 3′ end of the amplified DNA. .. The PCR fragments were ligated into the pCR2.1 TA cloning vector (Invitrogen) and the resulting plasmids were transfected by heat shock into TOP10 Competent E. coli (Invitrogen) for propagation.

    Article Title: Genome-Scale Cloning and Expression of Individual Open Reading Frames Using Topoisomerase I-Mediated Ligation
    Article Snippet: .. The reaction conditions were 1 cycle at 94°C for 4 min; 25 cycles at 94°C for 30 sec, 56°C for 45 sec, and 72°C for 3 min; followed by 1 cycle at 72°C for 4 min. Each initial amplification was performed in a 30 μl total volume with 2 units of a 50:1 (Unit/Unit) mixture of Taq I (Sigma, St. Louis, MO) and Pfu I (Stratagene, San Diego, CA) polymerases, 0.4 μl of 50 m m dNTPs, 100 ng of each primer, in 1× PCR buffer J (Invitrogen, Carlsbad, CA) (final concentrations of 60 m m Tris-Cl, 15 m m (NH4 )2 SO4 , 2.0 m m Mg2+ at pH 9.5). .. During the first pass for the yeast ORFs, primer YO8ATG was replaced after ∼84% of the yeast ORFs had been taken through the amplification step.

    Article Title: Genome-Scale Cloning and Expression of Individual Open Reading Frames Using Topoisomerase I-Mediated Ligation
    Article Snippet: .. PCR cycling conditions were: 1 cycle of 94°C for 10 min; 25 cycles of 94°C for 1 min, 56°C for 1 min, and 72°C for 3 min; followed by 1 cycle of 72°C for 4 min. Each initial amplification was performed in a 30 μl total volume with 2 units of Taq I (Sigma, St. Louis, MO) polymerase, 0.4 μl of 50 m m dNTPs, 100 ng of each primer, in 1× PCR buffer J (Invitrogen, Carlsbad, CA) (final concentrations of 60 m m Tris-Cl, 15 m m (NH4 )2 SO4 , 2.0 m m Mg2+ , pH 9.5). ..

    Isolation:

    Article Title: Long Term Effect of Curcumin in Regulation of Glycolytic Pathway and Angiogenesis via Modulation of Stress Activated Genes in Prevention of Cancer
    Article Snippet: .. Curcumin, reagents for RNA isolation and Taq polymerase, Nonfluorescent 2′, 7′-dichlorofluorescein diacetate (H2DCFDA) and HRP conjugated anti-β actin were purchased from Sigma Aldrich. .. Reverse Transcriptase, Ribonuclease Inhibitor, random primers and 100 bp Plus DNA ladder from Fermentase Life Science and gene specific primers for RT-PCR were synthesized from Metabion.

    Amplification:

    Article Title: Assessment of Heat Shock Protein 70 Induction by Heat in Alfalfa Varieties and Constitutive Overexpression in Transgenic Plants
    Article Snippet: .. PCR amplification was performed using 1X Buffer, 1.5 mM MgCl2 , 0.2 mM dNTPs, 0.4 μM primers, 1U Taq (Sigma), final volume 25μl. .. Thermal cycling was: 94°C for 1 min, 35 cycles at 94°C for 20 s, 65°C for 20 s, and 72°C for 20 s, final extension at 72°C for 10 min. Progeny plants were scored positive or negative for the two genes after agarose gel electrophoresis.

    Article Title: Only a Subset of Phosphoantigen-responsive ?9?2 T cells Mediate Protective TB Immunity 1
    Article Snippet: .. PCR was performed with the same primer sequences as above utilizing Taq polymerase (Sigma) to incorporate an adenosine at the 3′ end of the amplified DNA. .. The PCR fragments were ligated into the pCR2.1 TA cloning vector (Invitrogen) and the resulting plasmids were transfected by heat shock into TOP10 Competent E. coli (Invitrogen) for propagation.

    Article Title: Genome-Scale Cloning and Expression of Individual Open Reading Frames Using Topoisomerase I-Mediated Ligation
    Article Snippet: .. The reaction conditions were 1 cycle at 94°C for 4 min; 25 cycles at 94°C for 30 sec, 56°C for 45 sec, and 72°C for 3 min; followed by 1 cycle at 72°C for 4 min. Each initial amplification was performed in a 30 μl total volume with 2 units of a 50:1 (Unit/Unit) mixture of Taq I (Sigma, St. Louis, MO) and Pfu I (Stratagene, San Diego, CA) polymerases, 0.4 μl of 50 m m dNTPs, 100 ng of each primer, in 1× PCR buffer J (Invitrogen, Carlsbad, CA) (final concentrations of 60 m m Tris-Cl, 15 m m (NH4 )2 SO4 , 2.0 m m Mg2+ at pH 9.5). .. During the first pass for the yeast ORFs, primer YO8ATG was replaced after ∼84% of the yeast ORFs had been taken through the amplification step.

    Article Title: Genome-Scale Cloning and Expression of Individual Open Reading Frames Using Topoisomerase I-Mediated Ligation
    Article Snippet: .. PCR cycling conditions were: 1 cycle of 94°C for 10 min; 25 cycles of 94°C for 1 min, 56°C for 1 min, and 72°C for 3 min; followed by 1 cycle of 72°C for 4 min. Each initial amplification was performed in a 30 μl total volume with 2 units of Taq I (Sigma, St. Louis, MO) polymerase, 0.4 μl of 50 m m dNTPs, 100 ng of each primer, in 1× PCR buffer J (Invitrogen, Carlsbad, CA) (final concentrations of 60 m m Tris-Cl, 15 m m (NH4 )2 SO4 , 2.0 m m Mg2+ , pH 9.5). ..

    Mutagenesis:

    Article Title: CDK1 and CDK2 regulate NICD1 turnover and the periodicity of the segmentation clock
    Article Snippet: .. Site‐directed mutagenesis was carried out using the QuikChange Lightning Site‐Directed Mutagenesis Kit (Agilent Technologies) but substituting the Taq with KOD Hot Start DNA polymerase (Novagen). .. S2205A change was introduced using primers Forward: 5′‐CCCGTGGATAGCCTGGAAGCGCCTCACGGCTACCTGAGC Reverse: 5′‐GCTCAGGTAGCCGTGAGGCGCTTCCAGGCTATCCACGGG S2513A change was introduced using primers Forward: 5′‐CCCATTTCTGACCCCTGCACCCGAGAGCCCCGATC Reverse: 5′‐ATCGGGGCTCTCGGGTGCAGGGGTCAGAAATGGG S2516A change was introduced using primers Forward: 5′‐CTGACCCCTAGCCCCGAGGCGCCCGATCAGTGGTCTAGC Reverse: 5′‐GCTAGACCACTGATCGGGCGCCTCGGGGCTAGGGGTCAG S2513A and S2516A double mutant was generated with primers Forward: 5′‐CACCCCTTCCTCACCCCGGCCCCTGAGGCCCCTGACCAGTGGTCCA Reverse: 5′‐TGGACCACTGGTCAGGGGCCTCAGGGGCCGGGGTGAGGAAGGGGTG S2527A change was introduced using primers Forward: 5′‐TCTAGCAGCAGCCCCCACGCGAACGTGTCCGATTGGAGC Reverse: 5′‐GCTCCAATCGGACACGTTCGCGTGGGGGCTGCTGCTAGA S2538A change was introduced using primers Forward: 5′‐TGGAGCGAAGGCGTGTCCGCCCCCCCAACCAGCATGCAG Reverse: 5′‐CTGCATGCTGGTTGGGGGGGCGGACACGCCTTCGCTCCA T2511V mutant was generated with primers Forward: 5′‐CCCGAGCACCCATTTCTGGTCCCTAGCCCCGAGAGCCCC Reverse: 5′‐GGGGCTCTCGGGGCTAGGGACCAGAAATGGGTGCTCGGG P2512L change was introduced using primers Forward: 5′‐GAGCACCCATTTCTGACCCTTAGCCCCGAGAGCCCCGAT Reverse: 5′‐ATCGGGGCTCTCGGGGCTAAGGGTCAGAAATGGGTGCTC P2514R change was introduced using primers Forward: 5′‐CCATTTCTGACCCCTAGCCGCGAGAGCCCCGATCAGTGG Reverse: 5′‐CCACTGATCGGGGCTCTCGCGGCTAGGGGTCAGAAATGG

    Size-exclusion Chromatography:

    Article Title: Genome-Scale Cloning and Expression of Individual Open Reading Frames Using Topoisomerase I-Mediated Ligation
    Article Snippet: .. Cycling parameters were 1 cycle of 94°C for 4 min; 35 cycles of 94°C for 45 sec, 55°C for 45 sec, and 72°C for 3 min; followed by 1 cycle of 72°C for 4 min. Each reaction was performed in 50 μl total volume and included 2 units of a 50:1 (unit/unit) mixture of Taq I (Sigma, St. Louis, MO) and Pfu I (Stratagene, San Diego, CA) polymerases, 2.0 μl of 50 m m dNTPs, 2–20 ng first-strand cDNA, and 5 μl of TA 10× PCR buffer (Invitrogen, Carlsbad, CA). ..

    Article Title: Genome-Scale Cloning and Expression of Individual Open Reading Frames Using Topoisomerase I-Mediated Ligation
    Article Snippet: .. The reaction conditions were 1 cycle at 94°C for 4 min; 25 cycles at 94°C for 30 sec, 56°C for 45 sec, and 72°C for 3 min; followed by 1 cycle at 72°C for 4 min. Each initial amplification was performed in a 30 μl total volume with 2 units of a 50:1 (Unit/Unit) mixture of Taq I (Sigma, St. Louis, MO) and Pfu I (Stratagene, San Diego, CA) polymerases, 0.4 μl of 50 m m dNTPs, 100 ng of each primer, in 1× PCR buffer J (Invitrogen, Carlsbad, CA) (final concentrations of 60 m m Tris-Cl, 15 m m (NH4 )2 SO4 , 2.0 m m Mg2+ at pH 9.5). .. During the first pass for the yeast ORFs, primer YO8ATG was replaced after ∼84% of the yeast ORFs had been taken through the amplification step.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Millipore taq dna polymerase
    Taq Dna Polymerase, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 577 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/Millipore
    Average 94 stars, based on 577 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    Image Search Results