t4 rna ligase 2  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    T4 RNA Ligase 2 truncated
    Description:
    T4 RNA Ligase 2 truncated 10 000 units
    Catalog Number:
    M0242L
    Price:
    277
    Size:
    10 000 units
    Category:
    RNA Ligases
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs t4 rna ligase 2
    T4 RNA Ligase 2 truncated
    T4 RNA Ligase 2 truncated 10 000 units
    https://www.bioz.com/result/t4 rna ligase 2/product/New England Biolabs
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 2 - by Bioz Stars, 2019-12
    99/100 stars

    Images

    1) Product Images from "Blocking of targeted microRNAs from next-generation sequencing libraries"

    Article Title: Blocking of targeted microRNAs from next-generation sequencing libraries

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv724

    Modification of miRNA sequencing library generation protocol to allow for blocking of targeted species. ( A ) In the standard protocol, a pre-adenylated adaptor is ligated to the 3′ end of a small RNA pool using T4 RNA Ligase 2, truncated. Subsequently, a second adaptor is added to the 5′ end of the miRNA with T4 RNA Ligase 1, followed by reverse transcription and PCR. ( B ) In our modification, a hairpin oligonucleotide with an overhang complementary to the 5′ end of the targeted miRNA is attached via ligation with T4 DNA Ligase to the 5′ end of the miRNA subsequent to the ligation of the adaptor to the 3′ end. This prevents the ligation of the second adaptor to the 5′ end of the miRNA, resulting in a product that does not amplify during PCR. ( C ) Sequencing libraries were generated from human heart total RNA using a titration of a blocking oligonucleotide targeting hsa-miR-16–5p. The fraction of hsa-miR-16–5p present in the blocked library compared to the unblocked library is shown on the y-axis.
    Figure Legend Snippet: Modification of miRNA sequencing library generation protocol to allow for blocking of targeted species. ( A ) In the standard protocol, a pre-adenylated adaptor is ligated to the 3′ end of a small RNA pool using T4 RNA Ligase 2, truncated. Subsequently, a second adaptor is added to the 5′ end of the miRNA with T4 RNA Ligase 1, followed by reverse transcription and PCR. ( B ) In our modification, a hairpin oligonucleotide with an overhang complementary to the 5′ end of the targeted miRNA is attached via ligation with T4 DNA Ligase to the 5′ end of the miRNA subsequent to the ligation of the adaptor to the 3′ end. This prevents the ligation of the second adaptor to the 5′ end of the miRNA, resulting in a product that does not amplify during PCR. ( C ) Sequencing libraries were generated from human heart total RNA using a titration of a blocking oligonucleotide targeting hsa-miR-16–5p. The fraction of hsa-miR-16–5p present in the blocked library compared to the unblocked library is shown on the y-axis.

    Techniques Used: Modification, Sequencing, Blocking Assay, Polymerase Chain Reaction, Ligation, Generated, Titration

    2) Product Images from "Rolling Circle Translation of Circular RNA in Living Human Cells"

    Article Title: Rolling Circle Translation of Circular RNA in Living Human Cells

    Journal: Scientific Reports

    doi: 10.1038/srep16435

    Synthesis of circular RNAs. ( A ) A scheme for the synthesis of circular RNAs used in this study. Transcribed linear RNAs were annealed to its complementary DNA oligomer and then ligated using T4 RNA ligase 2 to produce the circular RNA. ( B , C ) Verification of their circularity of the RNAs. The RNAs were incubated with RNase R and the reactions were analysed by denaturing PAGE. The gels were visualised by SYBR Green II staining.
    Figure Legend Snippet: Synthesis of circular RNAs. ( A ) A scheme for the synthesis of circular RNAs used in this study. Transcribed linear RNAs were annealed to its complementary DNA oligomer and then ligated using T4 RNA ligase 2 to produce the circular RNA. ( B , C ) Verification of their circularity of the RNAs. The RNAs were incubated with RNase R and the reactions were analysed by denaturing PAGE. The gels were visualised by SYBR Green II staining.

    Techniques Used: Incubation, Polyacrylamide Gel Electrophoresis, SYBR Green Assay, Staining

    3) Product Images from "Rolling Circle Translation of Circular RNA in Living Human Cells"

    Article Title: Rolling Circle Translation of Circular RNA in Living Human Cells

    Journal: Scientific Reports

    doi: 10.1038/srep16435

    Synthesis of circular RNAs. ( A ) A scheme for the synthesis of circular RNAs used in this study. Transcribed linear RNAs were annealed to its complementary DNA oligomer and then ligated using T4 RNA ligase 2 to produce the circular RNA. ( B , C ) Verification of their circularity of the RNAs. The RNAs were incubated with RNase R and the reactions were analysed by denaturing PAGE. The gels were visualised by SYBR Green II staining.
    Figure Legend Snippet: Synthesis of circular RNAs. ( A ) A scheme for the synthesis of circular RNAs used in this study. Transcribed linear RNAs were annealed to its complementary DNA oligomer and then ligated using T4 RNA ligase 2 to produce the circular RNA. ( B , C ) Verification of their circularity of the RNAs. The RNAs were incubated with RNase R and the reactions were analysed by denaturing PAGE. The gels were visualised by SYBR Green II staining.

    Techniques Used: Incubation, Polyacrylamide Gel Electrophoresis, SYBR Green Assay, Staining

    4) Product Images from "Structure-function analysis of Methanobacterium thermoautotrophicum RNA ligase - engineering a thermostable ATP independent enzyme"

    Article Title: Structure-function analysis of Methanobacterium thermoautotrophicum RNA ligase - engineering a thermostable ATP independent enzyme

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-13-24

    (A) Structural comparison of T4 RNA ligase 2 and archaeal RNA ligase PAB1020 active sites.  Two structures were superimposed based on coordinates of pre-bound AMP and ATP homolog (AMPPNP) as well as known conserved amino acids of the ligase active sites. The T4Rnl2 structure is represented in grey and PAB1020 in yellow. The numbers of amino acids in the conserved motifs I-V (in parenthesis) are for T4Rnl2 and PAB1020 ortholog MthRnl, which were determined after sequence alignment of two archaeal enzymes.  (B)  The sequences of the conserved motifs I and V of MthRnl compared to corresponding motifs in the RNA and DNA ligases as discussed in the text. The listed RNA ligases are from: MthRnl ( Methanobacterium thermoautotrophicum ), PAB1020 ( Pyrococcus abyssi ), TS2126 (bacteriophage  Thermus scotoductus ), RM378 (bacteriophage  Rhodothermus marinus ), T4Rnl1 and T4Rnl2 (bacteriophage T4), AcNPV ( Autographa californica  nucleopolyhedrovirus). And DNA ligases are from: PBCV1 ( Chlorella  virus), MthDnl ( Methanobacterium thermoautotrophicum ), VacDnl (Vaccinia virus). The conserved lysines are shown in bold.
    Figure Legend Snippet: (A) Structural comparison of T4 RNA ligase 2 and archaeal RNA ligase PAB1020 active sites. Two structures were superimposed based on coordinates of pre-bound AMP and ATP homolog (AMPPNP) as well as known conserved amino acids of the ligase active sites. The T4Rnl2 structure is represented in grey and PAB1020 in yellow. The numbers of amino acids in the conserved motifs I-V (in parenthesis) are for T4Rnl2 and PAB1020 ortholog MthRnl, which were determined after sequence alignment of two archaeal enzymes. (B) The sequences of the conserved motifs I and V of MthRnl compared to corresponding motifs in the RNA and DNA ligases as discussed in the text. The listed RNA ligases are from: MthRnl ( Methanobacterium thermoautotrophicum ), PAB1020 ( Pyrococcus abyssi ), TS2126 (bacteriophage Thermus scotoductus ), RM378 (bacteriophage Rhodothermus marinus ), T4Rnl1 and T4Rnl2 (bacteriophage T4), AcNPV ( Autographa californica nucleopolyhedrovirus). And DNA ligases are from: PBCV1 ( Chlorella virus), MthDnl ( Methanobacterium thermoautotrophicum ), VacDnl (Vaccinia virus). The conserved lysines are shown in bold.

    Techniques Used: Sequencing

    5) Product Images from "Simple and efficient synthesis of 5? pre-adenylated DNA using thermostable RNA ligase"

    Article Title: Simple and efficient synthesis of 5? pre-adenylated DNA using thermostable RNA ligase

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr544

    Ligation of adenylated DNA linker made with MthRnl to RNA. AppDNA17c-NH 2  was ligated to RNA22 (lane 2) and FAM-RNA23 (lane 4) using T4 RNA ligase 2 truncated without ATP as described in ‘Materials and Methods’ section. Lanes 1 and 3 are controls without ligase. Single-stranded RNA size markers (Mr) are included for reference. The products were analyzed by a 15% urea–PAGE.
    Figure Legend Snippet: Ligation of adenylated DNA linker made with MthRnl to RNA. AppDNA17c-NH 2 was ligated to RNA22 (lane 2) and FAM-RNA23 (lane 4) using T4 RNA ligase 2 truncated without ATP as described in ‘Materials and Methods’ section. Lanes 1 and 3 are controls without ligase. Single-stranded RNA size markers (Mr) are included for reference. The products were analyzed by a 15% urea–PAGE.

    Techniques Used: Ligation, Polyacrylamide Gel Electrophoresis

    6) Product Images from "T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis"

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    Journal: BMC Biotechnology

    doi: 10.1186/1472-6750-11-72

    Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.
    Figure Legend Snippet: Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Techniques Used: Activity Assay, Labeling, Ligation, Binding Assay

    Deadenylation activity of T4 RNA ligase 2 truncated mutants . 5'-adenylated DNA adapters were incubated with an excess of ligase (13.8 pmol), and 12.5% PEG 8000 at 16°C overnight. Oligonucleotide substrates are depicted schematically above the gel. The contents of each sample were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold to visualize nucleic acid. Deadenylation of the DNA adapter (loss of 5'-App) is indicated by a band shift of ~1 nt towards the bottom of the gel. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.
    Figure Legend Snippet: Deadenylation activity of T4 RNA ligase 2 truncated mutants . 5'-adenylated DNA adapters were incubated with an excess of ligase (13.8 pmol), and 12.5% PEG 8000 at 16°C overnight. Oligonucleotide substrates are depicted schematically above the gel. The contents of each sample were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold to visualize nucleic acid. Deadenylation of the DNA adapter (loss of 5'-App) is indicated by a band shift of ~1 nt towards the bottom of the gel. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Techniques Used: Activity Assay, Incubation, Staining, Electrophoretic Mobility Shift Assay, Binding Assay

    Assaying the formation of side products by T4 RNA ligases . Intermolecular strand-joining reactions containing 5'-adenylated adapters, 21-mer 5'-PO 4  RNA acceptors, and ligase (1 pmol) were incubated at 16°C overnight in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. Products of the reaction were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Ladder = size standard ladder, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.
    Figure Legend Snippet: Assaying the formation of side products by T4 RNA ligases . Intermolecular strand-joining reactions containing 5'-adenylated adapters, 21-mer 5'-PO 4 RNA acceptors, and ligase (1 pmol) were incubated at 16°C overnight in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. Products of the reaction were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Ladder = size standard ladder, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Techniques Used: Incubation, Staining, Ligation, Binding Assay

    Following AMP during ligation reactions with T4 RNA ligases .  (A)  22-mer DNA adapters were 5'-adenylated with α- 32 P-labeled ATP (see materials and methods). Intermolecular strand-joining reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 21-mer 5'-PO 4  RNA acceptor, and ligase (1 pmol) were incubated overnight at 16°C in the presence of PEG 8000. Reaction products were resolved on a denaturing 15% acrylamide gel and radioactive molecules were visualized by exposure to Phosphor screens. The resulting products were either free AMP in solution (AMP*) or the adapter remaining adenylated (Ap*p-DNA). Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes  32 P-phosphate.  (B)  Determining the fate of AMP upon T4 RNA ligase-dependent deadenylation. Reactions containing radiolabeled DNA adapter (10 pmol) and ligase (14 pmol) were incubated overnight at 16°C in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. P* denotes  32 P-phosphate. Reaction products were resolved and visualized as in (A). The resulting products were either free AMP in solution (AMP*), the adapter remaining adenylated (Ap*p-DNA), or AMP covalently bound to the ligase (AMP*-ligase). The lane labeled input contains only Ap*p-DNA.  (C)  Reactions identical to those in (B) were treated with Proteinase K prior to gel electrophoresis and detection.  (D)  Reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 28-mer [5'-PO 4 , 3'-blocked] RNA acceptor, and ligase (1 pmol) were incubated, resolved and detected as in (A). The resulting products were either free AMP in solution (AMP*), adenylated adapter (Ap*p-DNA), or Ap*p-28-mer RNA. The lane labeled RNA size control contains 5'- 32 PO 4  RNA, and the lane labeled input contains only Ap*p-DNA. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes  32 P-phosphate. In all panels, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.
    Figure Legend Snippet: Following AMP during ligation reactions with T4 RNA ligases . (A) 22-mer DNA adapters were 5'-adenylated with α- 32 P-labeled ATP (see materials and methods). Intermolecular strand-joining reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 21-mer 5'-PO 4 RNA acceptor, and ligase (1 pmol) were incubated overnight at 16°C in the presence of PEG 8000. Reaction products were resolved on a denaturing 15% acrylamide gel and radioactive molecules were visualized by exposure to Phosphor screens. The resulting products were either free AMP in solution (AMP*) or the adapter remaining adenylated (Ap*p-DNA). Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. (B) Determining the fate of AMP upon T4 RNA ligase-dependent deadenylation. Reactions containing radiolabeled DNA adapter (10 pmol) and ligase (14 pmol) were incubated overnight at 16°C in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. P* denotes 32 P-phosphate. Reaction products were resolved and visualized as in (A). The resulting products were either free AMP in solution (AMP*), the adapter remaining adenylated (Ap*p-DNA), or AMP covalently bound to the ligase (AMP*-ligase). The lane labeled input contains only Ap*p-DNA. (C) Reactions identical to those in (B) were treated with Proteinase K prior to gel electrophoresis and detection. (D) Reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 28-mer [5'-PO 4 , 3'-blocked] RNA acceptor, and ligase (1 pmol) were incubated, resolved and detected as in (A). The resulting products were either free AMP in solution (AMP*), adenylated adapter (Ap*p-DNA), or Ap*p-28-mer RNA. The lane labeled RNA size control contains 5'- 32 PO 4 RNA, and the lane labeled input contains only Ap*p-DNA. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. In all panels, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Techniques Used: Ligation, Labeling, Incubation, Acrylamide Gel Assay, Nucleic Acid Electrophoresis, Binding Assay

    Production of ligation side products by T4 RNA ligases . Intermolecular ligation reactions containing 5'-adenylated DNA adapters, 21-mer 5'-PO 4  RNA acceptors and ligase (1 pmol) were incubated at 16°C overnight with 12.5% PEG 8000. Products of the reactions were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA.
    Figure Legend Snippet: Production of ligation side products by T4 RNA ligases . Intermolecular ligation reactions containing 5'-adenylated DNA adapters, 21-mer 5'-PO 4 RNA acceptors and ligase (1 pmol) were incubated at 16°C overnight with 12.5% PEG 8000. Products of the reactions were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA.

    Techniques Used: Ligation, Incubation, Staining, Binding Assay

    Purification and activity of T4 RNA Ligase 2 truncated mutants .  (A)  Aliquots of T4 RNA ligase 2 truncated and mutants were separated on 10-20% Tris-glycine SDS polyacrylamide gels and stained with Coomassie blue. The size (in kDa) of marker polypeptides are indicated on the left.  (B)  Intermolecular strand-joining activity of T4 RNA ligase 2 truncated mutants under multiple turnover conditions. 10 pmol 5'-adenylated 17-mer DNA was incubated for one hour at 25°C with 5 pmol 5'- FAM-labeled 31-mer RNA. 1 pmol of each ligase was added into reaction mixture. The reaction products were resolved on denaturing 15% acrylamide gels, scanned and quantified as described in the methods section. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments. * denotes difference in means p
    Figure Legend Snippet: Purification and activity of T4 RNA Ligase 2 truncated mutants . (A) Aliquots of T4 RNA ligase 2 truncated and mutants were separated on 10-20% Tris-glycine SDS polyacrylamide gels and stained with Coomassie blue. The size (in kDa) of marker polypeptides are indicated on the left. (B) Intermolecular strand-joining activity of T4 RNA ligase 2 truncated mutants under multiple turnover conditions. 10 pmol 5'-adenylated 17-mer DNA was incubated for one hour at 25°C with 5 pmol 5'- FAM-labeled 31-mer RNA. 1 pmol of each ligase was added into reaction mixture. The reaction products were resolved on denaturing 15% acrylamide gels, scanned and quantified as described in the methods section. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments. * denotes difference in means p

    Techniques Used: Purification, Activity Assay, Staining, Marker, Incubation, Labeling, Binding Assay

    Effect of pH on ligase intermolecular strand-joining activity .  (A-D)  Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid.  (E-H)  Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (13.8 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.
    Figure Legend Snippet: Effect of pH on ligase intermolecular strand-joining activity . (A-D) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. (E-H) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (13.8 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Techniques Used: Activity Assay, Labeling, Ligation, Binding Assay

    Analysis of intermolecular strand-joining over time . Strand-joining reactions were carried out with 10 pmol 5'-adenylated adapter, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) over a span of 24 hours at 25°C to assess the progress of ligation reactions. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.
    Figure Legend Snippet: Analysis of intermolecular strand-joining over time . Strand-joining reactions were carried out with 10 pmol 5'-adenylated adapter, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) over a span of 24 hours at 25°C to assess the progress of ligation reactions. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Techniques Used: Labeling, Ligation, Binding Assay

    7) Product Images from "Blocking of targeted microRNAs from next-generation sequencing libraries"

    Article Title: Blocking of targeted microRNAs from next-generation sequencing libraries

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv724

    Modification of miRNA sequencing library generation protocol to allow for blocking of targeted species. ( A ) In the standard protocol, a pre-adenylated adaptor is ligated to the 3′ end of a small RNA pool using T4 RNA Ligase 2, truncated. Subsequently, a second adaptor is added to the 5′ end of the miRNA with T4 RNA Ligase 1, followed by reverse transcription and PCR. ( B ) In our modification, a hairpin oligonucleotide with an overhang complementary to the 5′ end of the targeted miRNA is attached via ligation with T4 DNA Ligase to the 5′ end of the miRNA subsequent to the ligation of the adaptor to the 3′ end. This prevents the ligation of the second adaptor to the 5′ end of the miRNA, resulting in a product that does not amplify during PCR. ( C ) Sequencing libraries were generated from human heart total RNA using a titration of a blocking oligonucleotide targeting hsa-miR-16–5p. The fraction of hsa-miR-16–5p present in the blocked library compared to the unblocked library is shown on the y-axis.
    Figure Legend Snippet: Modification of miRNA sequencing library generation protocol to allow for blocking of targeted species. ( A ) In the standard protocol, a pre-adenylated adaptor is ligated to the 3′ end of a small RNA pool using T4 RNA Ligase 2, truncated. Subsequently, a second adaptor is added to the 5′ end of the miRNA with T4 RNA Ligase 1, followed by reverse transcription and PCR. ( B ) In our modification, a hairpin oligonucleotide with an overhang complementary to the 5′ end of the targeted miRNA is attached via ligation with T4 DNA Ligase to the 5′ end of the miRNA subsequent to the ligation of the adaptor to the 3′ end. This prevents the ligation of the second adaptor to the 5′ end of the miRNA, resulting in a product that does not amplify during PCR. ( C ) Sequencing libraries were generated from human heart total RNA using a titration of a blocking oligonucleotide targeting hsa-miR-16–5p. The fraction of hsa-miR-16–5p present in the blocked library compared to the unblocked library is shown on the y-axis.

    Techniques Used: Modification, Sequencing, Blocking Assay, Polymerase Chain Reaction, Ligation, Generated, Titration

    8) Product Images from "Arm-specific cleavage and mutation during reverse transcription of 2΄,5΄-branched RNA by Moloney murine leukemia virus reverse transcriptase"

    Article Title: Arm-specific cleavage and mutation during reverse transcription of 2΄,5΄-branched RNA by Moloney murine leukemia virus reverse transcriptase

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx073

    Scheme of the splinted-ligation method in bRNA construction. In this method, a 2΄-5΄ linked ribo-guanosine (G)-nucleoside in an RNA strand containing the 5΄-segment and 2΄-arm (precursor 1) is transformed into a branchpoint nucleotide by ligation to an RNA strand representing the 3΄-arm (precursor 2). To do so, the two precursors are hybridized partially to a complementary RNA bridge. In this way, the 5΄-phosphate of precursor 2 is brought close to the free 3΄-hydroxyl of the 2΄-5΄ linked nucleoside of precursor 1. The two oligonucleotides are then joined by T4 RNA Ligase 2. Red, blue, and pink symbols ‘w’ represent RNA; the black line represents DNA. The 2΄-5΄ linked ribo-G-nucleoside in precursor 1 at nucleotide (nt) position 37 is highlighted. Nucleic acids downstream of a 2΄-5΄ linkage are plotted vertically in linear and branched oligonucleotides.
    Figure Legend Snippet: Scheme of the splinted-ligation method in bRNA construction. In this method, a 2΄-5΄ linked ribo-guanosine (G)-nucleoside in an RNA strand containing the 5΄-segment and 2΄-arm (precursor 1) is transformed into a branchpoint nucleotide by ligation to an RNA strand representing the 3΄-arm (precursor 2). To do so, the two precursors are hybridized partially to a complementary RNA bridge. In this way, the 5΄-phosphate of precursor 2 is brought close to the free 3΄-hydroxyl of the 2΄-5΄ linked nucleoside of precursor 1. The two oligonucleotides are then joined by T4 RNA Ligase 2. Red, blue, and pink symbols ‘w’ represent RNA; the black line represents DNA. The 2΄-5΄ linked ribo-G-nucleoside in precursor 1 at nucleotide (nt) position 37 is highlighted. Nucleic acids downstream of a 2΄-5΄ linkage are plotted vertically in linear and branched oligonucleotides.

    Techniques Used: Ligation, Transformation Assay

    9) Product Images from "Simple and efficient synthesis of 5? pre-adenylated DNA using thermostable RNA ligase"

    Article Title: Simple and efficient synthesis of 5? pre-adenylated DNA using thermostable RNA ligase

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr544

    Ligation of adenylated DNA linker made with MthRnl to RNA. AppDNA17c-NH 2  was ligated to RNA22 (lane 2) and FAM-RNA23 (lane 4) using T4 RNA ligase 2 truncated without ATP as described in ‘Materials and Methods’ section. Lanes 1 and 3 are controls without ligase. Single-stranded RNA size markers (Mr) are included for reference. The products were analyzed by a 15% urea–PAGE.
    Figure Legend Snippet: Ligation of adenylated DNA linker made with MthRnl to RNA. AppDNA17c-NH 2 was ligated to RNA22 (lane 2) and FAM-RNA23 (lane 4) using T4 RNA ligase 2 truncated without ATP as described in ‘Materials and Methods’ section. Lanes 1 and 3 are controls without ligase. Single-stranded RNA size markers (Mr) are included for reference. The products were analyzed by a 15% urea–PAGE.

    Techniques Used: Ligation, Polyacrylamide Gel Electrophoresis

    10) Product Images from "Simple and efficient synthesis of 5? pre-adenylated DNA using thermostable RNA ligase"

    Article Title: Simple and efficient synthesis of 5? pre-adenylated DNA using thermostable RNA ligase

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr544

    Ligation of adenylated DNA linker made with MthRnl to RNA. AppDNA17c-NH 2  was ligated to RNA22 (lane 2) and FAM-RNA23 (lane 4) using T4 RNA ligase 2 truncated without ATP as described in ‘Materials and Methods’ section. Lanes 1 and 3 are controls without ligase. Single-stranded RNA size markers (Mr) are included for reference. The products were analyzed by a 15% urea–PAGE.
    Figure Legend Snippet: Ligation of adenylated DNA linker made with MthRnl to RNA. AppDNA17c-NH 2 was ligated to RNA22 (lane 2) and FAM-RNA23 (lane 4) using T4 RNA ligase 2 truncated without ATP as described in ‘Materials and Methods’ section. Lanes 1 and 3 are controls without ligase. Single-stranded RNA size markers (Mr) are included for reference. The products were analyzed by a 15% urea–PAGE.

    Techniques Used: Ligation, Polyacrylamide Gel Electrophoresis

    11) Product Images from "Simple and efficient synthesis of 5? pre-adenylated DNA using thermostable RNA ligase"

    Article Title: Simple and efficient synthesis of 5? pre-adenylated DNA using thermostable RNA ligase

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr544

    Ligation of adenylated DNA linker made with MthRnl to RNA. AppDNA17c-NH 2  was ligated to RNA22 (lane 2) and FAM-RNA23 (lane 4) using T4 RNA ligase 2 truncated without ATP as described in ‘Materials and Methods’ section. Lanes 1 and 3 are controls without ligase. Single-stranded RNA size markers (Mr) are included for reference. The products were analyzed by a 15% urea–PAGE.
    Figure Legend Snippet: Ligation of adenylated DNA linker made with MthRnl to RNA. AppDNA17c-NH 2 was ligated to RNA22 (lane 2) and FAM-RNA23 (lane 4) using T4 RNA ligase 2 truncated without ATP as described in ‘Materials and Methods’ section. Lanes 1 and 3 are controls without ligase. Single-stranded RNA size markers (Mr) are included for reference. The products were analyzed by a 15% urea–PAGE.

    Techniques Used: Ligation, Polyacrylamide Gel Electrophoresis

    12) Product Images from "Random-sequence genetic oligomer pools display an innate potential for ligation and recombination"

    Article Title: Random-sequence genetic oligomer pools display an innate potential for ligation and recombination

    Journal: eLife

    doi: 10.7554/eLife.43022

    Analysis of regioselectivity of ligation by H4 and J4 RNA motifs. ( A ) Partial RNAse T1 digest of T4-RNA Ligase 2 (Rnl2) ligated H4 (H4T) (Tab S2) and self-ligated H4T RNA. Regiospecific nuclease-catalysed cleavage at the ligation junction confirms that 3’−5’ linkages were formed in both ligation reactions. Note that cleavage of self-ligated H4T by RNAse T1 is slower due to the presence of the co-purified splint (H4_splintA) RNA used for in-ice H4T ligation. ( B ) A 3’−5’ regioselective 8–17 DNAzyme cleaves a typical self-ligated (H4, lig) or enzymatically ligated (H4, Rnl2) full-length H4 clone from the original semi-random RNA pool at the ligation junction with similar efficiencies. ( C ) A minimal J4 cis motif (J4-min) is unable to cleave an enzymatically produced 3’−5’ ligation site (J4-min Rnl2; lane 1, 2; 15 hr, RT, see Material and methods). In contrast, the same Rnl2 product is efficiently cleaved by a custom DNAzyme (lane 3, E1111_J4) under the same conditions. However, J4-min catalyses reverse cleavage of its own gel-purified in-ice ligation product, suggesting that the ligation reaction of J4 yields RNA with a 2’−5’ phosphodiester linkage. Rapid initial cleavage of self-ligated J4-min that occurs during the mixing dead time is inhibited after annealing of the J4-min RNA to the E1111_J4 DNAzyme, suggesting that the J4 internal loop is a prerequisite for rapid self-cleavage.
    Figure Legend Snippet: Analysis of regioselectivity of ligation by H4 and J4 RNA motifs. ( A ) Partial RNAse T1 digest of T4-RNA Ligase 2 (Rnl2) ligated H4 (H4T) (Tab S2) and self-ligated H4T RNA. Regiospecific nuclease-catalysed cleavage at the ligation junction confirms that 3’−5’ linkages were formed in both ligation reactions. Note that cleavage of self-ligated H4T by RNAse T1 is slower due to the presence of the co-purified splint (H4_splintA) RNA used for in-ice H4T ligation. ( B ) A 3’−5’ regioselective 8–17 DNAzyme cleaves a typical self-ligated (H4, lig) or enzymatically ligated (H4, Rnl2) full-length H4 clone from the original semi-random RNA pool at the ligation junction with similar efficiencies. ( C ) A minimal J4 cis motif (J4-min) is unable to cleave an enzymatically produced 3’−5’ ligation site (J4-min Rnl2; lane 1, 2; 15 hr, RT, see Material and methods). In contrast, the same Rnl2 product is efficiently cleaved by a custom DNAzyme (lane 3, E1111_J4) under the same conditions. However, J4-min catalyses reverse cleavage of its own gel-purified in-ice ligation product, suggesting that the ligation reaction of J4 yields RNA with a 2’−5’ phosphodiester linkage. Rapid initial cleavage of self-ligated J4-min that occurs during the mixing dead time is inhibited after annealing of the J4-min RNA to the E1111_J4 DNAzyme, suggesting that the J4 internal loop is a prerequisite for rapid self-cleavage.

    Techniques Used: Ligation, Purification, Produced

    13) Product Images from "Simple and efficient synthesis of 5? pre-adenylated DNA using thermostable RNA ligase"

    Article Title: Simple and efficient synthesis of 5? pre-adenylated DNA using thermostable RNA ligase

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr544

    Ligation of adenylated DNA linker made with MthRnl to RNA. AppDNA17c-NH 2  was ligated to RNA22 (lane 2) and FAM-RNA23 (lane 4) using T4 RNA ligase 2 truncated without ATP as described in ‘Materials and Methods’ section. Lanes 1 and 3 are controls without ligase. Single-stranded RNA size markers (Mr) are included for reference. The products were analyzed by a 15% urea–PAGE.
    Figure Legend Snippet: Ligation of adenylated DNA linker made with MthRnl to RNA. AppDNA17c-NH 2 was ligated to RNA22 (lane 2) and FAM-RNA23 (lane 4) using T4 RNA ligase 2 truncated without ATP as described in ‘Materials and Methods’ section. Lanes 1 and 3 are controls without ligase. Single-stranded RNA size markers (Mr) are included for reference. The products were analyzed by a 15% urea–PAGE.

    Techniques Used: Ligation, Polyacrylamide Gel Electrophoresis

    14) Product Images from "Blocking of targeted microRNAs from next-generation sequencing libraries"

    Article Title: Blocking of targeted microRNAs from next-generation sequencing libraries

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv724

    Modification of miRNA sequencing library generation protocol to allow for blocking of targeted species. ( A ) In the standard protocol, a pre-adenylated adaptor is ligated to the 3′ end of a small RNA pool using T4 RNA Ligase 2, truncated. Subsequently, a second adaptor is added to the 5′ end of the miRNA with T4 RNA Ligase 1, followed by reverse transcription and PCR. ( B ) In our modification, a hairpin oligonucleotide with an overhang complementary to the 5′ end of the targeted miRNA is attached via ligation with T4 DNA Ligase to the 5′ end of the miRNA subsequent to the ligation of the adaptor to the 3′ end. This prevents the ligation of the second adaptor to the 5′ end of the miRNA, resulting in a product that does not amplify during PCR. ( C ) Sequencing libraries were generated from human heart total RNA using a titration of a blocking oligonucleotide targeting hsa-miR-16–5p. The fraction of hsa-miR-16–5p present in the blocked library compared to the unblocked library is shown on the y-axis.
    Figure Legend Snippet: Modification of miRNA sequencing library generation protocol to allow for blocking of targeted species. ( A ) In the standard protocol, a pre-adenylated adaptor is ligated to the 3′ end of a small RNA pool using T4 RNA Ligase 2, truncated. Subsequently, a second adaptor is added to the 5′ end of the miRNA with T4 RNA Ligase 1, followed by reverse transcription and PCR. ( B ) In our modification, a hairpin oligonucleotide with an overhang complementary to the 5′ end of the targeted miRNA is attached via ligation with T4 DNA Ligase to the 5′ end of the miRNA subsequent to the ligation of the adaptor to the 3′ end. This prevents the ligation of the second adaptor to the 5′ end of the miRNA, resulting in a product that does not amplify during PCR. ( C ) Sequencing libraries were generated from human heart total RNA using a titration of a blocking oligonucleotide targeting hsa-miR-16–5p. The fraction of hsa-miR-16–5p present in the blocked library compared to the unblocked library is shown on the y-axis.

    Techniques Used: Modification, Sequencing, Blocking Assay, Polymerase Chain Reaction, Ligation, Generated, Titration

    15) Product Images from "Uridylation by TUT4/7 Restricts Retrotransposition of Human LINE-1s"

    Article Title: Uridylation by TUT4/7 Restricts Retrotransposition of Human LINE-1s

    Journal: Cell

    doi: 10.1016/j.cell.2018.07.022

    Graphical Visualization of the 3′ RACE-Seq Approach, Related to   Figure 2 (A) Graphical representation of 3′ RACE-seq library preparation and the oligonucleotides used. First, the 3′ adaptor RA3_15N was joined to the 3′ end of RNA by enzymatic ligation. The adaptor has: (i) 5′ rApp modification for efficient and specific ligation by the truncated T4 RNA ligase 2, (ii) delimiter sequence to be used in bioinformatics analyses to exclude RT and PCR artifacts (CTGAC, highlighted in violet), (iii) unique 15N barcode for individual transcript barcoding (highlighted in green), (iv) anchor sequence to pair with the reverse transcription primer (underlined) and (v) dideoxyC on the 3′ end to prevent concatamer formation. The RNA ligated to the adaptor sequence was purified from excess adaptor and reverse transcription was performed with the RT primer, which is compatible with Illumina sequencing and has: (i) sequences to base-pair with the adaptor (underlined), (ii) 6-nucleotide barcode for sample barcoding (highlighted in red), (iii) sequences that base pair with the universal outer primer for nested PCR (blue). Libraries were generated by nested PCR with 2 outer forward primers (F1 and F2) and a single universal reverse primer (uni rev). PCR amplicons of first and second PCRs were purified from excess primers on AmPure beads (Agencourt) before beginning the next step. (B) Flowchart of the bioinformatics approach to 3′ RACE-seq data analysis. The procedure starts at the top. Datasets are shown in rectangles. Software used is depicted in hexagons.
    Figure Legend Snippet: Graphical Visualization of the 3′ RACE-Seq Approach, Related to Figure 2 (A) Graphical representation of 3′ RACE-seq library preparation and the oligonucleotides used. First, the 3′ adaptor RA3_15N was joined to the 3′ end of RNA by enzymatic ligation. The adaptor has: (i) 5′ rApp modification for efficient and specific ligation by the truncated T4 RNA ligase 2, (ii) delimiter sequence to be used in bioinformatics analyses to exclude RT and PCR artifacts (CTGAC, highlighted in violet), (iii) unique 15N barcode for individual transcript barcoding (highlighted in green), (iv) anchor sequence to pair with the reverse transcription primer (underlined) and (v) dideoxyC on the 3′ end to prevent concatamer formation. The RNA ligated to the adaptor sequence was purified from excess adaptor and reverse transcription was performed with the RT primer, which is compatible with Illumina sequencing and has: (i) sequences to base-pair with the adaptor (underlined), (ii) 6-nucleotide barcode for sample barcoding (highlighted in red), (iii) sequences that base pair with the universal outer primer for nested PCR (blue). Libraries were generated by nested PCR with 2 outer forward primers (F1 and F2) and a single universal reverse primer (uni rev). PCR amplicons of first and second PCRs were purified from excess primers on AmPure beads (Agencourt) before beginning the next step. (B) Flowchart of the bioinformatics approach to 3′ RACE-seq data analysis. The procedure starts at the top. Datasets are shown in rectangles. Software used is depicted in hexagons.

    Techniques Used: Ligation, Modification, Sequencing, Polymerase Chain Reaction, Purification, Nested PCR, Generated, Software

    Related Articles

    Clone Assay:

    Article Title: High-efficiency RNA cloning enables accurate quantification of miRNA expression by deep sequencing
    Article Snippet: Labeled RNA was phenol/chloroform extracted, ethanol precipitated, and resuspended in distilled H2 O. .. Initial reactions (Figure A) were composed of 25 femtomoles of labeled RNA, 1 picomole of 5′ adenylated DNA cloning linker, 50 mM Tris-HCl pH 7.5, 10 mM MgCl2 , 1 mM dithiothreitol, 20 units truncated T4 RNA Ligase 2 (residues 1 to 249, K227Q point mutant) (New England Biolabs M0242S Waltham, Massachusetts, USA), and 20 units RNase Inhibitor (Invitrogen N2611 Carlsbad, California, USA). .. Reactions were stopped by the addition of an equal volume of 2X loading dye (7 M urea, 1× TBE, 0.01% bromophenol blue and 0.005% xylene cyanol), briefly heated to 95°C, and snap cooled on ice.

    Article Title: Pervasive translational regulation of the cell signalling circuitry underlies mammalian development
    Article Snippet: 28–31 nt RPFs and 30–50 nt fragmented RNAs were excised from the gel for Ribo-Seq and RNA-Seq respectively. .. RNAs were eluted, dephosphorylated by PNK (NEB, M0201S), and ligated to the miRNA Cloning linker (NEB, S1315S) by T4 RNA Ligase2 truncated K227Q (NEB, M0242S). .. Ligated RNA was gel purified and reverse transcribed by Superscript III (Invitrogen, 18080).

    Article Title: The mammalian ribo-interactome reveals ribosome functional diversity and heterogeneity
    Article Snippet: Samples were eluted with 8.5 uL nuclease free water and incubated with 1.5 uL of 0.5 ug/uL Universal miRNA Cloning Linker (NEB, catalog no. S1315S) and denatured at 80°C for 90 seconds. .. The denatured sample was then incubated with 1 uL T4 RNA Ligase 2, truncated (NEB, catalog no. M0242S), 2 uL 10× buffer, 1 uL SUPERase In, and 6 uL 50% PEG 8000 for 2.5 hours at room temperature.

    Article Title: Evaluating bias-reducing protocols for RNA sequencing library preparation
    Article Snippet: For the CircLig libraries, 40 ng RNA pool (~6 pmol) and 100 ng Universal Cloning Linker (~18 pmol; NEB) were denatured at 80°C for 2 min then placed immediately on ice. .. Ligation with 200 U T4 RNA Ligase 2 truncated K227Q mutant (trRnl2 K227Q; NEB) was performed in the presence of 1X RNA ligase buffer (NEB), 15% PEG8000, 20 U SuperaseIn (Ambion), at 25°C for 3 hr.

    Centrifugation:

    Article Title: RNA regulatory networks diversified through curvature of the PUF protein scaffold
    Article Snippet: The lysate was cleared by centrifugation then incubated with 400 μl pre-washed calmodulin Sepharose beads (GE 17-0529-01) rotating at 4 °C for 1 h. Beads were washed with 10 ml CBB and then incubated in 3 ml CEB (10 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1 mM magnesium acetate, 1 mM imidazole, 2 mM EGTA, 0.1% IGEPAL, 10 mM β-mercaptoethanol) for 45 min rotating at 4 °C, followed by washing with 2 ml CEB. .. Adaptor ligation was performed in 1 × T4 RNA ligase buffer (NEB), T4 RNA ligase truncated (NEB M0242L) RNasin, 1 μM pre-adenylated 3′-adaptor (5′- TGGAATTCTCGGGTGCCAAGG -3′), 10% PEG400 (Sigma, 81170) overnight at 16 °C shaking every minute for 15 s. RNAs were labelled with 5 μl P32 -γ-ATP, 50 units T4 PNK (Promega M4101) in 1 × PNK buffer at 37 °C for 10 min shaking every 5 min for 15 s. Ten microlitres of 10 mM ATP was added to the reaction and incubated for an additional 5 min.

    Amplification:

    Article Title: Identification of cytokine-induced modulation of microRNA expression and secretion as measured by a novel microRNA specific qPCR assay
    Article Snippet: For increased specificity, the miLINKER sequence was derived from the tuberosum phyB gene (GeneBank Y14572) which has been optimized not to hybridize with any known sequences in published genomes. miLINKER is designed to be a substrate of the truncated T4 RNA ligase 2 K227Q (Rnl2tr, NEB Cat: M0242L). .. The miLINKER ligation to mature miRNAs (22–24 nts) results in the formation of a molecule 48 to 50 nts long.

    Article Title: Pervasive translational regulation of the cell signalling circuitry underlies mammalian development
    Article Snippet: RNAs were eluted, dephosphorylated by PNK (NEB, M0201S), and ligated to the miRNA Cloning linker (NEB, S1315S) by T4 RNA Ligase2 truncated K227Q (NEB, M0242S). .. Gel purified cDNAs were circularized by Circligase (Epicentra, CL4111K) and rRNA sequence were subtracted using biotinylated oligos .

    Article Title: Bone Marrow Niche Trafficking of miR-126 Controls Self-Renewal of Leukemia Stem Cells in Chronic Myelogenous Leukemia
    Article Snippet: Total RNA was ligated to the modified 3′ Adapter (5′ TCTGGAATTCTCGGGTGCCAAGGAACTCC) with T4 RNA Ligase 2, truncated (NEB, M0242L) for 1 h at 22°C. .. The product subsequently was ligated to the modified 5′ adaptor (5′GUUCAGAGUUCUACAGUCCGACGAUCNNN) with T4 RNA ligase1 (NEB, M0204L) for 1 h at 20°C.

    Article Title: DNA damage response inhibition at dysfunctional telomeres by modulation of telomeric DNA damage response RNAs
    Article Snippet: The 3′-end of the starting RNA was ligated to a monoadenylated DNA linker by a T4 RNA ligase 2-truncated enzyme (NEB) incubated for 1 h at 25 °C. .. The 3′-end of the starting RNA was ligated to a monoadenylated DNA linker by a T4 RNA ligase 2-truncated enzyme (NEB) incubated for 1 h at 25 °C.

    Synthesized:

    Article Title: Landscape of Fluid Sets of Hairpin-Derived 21-/24-nt-Long Small RNAs at Seed Set Uncovers Special Epigenetic Features in Picea glauca
    Article Snippet: A 3′ adapter that is an adenylated single-stranded DNA was selectively ligated to the sRNA template using a truncated T4 RNA ligase 2 (NEB Canada, cat. M0242L). .. A 3′ adapter that is an adenylated single-stranded DNA was selectively ligated to the sRNA template using a truncated T4 RNA ligase 2 (NEB Canada, cat. M0242L).

    Article Title: Large-scale profiling of microRNAs for The Cancer Genome Atlas
    Article Snippet: A 3′ adapter was ligated to the RNA template using a truncated T4 RNA ligase2 (NEB Canada, cat. M0242L) with an incubation of 1 h at 22°C. .. An RNA 5′ adapter was then added, using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and was incubated at 37°C for 1 h. The sequence of the single strand RNA adapter is 5′GUUCAGAGUUCUACAGUCCGACGAUCUGGUCAA3′.

    Blocking Assay:

    Article Title: Protein Interaction Profile Sequencing (PIP-seq)
    Article Snippet: The double-stranded DNA sequences are then digested by the by the double-stranded nuclease (DSN), dramatically reducing the rRNA and tRNA content. .. Protein interaction profile RNA (Basic Protocol 2) 10× Fragmentation Reagent (Life Technologies, cat. no. AM8740) Fragmentation Stop Solution (Life Technologies, cat. no. AM8740) DEPC-treated H2 O 5 mg/ml Glycogen, ultrapure (Life Technologies, cat. no. AM9510) 3 M NaOAc (pH = 5.5) (Life Technologies, cat. no. AM9740) 100% EtOH (Decon Labs, cat. no. 2716) 80% EtOH Ice T4 DNA ligase buffer (NEB, cat. no. B0202S) T4 polynucleotide kinase (NEB, cat. no. M0201S) 10 mM ATP (Life Technologies, cat. no. AM8110G) 10× TBE (Bio-Rad, 161-0733) Gel loading buffer II (Life Technologies, cat. no. AM8546G) 10-bp DNA ladder (Life Technologies, cat. no. 10821-015) 10 mg/ml Ethidium Bromide (Life Technologies, cat. no. 15585-011) 0.3 M NaCl 5 μM 3′ Adapter (RA3) (TGGAATTCTCGGGTGCCAAGG) RNA Ligase Buffer (NEB, cat. no. B0216L) RNaseOUT (Life Technologies, cat. no. 10777019) 200 U/μl Epicenter T4 RNA Ligase 2, truncated (NEB, cat. no. M0242S) 25 μM 5′ Adapter (RA5) (GUUCAGAGUUCUACAGUCCGACGAUC) T4 RNA Ligase 1 (NEB, cat. no. M0204S) RNA RT Primer (RTP) (GCCTTGGCACCCGAGAATTCCA) 5× First-Strand Buffer (Life Technologies, cat. no. 18064-014) 50 mM dNTPs 100 mM DTT (Life Technologies, cat. no. 18064-014) SuperScript II Reverse Transcriptase (Life Technologies, cat. no. 18064-014) 2× Phusion Mix (NEB, cat. no. M0531S) 5 mM Betaine (MP Biomedicals, cat. no. 215046180) 10 μM RNA PCR Primer (RTP) (GCCTTGGCACCCGAGAATTCCA) 10 μM RNA PCR Primer Index Nuclease-free water 25-bp DNA ladder (Life Technologies, cat. no. 10597-011) DSN Hybridization buffer (see recipe) 10× DSN Master Mix (Evrogen, cat. no. EA001) DSN Enzyme (Evrogen, cat. no. EA001) DSN STOP solution (Evrogen, cat. no. EA001) 1.7-ml tubes 70°C heat block Centrifuge 37°C heat block 1.0-mm, 10-well 15% TBE-Urea gels (Life Technologies, cat. no. EC6885BOX) Gel box for running prepoured gels (Life, Technologies, cat. no. EI0001) 18-G needles Razor blades Gel Breaker Tubes (IST Engineering, cat. no. 388-100) 2-ml tubes End-over-end rotator Spin-X columns (Costar, cat. no. 8160) 200-μl PCR tubes Thermal cycler 6% TBE gels 1.0 mm, 10 well (Invitrogen, cat. no. EC6265BOX) .. Add 1 μl of 10× Fragmentation Reagent to 9 μl RNA in a 1.7-ml tube.

    Real-time Polymerase Chain Reaction:

    Article Title: Identification of cytokine-induced modulation of microRNA expression and secretion as measured by a novel microRNA specific qPCR assay
    Article Snippet: For increased specificity, the miLINKER sequence was derived from the tuberosum phyB gene (GeneBank Y14572) which has been optimized not to hybridize with any known sequences in published genomes. miLINKER is designed to be a substrate of the truncated T4 RNA ligase 2 K227Q (Rnl2tr, NEB Cat: M0242L). .. The miLINKER ligation to mature miRNAs (22–24 nts) results in the formation of a molecule 48 to 50 nts long.

    Incubation:

    Article Title: Identification of cytokine-induced modulation of microRNA expression and secretion as measured by a novel microRNA specific qPCR assay
    Article Snippet: The presented method exploits the characteristic of Rnl2tr (NEB; Cat M0242L) and PrimeScript (Takara; Cat 2680A) to respectively elongate and reverse transcriptase elongated miRNAs. .. To the purpose of elongate miRNAs, 10 ng of total RNA (or 4 μl of miRNeasy isolated Exosomal-RNAs) are dilute into 4 μl of nuclease free water, mixed with 4 μl of Elongation Mix ( ) and incubated for 30 minutes at 25 °C.

    Article Title: A Genome-Wide Survey of Highly Expressed Non-Coding RNAs and Biological Validation of Selected Candidates in Agrobacterium tumefaciens
    Article Snippet: A 25 µl reaction mixture was incubated at 37°C for 1 hour on a pre-heated thermal cycler. .. Next, a master mix of 4 µl was prepared as following before adding to the 6 µl reaction: 2 µl Ligation Buffer (HML) (part#15013206, Illumina), 1 µl RNase Inhibitor (part#15003548, Illumina), and 1 µl T4 RNA Ligase 2 Deletion Mutant (part# M0242S, NEB).

    Article Title: Large-scale profiling of microRNAs for The Cancer Genome Atlas
    Article Snippet: Approximately 1 μg of either total RNA or messenger RNA-depleted RNA, containing small RNA species was used. .. A 3′ adapter was ligated to the RNA template using a truncated T4 RNA ligase2 (NEB Canada, cat. M0242L) with an incubation of 1 h at 22°C. .. This adapter was an adenylated, single-strand DNA with the sequence 5′ /5rApp/ ATCTCGTATGCCGTCTTCTGCTTGT /3ddC/, which selectively ligated miRNAs.

    Article Title: RNA regulatory networks diversified through curvature of the PUF protein scaffold
    Article Snippet: Beads were incubated in 1 × PNK pH 6.5 buffer, 1 unit T4 PNK (NEB M0201s), 100 units RNasin (Promega N2511) and 5 units alkaline phosphatase (Promgea M1821 ) at 37 °C for 20 min shaking every 3 min for 15 s followed by washing 2 × with 1 × PNK+EGTA buffer (50 mM Tris (pH 7.5), 20 mM EGTA, 0.5% IGEPAL) and 2 × with 1X PNK buffer. .. Adaptor ligation was performed in 1 × T4 RNA ligase buffer (NEB), T4 RNA ligase truncated (NEB M0242L) RNasin, 1 μM pre-adenylated 3′-adaptor (5′- TGGAATTCTCGGGTGCCAAGG -3′), 10% PEG400 (Sigma, 81170) overnight at 16 °C shaking every minute for 15 s. RNAs were labelled with 5 μl P32 -γ-ATP, 50 units T4 PNK (Promega M4101) in 1 × PNK buffer at 37 °C for 10 min shaking every 5 min for 15 s. Ten microlitres of 10 mM ATP was added to the reaction and incubated for an additional 5 min. .. The reaction was quenched by washing 2 × with high-salt buffer and then 2 × with 1 × PNK.

    Article Title: The mammalian ribo-interactome reveals ribosome functional diversity and heterogeneity
    Article Snippet: Samples were eluted with 8.5 uL nuclease free water and incubated with 1.5 uL of 0.5 ug/uL Universal miRNA Cloning Linker (NEB, catalog no. S1315S) and denatured at 80°C for 90 seconds. .. The denatured sample was then incubated with 1 uL T4 RNA Ligase 2, truncated (NEB, catalog no. M0242S), 2 uL 10× buffer, 1 uL SUPERase In, and 6 uL 50% PEG 8000 for 2.5 hours at room temperature. .. Samples were then purified using Zymo RNA Clean & Concentrator 5 columns (100 uL sample, 200 uL RNA binding buffer, 450 uL 100% ethanol).

    Article Title: Transfection of microRNA Mimics Should Be Used with Caution
    Article Snippet: 10 pmol of 3′-adenylated DNA adapter (5′-AppT GGAATTCTCGGGTGCCAAGGddC) is combined with 1 μg total RNA in a 4 μl volume, heated to 70°C for 2 min and then placed on ice. .. In a separate tube, 2 μl 10X T4 RNA Ligase 2 Truncated reaction buffer (NEB), 2 μl 50% PEG8000 (NEB), 1 μl RNase OUT (Lifetech) and 1 μl T4 RNA Ligase 2 Truncated enzyme (NEB) were combined and added to the RNA/3′adapter mix and incubated at 28°C for 1 h. This mixture was then heated to 70°C for 2 min. .. 1 μl water, 1 μl 10 mM ATP, 1 μl T4 RNA Ligase and 1 μl 5′ RNA adapter (25 pmol, 5′-GUUCA GAGUUCUACAGUCCGACGAUC) were added and incubated at 28°C for 1 h.

    Article Title: DNA damage response inhibition at dysfunctional telomeres by modulation of telomeric DNA damage response RNAs
    Article Snippet: Two linkers were ligated to the two ends of the RNA molecules in the sample to be analysed. .. The 3′-end of the starting RNA was ligated to a monoadenylated DNA linker by a T4 RNA ligase 2-truncated enzyme (NEB) incubated for 1 h at 25 °C. .. The 5′ RNA linker was then ligated by a T4 RNA ligase 1 (NEB) to the target RNA at 20 °C for 1 h, after removing the 5′ cap structure by Tobacco Acid Pyrophosphatase (Epicentre), incubated at 37 °C for 1 h. Linkers enabled cDNA synthesis using PrimeScript RT–PCR Kit (Takara).

    Modification:

    Article Title: Bone Marrow Niche Trafficking of miR-126 Controls Self-Renewal of Leukemia Stem Cells in Chronic Myelogenous Leukemia
    Article Snippet: Briefly, 250ng of total RNA was used for smRNA sequencing library construction. .. Total RNA was ligated to the modified 3′ Adapter (5′ TCTGGAATTCTCGGGTGCCAAGGAACTCC) with T4 RNA Ligase 2, truncated (NEB, M0242L) for 1 h at 22°C. .. The unligated free 3′ adaptors were blocked by annealing with RT primer (5′ GGAGTTCCTTGGCACCCGAGAATTCCA) at 75°C for 5min, 37°C for 30 min and 25°C for 15 min.

    RNA Binding Assay:

    Article Title: Rules of RNA specificity of hnRNP A1 revealed by global and quantitative analysis of its affinity distribution
    Article Snippet: Paragraph title: Measurement of RNA Binding Affinity Distributions by HTS-EQ. ... Following separation of unbound and UP1 bound SL3ESS3 variants, the unbound RNAs were ligated to a 17-nt adapter, 5′-rAppCTGTAGGCACCATCAAT-NH2-3′ (NEB S1315S; New England Biolabs) by T4 RNA ligase 2 (NEB M0242S; New England Biolabs), and gel purification was used to remove the unreacted sequences.

    Article Title: The mammalian ribo-interactome reveals ribosome functional diversity and heterogeneity
    Article Snippet: The fragmented total RNA and ribosome protected fragments were then purified using Zymo RNA Clean & Concentrator 5 columns using a protocol in which 100 uL sample, 200 uL RNA binding buffer, and 450 uL 100% ethanol were used for binding (see above). .. The denatured sample was then incubated with 1 uL T4 RNA Ligase 2, truncated (NEB, catalog no. M0242S), 2 uL 10× buffer, 1 uL SUPERase In, and 6 uL 50% PEG 8000 for 2.5 hours at room temperature.

    Derivative Assay:

    Article Title: Identification of cytokine-induced modulation of microRNA expression and secretion as measured by a novel microRNA specific qPCR assay
    Article Snippet: RNA elongation is achieved through the ligation of the miLINKER (a 26 nts long linker-adaptor; IDT USA; ) to RNAs 3′-ends. .. For increased specificity, the miLINKER sequence was derived from the tuberosum phyB gene (GeneBank Y14572) which has been optimized not to hybridize with any known sequences in published genomes. miLINKER is designed to be a substrate of the truncated T4 RNA ligase 2 K227Q (Rnl2tr, NEB Cat: M0242L). .. For this purpose, the linker was synthesized with a 5′, 5′-adenyl group at the 5′-end, while a Dideoxycytidine group blocks the linker’s 3′-end ( and ).

    Hybridization:

    Article Title: Protein Interaction Profile Sequencing (PIP-seq)
    Article Snippet: The double-stranded DNA sequences are then digested by the by the double-stranded nuclease (DSN), dramatically reducing the rRNA and tRNA content. .. Protein interaction profile RNA (Basic Protocol 2) 10× Fragmentation Reagent (Life Technologies, cat. no. AM8740) Fragmentation Stop Solution (Life Technologies, cat. no. AM8740) DEPC-treated H2 O 5 mg/ml Glycogen, ultrapure (Life Technologies, cat. no. AM9510) 3 M NaOAc (pH = 5.5) (Life Technologies, cat. no. AM9740) 100% EtOH (Decon Labs, cat. no. 2716) 80% EtOH Ice T4 DNA ligase buffer (NEB, cat. no. B0202S) T4 polynucleotide kinase (NEB, cat. no. M0201S) 10 mM ATP (Life Technologies, cat. no. AM8110G) 10× TBE (Bio-Rad, 161-0733) Gel loading buffer II (Life Technologies, cat. no. AM8546G) 10-bp DNA ladder (Life Technologies, cat. no. 10821-015) 10 mg/ml Ethidium Bromide (Life Technologies, cat. no. 15585-011) 0.3 M NaCl 5 μM 3′ Adapter (RA3) (TGGAATTCTCGGGTGCCAAGG) RNA Ligase Buffer (NEB, cat. no. B0216L) RNaseOUT (Life Technologies, cat. no. 10777019) 200 U/μl Epicenter T4 RNA Ligase 2, truncated (NEB, cat. no. M0242S) 25 μM 5′ Adapter (RA5) (GUUCAGAGUUCUACAGUCCGACGAUC) T4 RNA Ligase 1 (NEB, cat. no. M0204S) RNA RT Primer (RTP) (GCCTTGGCACCCGAGAATTCCA) 5× First-Strand Buffer (Life Technologies, cat. no. 18064-014) 50 mM dNTPs 100 mM DTT (Life Technologies, cat. no. 18064-014) SuperScript II Reverse Transcriptase (Life Technologies, cat. no. 18064-014) 2× Phusion Mix (NEB, cat. no. M0531S) 5 mM Betaine (MP Biomedicals, cat. no. 215046180) 10 μM RNA PCR Primer (RTP) (GCCTTGGCACCCGAGAATTCCA) 10 μM RNA PCR Primer Index Nuclease-free water 25-bp DNA ladder (Life Technologies, cat. no. 10597-011) DSN Hybridization buffer (see recipe) 10× DSN Master Mix (Evrogen, cat. no. EA001) DSN Enzyme (Evrogen, cat. no. EA001) DSN STOP solution (Evrogen, cat. no. EA001) 1.7-ml tubes 70°C heat block Centrifuge 37°C heat block 1.0-mm, 10-well 15% TBE-Urea gels (Life Technologies, cat. no. EC6885BOX) Gel box for running prepoured gels (Life, Technologies, cat. no. EI0001) 18-G needles Razor blades Gel Breaker Tubes (IST Engineering, cat. no. 388-100) 2-ml tubes End-over-end rotator Spin-X columns (Costar, cat. no. 8160) 200-μl PCR tubes Thermal cycler 6% TBE gels 1.0 mm, 10 well (Invitrogen, cat. no. EC6265BOX) .. Add 1 μl of 10× Fragmentation Reagent to 9 μl RNA in a 1.7-ml tube.

    Electron Microscopy:

    Article Title: A detailed protocol for subcellular RNA sequencing (subRNA-seq)
    Article Snippet: Although we describe a NET-seq-based library preparation method here, we expect that our cell fractionation and RNA isolation approach ( BASIC PROTOCOL 1 ) can also be combined with alternative library preparation protocols to obtain sequencing libraries. .. RNase/DNase-free H2 O (Life Technologies, cat. no. 10977-015) Ribo-Zero rRNA Removal Kit (Epicentre, cat. no. MRZH116) 80% (vol/vol) ethanol (VWR, cat. no. V1016) Sodium carbonate anhydrous (VWR, cat. no. M138) Sodium bicarbonate (VWR, cat. no. 3509) EDTA (0.5 M; Life Technologies, cat. no. AM9260G) Isopropanol (Sigma, cat. no. 278475) RNA control ladder (0.1–2 kb; Life Technologies, cat. no. 15623-100) 2x TBU denaturing loading buffer (Life Technologies, cat. no. LC6876) TBE-urea gels, 15% (wt/vol) (Life Technologies, cat. no. EC68852BOX) TBE buffer, 10x (Life Technologies, cat. no. 15581-044) Orange G (Sigma, cat. no. O3756) SYBR Gold Nucleic Acid Gel Stain (10,000x concentrate; Life Technologies, cat. no. S-11494) PEG8000 (part of T4 RNA Ligase 2, truncated, NEB, cat. no. M0242S) DMSO (Sigma, cat. no. D8418) T4 RNA Ligase Buffer, 10x (part of T4 RNA Ligase 2, truncated, NEB, cat. no. M0242S) T4 RNA Ligase 2, truncated (NEB, cat. no. M0242S) GlycoBlue (15 mg/ml; Life Technologies, cat. no. AM9515) Sodium acetate, RNase-free (3 M; Life Technologies, cat. no. AM9740) T4 PNK Buffer, 10x (part of T4 Polynucleotide Kinase, NEB, cat. no. M0201S) T4 Polynucleotide Kinase (10,000 U/ml; NEB, cat. no. M0201S) DTT (0.1 M; part of the SuperScript III First-Strand Synthesis System, Life Technologies, cat. no. 18080-051) SUPERase.In (20 U/μl; Life Technologies, cat. no. AM2696) 5x First-Strand Buffer (part of SuperScript III First-Strand Synthesis System, Life Technologies, cat. no. 18080-051) dNTP mix (10 mM; Life Technologies, cat. no. 18427-013) SuperScript III First-Strand Synthesis System (Life Technologies, cat. no. 18080-051) TBE-urea gels, 10% (wt/vol) (Life Technologies, cat. no. EC68752BOX) CircLigase Reaction Buffer, 10x (part of CircLigase ssDNA Ligase, Epicentre, cat. no. CL4111K) ATP, 1 mM (part of CircLigase ssDNA Ligase, Epicentre, cat. no. CL4111K) MnCl2 , 50 mM (part of CircLigase ssDNA Ligase, Epicentre, cat. no. CL4111K) CircLigase ssDNA Ligase (100 U/μl; Epicentre, cat. no. CL4111K) Phusion HF Buffer, 5x (part of Phusion High-Fidelity DNA Polymerase, NEB, cat. no. M0530S) Phusion DNA Polymerase (2,000 U/ml; NEB, cat. no. M0530S) DNA control ladder (10 bp; Life Technologies, cat. no. 10821-015) TBE gels, 8% (wt/vol) (Life Technologies, cat. no. EC62152BOX) Qubit dsDNA HS Assay Kit (Life Technologies, cat. no. ) High Sensitivity DNA Analysis Kit (Agilent Technologies, cat. no. 5067-4626) Scalpels (Electron Microscopy Sciences, cat. no. 72042-11) 20G Needle (BD, cat. no. 305175) Microfuge tube filter: Costar Spin-X centrifuge tube filters (Sigma, cat. no. CLS8162-96EA) CAUTION: Sodium carbonate causes irritations. .. Solutions containing sodium carbonate should be used with care.

    Ligation:

    Article Title: High-efficiency RNA cloning enables accurate quantification of miRNA expression by deep sequencing
    Article Snippet: Paragraph title: 3′ ligation reactions ... Initial reactions (Figure A) were composed of 25 femtomoles of labeled RNA, 1 picomole of 5′ adenylated DNA cloning linker, 50 mM Tris-HCl pH 7.5, 10 mM MgCl2 , 1 mM dithiothreitol, 20 units truncated T4 RNA Ligase 2 (residues 1 to 249, K227Q point mutant) (New England Biolabs M0242S Waltham, Massachusetts, USA), and 20 units RNase Inhibitor (Invitrogen N2611 Carlsbad, California, USA).

    Article Title: Identification of cytokine-induced modulation of microRNA expression and secretion as measured by a novel microRNA specific qPCR assay
    Article Snippet: RNA elongation is achieved through the ligation of the miLINKER (a 26 nts long linker-adaptor; IDT USA; ) to RNAs 3′-ends. .. For increased specificity, the miLINKER sequence was derived from the tuberosum phyB gene (GeneBank Y14572) which has been optimized not to hybridize with any known sequences in published genomes. miLINKER is designed to be a substrate of the truncated T4 RNA ligase 2 K227Q (Rnl2tr, NEB Cat: M0242L).

    Article Title: Landscape of Fluid Sets of Hairpin-Derived 21-/24-nt-Long Small RNAs at Seed Set Uncovers Special Epigenetic Features in Picea glauca
    Article Snippet: A 3′ adapter that is an adenylated single-stranded DNA was selectively ligated to the sRNA template using a truncated T4 RNA ligase 2 (NEB Canada, cat. M0242L). .. A 3′ adapter that is an adenylated single-stranded DNA was selectively ligated to the sRNA template using a truncated T4 RNA ligase 2 (NEB Canada, cat. M0242L).

    Article Title: A Genome-Wide Survey of Highly Expressed Non-Coding RNAs and Biological Validation of Selected Candidates in Agrobacterium tumefaciens
    Article Snippet: Five microliter of purified fragmented RNAs were ligated with 1 µl RNA 3′ Adapter (RA3) (part# 15013207, Illumina); reactions were heated at 70°C for 2 minutes, then immediately cooled on ice. .. Next, a master mix of 4 µl was prepared as following before adding to the 6 µl reaction: 2 µl Ligation Buffer (HML) (part#15013206, Illumina), 1 µl RNase Inhibitor (part#15003548, Illumina), and 1 µl T4 RNA Ligase 2 Deletion Mutant (part# M0242S, NEB). .. The 10 µl reaction was incubated on the pre-heated thermal cycler at 28°C for 1 hour.

    Article Title: Large-scale profiling of microRNAs for The Cancer Genome Atlas
    Article Snippet: A 3′ adapter was ligated to the RNA template using a truncated T4 RNA ligase2 (NEB Canada, cat. M0242L) with an incubation of 1 h at 22°C. .. An RNA 5′ adapter was then added, using a T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and was incubated at 37°C for 1 h. The sequence of the single strand RNA adapter is 5′GUUCAGAGUUCUACAGUCCGACGAUCUGGUCAA3′.

    Article Title: RNA regulatory networks diversified through curvature of the PUF protein scaffold
    Article Snippet: Beads were incubated in 1 × PNK pH 6.5 buffer, 1 unit T4 PNK (NEB M0201s), 100 units RNasin (Promega N2511) and 5 units alkaline phosphatase (Promgea M1821 ) at 37 °C for 20 min shaking every 3 min for 15 s followed by washing 2 × with 1 × PNK+EGTA buffer (50 mM Tris (pH 7.5), 20 mM EGTA, 0.5% IGEPAL) and 2 × with 1X PNK buffer. .. Adaptor ligation was performed in 1 × T4 RNA ligase buffer (NEB), T4 RNA ligase truncated (NEB M0242L) RNasin, 1 μM pre-adenylated 3′-adaptor (5′- TGGAATTCTCGGGTGCCAAGG -3′), 10% PEG400 (Sigma, 81170) overnight at 16 °C shaking every minute for 15 s. RNAs were labelled with 5 μl P32 -γ-ATP, 50 units T4 PNK (Promega M4101) in 1 × PNK buffer at 37 °C for 10 min shaking every 5 min for 15 s. Ten microlitres of 10 mM ATP was added to the reaction and incubated for an additional 5 min. .. The reaction was quenched by washing 2 × with high-salt buffer and then 2 × with 1 × PNK.

    Article Title: Transfection of microRNA Mimics Should Be Used with Caution
    Article Snippet: Paragraph title: 3′ adapter ligation ... In a separate tube, 2 μl 10X T4 RNA Ligase 2 Truncated reaction buffer (NEB), 2 μl 50% PEG8000 (NEB), 1 μl RNase OUT (Lifetech) and 1 μl T4 RNA Ligase 2 Truncated enzyme (NEB) were combined and added to the RNA/3′adapter mix and incubated at 28°C for 1 h. This mixture was then heated to 70°C for 2 min.

    Article Title: Evaluating bias-reducing protocols for RNA sequencing library preparation
    Article Snippet: For the CircLig libraries, 40 ng RNA pool (~6 pmol) and 100 ng Universal Cloning Linker (~18 pmol; NEB) were denatured at 80°C for 2 min then placed immediately on ice. .. Ligation with 200 U T4 RNA Ligase 2 truncated K227Q mutant (trRnl2 K227Q; NEB) was performed in the presence of 1X RNA ligase buffer (NEB), 15% PEG8000, 20 U SuperaseIn (Ambion), at 25°C for 3 hr. .. Ligation with 20 pmol Mth K97A was performed in 1X NEB1 buffer and 20 U SuperaseIn, at 65°C for 1 hr, as described by Zhelkovsky and McReynolds (11).

    Gel Purification:

    Article Title: Bone Marrow Niche Trafficking of miR-126 Controls Self-Renewal of Leukemia Stem Cells in Chronic Myelogenous Leukemia
    Article Snippet: Total RNA was ligated to the modified 3′ Adapter (5′ TCTGGAATTCTCGGGTGCCAAGGAACTCC) with T4 RNA Ligase 2, truncated (NEB, M0242L) for 1 h at 22°C. .. The product subsequently was ligated to the modified 5′ adaptor (5′GUUCAGAGUUCUACAGUCCGACGAUCNNN) with T4 RNA ligase1 (NEB, M0204L) for 1 h at 20°C.

    Article Title: Rules of RNA specificity of hnRNP A1 revealed by global and quantitative analysis of its affinity distribution
    Article Snippet: The sample preparation steps were similar to those sample preparation steps published previously ( ). .. Following separation of unbound and UP1 bound SL3ESS3 variants, the unbound RNAs were ligated to a 17-nt adapter, 5′-rAppCTGTAGGCACCATCAAT-NH2-3′ (NEB S1315S; New England Biolabs) by T4 RNA ligase 2 (NEB M0242S; New England Biolabs), and gel purification was used to remove the unreacted sequences. .. The adapter-ligated RNA constructs were then reverse-transcribed using SuperScript III Reverse Transcriptase (ThermoFisher) and the following reverse transcription primer: 5′-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3′.

    Polymerase Chain Reaction:

    Article Title: Protein Interaction Profile Sequencing (PIP-seq)
    Article Snippet: The double-stranded DNA sequences are then digested by the by the double-stranded nuclease (DSN), dramatically reducing the rRNA and tRNA content. .. Protein interaction profile RNA (Basic Protocol 2) 10× Fragmentation Reagent (Life Technologies, cat. no. AM8740) Fragmentation Stop Solution (Life Technologies, cat. no. AM8740) DEPC-treated H2 O 5 mg/ml Glycogen, ultrapure (Life Technologies, cat. no. AM9510) 3 M NaOAc (pH = 5.5) (Life Technologies, cat. no. AM9740) 100% EtOH (Decon Labs, cat. no. 2716) 80% EtOH Ice T4 DNA ligase buffer (NEB, cat. no. B0202S) T4 polynucleotide kinase (NEB, cat. no. M0201S) 10 mM ATP (Life Technologies, cat. no. AM8110G) 10× TBE (Bio-Rad, 161-0733) Gel loading buffer II (Life Technologies, cat. no. AM8546G) 10-bp DNA ladder (Life Technologies, cat. no. 10821-015) 10 mg/ml Ethidium Bromide (Life Technologies, cat. no. 15585-011) 0.3 M NaCl 5 μM 3′ Adapter (RA3) (TGGAATTCTCGGGTGCCAAGG) RNA Ligase Buffer (NEB, cat. no. B0216L) RNaseOUT (Life Technologies, cat. no. 10777019) 200 U/μl Epicenter T4 RNA Ligase 2, truncated (NEB, cat. no. M0242S) 25 μM 5′ Adapter (RA5) (GUUCAGAGUUCUACAGUCCGACGAUC) T4 RNA Ligase 1 (NEB, cat. no. M0204S) RNA RT Primer (RTP) (GCCTTGGCACCCGAGAATTCCA) 5× First-Strand Buffer (Life Technologies, cat. no. 18064-014) 50 mM dNTPs 100 mM DTT (Life Technologies, cat. no. 18064-014) SuperScript II Reverse Transcriptase (Life Technologies, cat. no. 18064-014) 2× Phusion Mix (NEB, cat. no. M0531S) 5 mM Betaine (MP Biomedicals, cat. no. 215046180) 10 μM RNA PCR Primer (RTP) (GCCTTGGCACCCGAGAATTCCA) 10 μM RNA PCR Primer Index Nuclease-free water 25-bp DNA ladder (Life Technologies, cat. no. 10597-011) DSN Hybridization buffer (see recipe) 10× DSN Master Mix (Evrogen, cat. no. EA001) DSN Enzyme (Evrogen, cat. no. EA001) DSN STOP solution (Evrogen, cat. no. EA001) 1.7-ml tubes 70°C heat block Centrifuge 37°C heat block 1.0-mm, 10-well 15% TBE-Urea gels (Life Technologies, cat. no. EC6885BOX) Gel box for running prepoured gels (Life, Technologies, cat. no. EI0001) 18-G needles Razor blades Gel Breaker Tubes (IST Engineering, cat. no. 388-100) 2-ml tubes End-over-end rotator Spin-X columns (Costar, cat. no. 8160) 200-μl PCR tubes Thermal cycler 6% TBE gels 1.0 mm, 10 well (Invitrogen, cat. no. EC6265BOX) .. Add 1 μl of 10× Fragmentation Reagent to 9 μl RNA in a 1.7-ml tube.

    Article Title: High-Throughput Sequencing of RNA Isolated by Cross- Linking and Immunoprecipitation (HITS-CLIP) to Determine Sites of Binding of CstF-64 on Nascent RNAs
    Article Snippet: T4 RNA Ligase 2, truncated (M0242L, New England Biolabs). .. T4 RNA Ligase 2, truncated (M0242L, New England Biolabs).

    Article Title: Landscape of Fluid Sets of Hairpin-Derived 21-/24-nt-Long Small RNAs at Seed Set Uncovers Special Epigenetic Features in Picea glauca
    Article Snippet: A 3′ adapter that is an adenylated single-stranded DNA was selectively ligated to the sRNA template using a truncated T4 RNA ligase 2 (NEB Canada, cat. M0242L). .. After ligation, first-strand cDNA was synthesized using a Superscript II Reverse Transcriptase (Invitrogen, cat. 18064 014) and one RT primer.

    Article Title: Large-scale profiling of microRNAs for The Cancer Genome Atlas
    Article Snippet: A 3′ adapter was ligated to the RNA template using a truncated T4 RNA ligase2 (NEB Canada, cat. M0242L) with an incubation of 1 h at 22°C. .. A 3′ adapter was ligated to the RNA template using a truncated T4 RNA ligase2 (NEB Canada, cat. M0242L) with an incubation of 1 h at 22°C.

    Article Title: Pervasive translational regulation of the cell signalling circuitry underlies mammalian development
    Article Snippet: RNAs were eluted, dephosphorylated by PNK (NEB, M0201S), and ligated to the miRNA Cloning linker (NEB, S1315S) by T4 RNA Ligase2 truncated K227Q (NEB, M0242S). .. Amplification was done using Phusion High Fidelity DNA Polymerase (NEB, M0530S).

    Article Title: Bone Marrow Niche Trafficking of miR-126 Controls Self-Renewal of Leukemia Stem Cells in Chronic Myelogenous Leukemia
    Article Snippet: Total RNA was ligated to the modified 3′ Adapter (5′ TCTGGAATTCTCGGGTGCCAAGGAACTCC) with T4 RNA Ligase 2, truncated (NEB, M0242L) for 1 h at 22°C. .. The product subsequently was ligated to the modified 5′ adaptor (5′GUUCAGAGUUCUACAGUCCGACGAUCNNN) with T4 RNA ligase1 (NEB, M0204L) for 1 h at 20°C.

    Article Title: Rules of RNA specificity of hnRNP A1 revealed by global and quantitative analysis of its affinity distribution
    Article Snippet: Following separation of unbound and UP1 bound SL3ESS3 variants, the unbound RNAs were ligated to a 17-nt adapter, 5′-rAppCTGTAGGCACCATCAAT-NH2-3′ (NEB S1315S; New England Biolabs) by T4 RNA ligase 2 (NEB M0242S; New England Biolabs), and gel purification was used to remove the unreacted sequences. .. After gel purification, the RT products were cyclized by CircLigase ssDNA Ligase.

    Article Title: DNA damage response inhibition at dysfunctional telomeres by modulation of telomeric DNA damage response RNAs
    Article Snippet: The 3′-end of the starting RNA was ligated to a monoadenylated DNA linker by a T4 RNA ligase 2-truncated enzyme (NEB) incubated for 1 h at 25 °C. .. The 5′ RNA linker was then ligated by a T4 RNA ligase 1 (NEB) to the target RNA at 20 °C for 1 h, after removing the 5′ cap structure by Tobacco Acid Pyrophosphatase (Epicentre), incubated at 37 °C for 1 h. Linkers enabled cDNA synthesis using PrimeScript RT–PCR Kit (Takara).

    Sequencing:

    Article Title: Identification of cytokine-induced modulation of microRNA expression and secretion as measured by a novel microRNA specific qPCR assay
    Article Snippet: RNA elongation is achieved through the ligation of the miLINKER (a 26 nts long linker-adaptor; IDT USA; ) to RNAs 3′-ends. .. For increased specificity, the miLINKER sequence was derived from the tuberosum phyB gene (GeneBank Y14572) which has been optimized not to hybridize with any known sequences in published genomes. miLINKER is designed to be a substrate of the truncated T4 RNA ligase 2 K227Q (Rnl2tr, NEB Cat: M0242L). .. For this purpose, the linker was synthesized with a 5′, 5′-adenyl group at the 5′-end, while a Dideoxycytidine group blocks the linker’s 3′-end ( and ).

    Article Title: Landscape of Fluid Sets of Hairpin-Derived 21-/24-nt-Long Small RNAs at Seed Set Uncovers Special Epigenetic Features in Picea glauca
    Article Snippet: Paragraph title: RNA Isolation, Library Construction, and sRNA Sequencing ... A 3′ adapter that is an adenylated single-stranded DNA was selectively ligated to the sRNA template using a truncated T4 RNA ligase 2 (NEB Canada, cat. M0242L).

    Article Title: Large-scale profiling of microRNAs for The Cancer Genome Atlas
    Article Snippet: Paragraph title: Library construction and sequencing ... A 3′ adapter was ligated to the RNA template using a truncated T4 RNA ligase2 (NEB Canada, cat. M0242L) with an incubation of 1 h at 22°C.

    Article Title: Pervasive translational regulation of the cell signalling circuitry underlies mammalian development
    Article Snippet: RNAs were eluted, dephosphorylated by PNK (NEB, M0201S), and ligated to the miRNA Cloning linker (NEB, S1315S) by T4 RNA Ligase2 truncated K227Q (NEB, M0242S). .. RNAs were eluted, dephosphorylated by PNK (NEB, M0201S), and ligated to the miRNA Cloning linker (NEB, S1315S) by T4 RNA Ligase2 truncated K227Q (NEB, M0242S).

    Article Title: Bone Marrow Niche Trafficking of miR-126 Controls Self-Renewal of Leukemia Stem Cells in Chronic Myelogenous Leukemia
    Article Snippet: Paragraph title: Small RNA deep sequencing using Illumina HiSeq2500 ... Total RNA was ligated to the modified 3′ Adapter (5′ TCTGGAATTCTCGGGTGCCAAGGAACTCC) with T4 RNA Ligase 2, truncated (NEB, M0242L) for 1 h at 22°C.

    Article Title: Rules of RNA specificity of hnRNP A1 revealed by global and quantitative analysis of its affinity distribution
    Article Snippet: After separating the UP1–SL3ESS3R complex and the substrate, the unbound substrates were collected for high-throughput sequencing. .. Following separation of unbound and UP1 bound SL3ESS3 variants, the unbound RNAs were ligated to a 17-nt adapter, 5′-rAppCTGTAGGCACCATCAAT-NH2-3′ (NEB S1315S; New England Biolabs) by T4 RNA ligase 2 (NEB M0242S; New England Biolabs), and gel purification was used to remove the unreacted sequences.

    Article Title: DNA damage response inhibition at dysfunctional telomeres by modulation of telomeric DNA damage response RNAs
    Article Snippet: Paragraph title: Targeted sequencing of small RNA ... The 3′-end of the starting RNA was ligated to a monoadenylated DNA linker by a T4 RNA ligase 2-truncated enzyme (NEB) incubated for 1 h at 25 °C.

    Recombinant:

    Article Title: High-Throughput Sequencing of RNA Isolated by Cross- Linking and Immunoprecipitation (HITS-CLIP) to Determine Sites of Binding of CstF-64 on Nascent RNAs
    Article Snippet: T4 RNA Ligase 2, truncated (M0242L, New England Biolabs). .. T4 RNA Ligase 2, truncated (M0242L, New England Biolabs).

    Molecular Weight:

    Article Title: High-efficiency RNA cloning enables accurate quantification of miRNA expression by deep sequencing
    Article Snippet: Initial reactions (Figure A) were composed of 25 femtomoles of labeled RNA, 1 picomole of 5′ adenylated DNA cloning linker, 50 mM Tris-HCl pH 7.5, 10 mM MgCl2 , 1 mM dithiothreitol, 20 units truncated T4 RNA Ligase 2 (residues 1 to 249, K227Q point mutant) (New England Biolabs M0242S Waltham, Massachusetts, USA), and 20 units RNase Inhibitor (Invitrogen N2611 Carlsbad, California, USA). .. Initial reactions (Figure A) were composed of 25 femtomoles of labeled RNA, 1 picomole of 5′ adenylated DNA cloning linker, 50 mM Tris-HCl pH 7.5, 10 mM MgCl2 , 1 mM dithiothreitol, 20 units truncated T4 RNA Ligase 2 (residues 1 to 249, K227Q point mutant) (New England Biolabs M0242S Waltham, Massachusetts, USA), and 20 units RNase Inhibitor (Invitrogen N2611 Carlsbad, California, USA).

    RNA Sequencing Assay:

    Article Title: Pervasive translational regulation of the cell signalling circuitry underlies mammalian development
    Article Snippet: 28–31 nt RPFs and 30–50 nt fragmented RNAs were excised from the gel for Ribo-Seq and RNA-Seq respectively. .. RNAs were eluted, dephosphorylated by PNK (NEB, M0201S), and ligated to the miRNA Cloning linker (NEB, S1315S) by T4 RNA Ligase2 truncated K227Q (NEB, M0242S).

    Article Title: Bone Marrow Niche Trafficking of miR-126 Controls Self-Renewal of Leukemia Stem Cells in Chronic Myelogenous Leukemia
    Article Snippet: Small RNA sequencing was performed using Illumina HiSeq2500 at the COH Integrative Genomics Core following the manufacturer’s sample preparation protocol (TruSeq Small RNA Sample Prep kit, Illumina, Inc.) with some modifications. .. Total RNA was ligated to the modified 3′ Adapter (5′ TCTGGAATTCTCGGGTGCCAAGGAACTCC) with T4 RNA Ligase 2, truncated (NEB, M0242L) for 1 h at 22°C.

    Article Title: Evaluating bias-reducing protocols for RNA sequencing library preparation
    Article Snippet: For standard libraries, ligation of 10 ng of RNA pool was performed with the Ion Total RNA-Seq kit v2 (Life Technologies), following the manufacturer’s instructions. .. Ligation with 200 U T4 RNA Ligase 2 truncated K227Q mutant (trRnl2 K227Q; NEB) was performed in the presence of 1X RNA ligase buffer (NEB), 15% PEG8000, 20 U SuperaseIn (Ambion), at 25°C for 3 hr.

    Mutagenesis:

    Article Title: High-efficiency RNA cloning enables accurate quantification of miRNA expression by deep sequencing
    Article Snippet: Labeled RNA was phenol/chloroform extracted, ethanol precipitated, and resuspended in distilled H2 O. .. Initial reactions (Figure A) were composed of 25 femtomoles of labeled RNA, 1 picomole of 5′ adenylated DNA cloning linker, 50 mM Tris-HCl pH 7.5, 10 mM MgCl2 , 1 mM dithiothreitol, 20 units truncated T4 RNA Ligase 2 (residues 1 to 249, K227Q point mutant) (New England Biolabs M0242S Waltham, Massachusetts, USA), and 20 units RNase Inhibitor (Invitrogen N2611 Carlsbad, California, USA). .. Reactions were stopped by the addition of an equal volume of 2X loading dye (7 M urea, 1× TBE, 0.01% bromophenol blue and 0.005% xylene cyanol), briefly heated to 95°C, and snap cooled on ice.

    Article Title: The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosome-protected mRNA fragments
    Article Snippet: [CRITICAL -- Avoid the 3′ phosphatase minus mutant, cat. no. .. T4 RNA ligase 2, truncated (New England Biolabs, cat. no. M0242S).

    Article Title: A Genome-Wide Survey of Highly Expressed Non-Coding RNAs and Biological Validation of Selected Candidates in Agrobacterium tumefaciens
    Article Snippet: Five microliter of purified fragmented RNAs were ligated with 1 µl RNA 3′ Adapter (RA3) (part# 15013207, Illumina); reactions were heated at 70°C for 2 minutes, then immediately cooled on ice. .. Next, a master mix of 4 µl was prepared as following before adding to the 6 µl reaction: 2 µl Ligation Buffer (HML) (part#15013206, Illumina), 1 µl RNase Inhibitor (part#15003548, Illumina), and 1 µl T4 RNA Ligase 2 Deletion Mutant (part# M0242S, NEB). .. The 10 µl reaction was incubated on the pre-heated thermal cycler at 28°C for 1 hour.

    Article Title: Evaluating bias-reducing protocols for RNA sequencing library preparation
    Article Snippet: For the CircLig libraries, 40 ng RNA pool (~6 pmol) and 100 ng Universal Cloning Linker (~18 pmol; NEB) were denatured at 80°C for 2 min then placed immediately on ice. .. Ligation with 200 U T4 RNA Ligase 2 truncated K227Q mutant (trRnl2 K227Q; NEB) was performed in the presence of 1X RNA ligase buffer (NEB), 15% PEG8000, 20 U SuperaseIn (Ambion), at 25°C for 3 hr. .. Ligation with 20 pmol Mth K97A was performed in 1X NEB1 buffer and 20 U SuperaseIn, at 65°C for 1 hr, as described by Zhelkovsky and McReynolds (11).

    Isolation:

    Article Title: Landscape of Fluid Sets of Hairpin-Derived 21-/24-nt-Long Small RNAs at Seed Set Uncovers Special Epigenetic Features in Picea glauca
    Article Snippet: Paragraph title: RNA Isolation, Library Construction, and sRNA Sequencing ... A 3′ adapter that is an adenylated single-stranded DNA was selectively ligated to the sRNA template using a truncated T4 RNA ligase 2 (NEB Canada, cat. M0242L).

    Labeling:

    Article Title: High-efficiency RNA cloning enables accurate quantification of miRNA expression by deep sequencing
    Article Snippet: Labeled RNA was phenol/chloroform extracted, ethanol precipitated, and resuspended in distilled H2 O. .. Initial reactions (Figure A) were composed of 25 femtomoles of labeled RNA, 1 picomole of 5′ adenylated DNA cloning linker, 50 mM Tris-HCl pH 7.5, 10 mM MgCl2 , 1 mM dithiothreitol, 20 units truncated T4 RNA Ligase 2 (residues 1 to 249, K227Q point mutant) (New England Biolabs M0242S Waltham, Massachusetts, USA), and 20 units RNase Inhibitor (Invitrogen N2611 Carlsbad, California, USA). .. Reactions were stopped by the addition of an equal volume of 2X loading dye (7 M urea, 1× TBE, 0.01% bromophenol blue and 0.005% xylene cyanol), briefly heated to 95°C, and snap cooled on ice.

    Purification:

    Article Title: A Genome-Wide Survey of Highly Expressed Non-Coding RNAs and Biological Validation of Selected Candidates in Agrobacterium tumefaciens
    Article Snippet: Five microliter of purified fragmented RNAs were ligated with 1 µl RNA 3′ Adapter (RA3) (part# 15013207, Illumina); reactions were heated at 70°C for 2 minutes, then immediately cooled on ice. .. Next, a master mix of 4 µl was prepared as following before adding to the 6 µl reaction: 2 µl Ligation Buffer (HML) (part#15013206, Illumina), 1 µl RNase Inhibitor (part#15003548, Illumina), and 1 µl T4 RNA Ligase 2 Deletion Mutant (part# M0242S, NEB).

    Article Title: Pervasive translational regulation of the cell signalling circuitry underlies mammalian development
    Article Snippet: RNAs were eluted, dephosphorylated by PNK (NEB, M0201S), and ligated to the miRNA Cloning linker (NEB, S1315S) by T4 RNA Ligase2 truncated K227Q (NEB, M0242S). .. Ligated RNA was gel purified and reverse transcribed by Superscript III (Invitrogen, 18080).

    Article Title: Rules of RNA specificity of hnRNP A1 revealed by global and quantitative analysis of its affinity distribution
    Article Snippet: The UP1 protein was expressed and purified as previously described ( ). .. Following separation of unbound and UP1 bound SL3ESS3 variants, the unbound RNAs were ligated to a 17-nt adapter, 5′-rAppCTGTAGGCACCATCAAT-NH2-3′ (NEB S1315S; New England Biolabs) by T4 RNA ligase 2 (NEB M0242S; New England Biolabs), and gel purification was used to remove the unreacted sequences.

    Article Title: The mammalian ribo-interactome reveals ribosome functional diversity and heterogeneity
    Article Snippet: The fragmented total RNA and ribosome protected fragments were then purified using Zymo RNA Clean & Concentrator 5 columns using a protocol in which 100 uL sample, 200 uL RNA binding buffer, and 450 uL 100% ethanol were used for binding (see above). .. The denatured sample was then incubated with 1 uL T4 RNA Ligase 2, truncated (NEB, catalog no. M0242S), 2 uL 10× buffer, 1 uL SUPERase In, and 6 uL 50% PEG 8000 for 2.5 hours at room temperature.

    High Throughput Screening Assay:

    Article Title: Rules of RNA specificity of hnRNP A1 revealed by global and quantitative analysis of its affinity distribution
    Article Snippet: After separating the UP1–SL3ESS3R complex and the substrate, the unbound substrates were collected for high-throughput sequencing. .. Following separation of unbound and UP1 bound SL3ESS3 variants, the unbound RNAs were ligated to a 17-nt adapter, 5′-rAppCTGTAGGCACCATCAAT-NH2-3′ (NEB S1315S; New England Biolabs) by T4 RNA ligase 2 (NEB M0242S; New England Biolabs), and gel purification was used to remove the unreacted sequences.

    Selection:

    Article Title: Landscape of Fluid Sets of Hairpin-Derived 21-/24-nt-Long Small RNAs at Seed Set Uncovers Special Epigenetic Features in Picea glauca
    Article Snippet: To enrich sRNAs, total RNA samples underwent polyA selection using Miltenyi MultiMACS mRNA isolation kit (cat. 130-092-519) following the manufacturer’s protocol and the flowthrough (i.e., containing sRNA species without mRNA) was used for plate-based sRNA construction. .. A 3′ adapter that is an adenylated single-stranded DNA was selectively ligated to the sRNA template using a truncated T4 RNA ligase 2 (NEB Canada, cat. M0242L).

    Article Title: Bone Marrow Niche Trafficking of miR-126 Controls Self-Renewal of Leukemia Stem Cells in Chronic Myelogenous Leukemia
    Article Snippet: Total RNA was ligated to the modified 3′ Adapter (5′ TCTGGAATTCTCGGGTGCCAAGGAACTCC) with T4 RNA Ligase 2, truncated (NEB, M0242L) for 1 h at 22°C. .. The product subsequently was ligated to the modified 5′ adaptor (5′GUUCAGAGUUCUACAGUCCGACGAUCNNN) with T4 RNA ligase1 (NEB, M0204L) for 1 h at 20°C.

    Construct:

    Article Title: Landscape of Fluid Sets of Hairpin-Derived 21-/24-nt-Long Small RNAs at Seed Set Uncovers Special Epigenetic Features in Picea glauca
    Article Snippet: Briefly, sRNA-seq libraries were constructed using a strand-specific and plate-based protocol. .. A 3′ adapter that is an adenylated single-stranded DNA was selectively ligated to the sRNA template using a truncated T4 RNA ligase 2 (NEB Canada, cat. M0242L).

    Article Title: Large-scale profiling of microRNAs for The Cancer Genome Atlas
    Article Snippet: miRNA-seq libraries were constructed using a strand-specific, plate-based protocol developed at the GSC (Figure ). .. A 3′ adapter was ligated to the RNA template using a truncated T4 RNA ligase2 (NEB Canada, cat. M0242L) with an incubation of 1 h at 22°C.

    Article Title: Bone Marrow Niche Trafficking of miR-126 Controls Self-Renewal of Leukemia Stem Cells in Chronic Myelogenous Leukemia
    Article Snippet: Total RNA was ligated to the modified 3′ Adapter (5′ TCTGGAATTCTCGGGTGCCAAGGAACTCC) with T4 RNA Ligase 2, truncated (NEB, M0242L) for 1 h at 22°C. .. The product subsequently was ligated to the modified 5′ adaptor (5′GUUCAGAGUUCUACAGUCCGACGAUCNNN) with T4 RNA ligase1 (NEB, M0204L) for 1 h at 20°C.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Pervasive translational regulation of the cell signalling circuitry underlies mammalian development
    Article Snippet: RNAs were eluted, dephosphorylated by PNK (NEB, M0201S), and ligated to the miRNA Cloning linker (NEB, S1315S) by T4 RNA Ligase2 truncated K227Q (NEB, M0242S). .. Amplification was done using Phusion High Fidelity DNA Polymerase (NEB, M0530S).

    Article Title: Bone Marrow Niche Trafficking of miR-126 Controls Self-Renewal of Leukemia Stem Cells in Chronic Myelogenous Leukemia
    Article Snippet: Total RNA was ligated to the modified 3′ Adapter (5′ TCTGGAATTCTCGGGTGCCAAGGAACTCC) with T4 RNA Ligase 2, truncated (NEB, M0242L) for 1 h at 22°C. .. The product subsequently was ligated to the modified 5′ adaptor (5′GUUCAGAGUUCUACAGUCCGACGAUCNNN) with T4 RNA ligase1 (NEB, M0204L) for 1 h at 20°C.

    Staining:

    Article Title: Genome-wide profiling of RNA polymerase transcription at nucleotide resolution in human cells with native elongating transcript sequencing
    Article Snippet: RNase-Free DNase Set (50) (Qiagen, cat. no. 79254) PEG8000, molecular biology grade (part of T4 RNA Ligase 2, truncated, NEB, cat. no. M0242S) CRITICAL: Store PEG8000 solution at −20°C. .. Dimethyl sulfoxide (DMSO), molecular biology grade (Sigma, cat. no. D8418) T4 RNA Ligase Buffer (part of T4 RNA Ligase 2, truncated, NEB, cat. no. M0242S) T4 RNA Ligase 2, truncated (NEB, cat. no. M0242S) CRITICAL: We recommend to keep track of the enzyme lot since the ligase activity can vary between different batches.

    Article Title: A detailed protocol for subcellular RNA sequencing (subRNA-seq)
    Article Snippet: Although we describe a NET-seq-based library preparation method here, we expect that our cell fractionation and RNA isolation approach ( BASIC PROTOCOL 1 ) can also be combined with alternative library preparation protocols to obtain sequencing libraries. .. RNase/DNase-free H2 O (Life Technologies, cat. no. 10977-015) Ribo-Zero rRNA Removal Kit (Epicentre, cat. no. MRZH116) 80% (vol/vol) ethanol (VWR, cat. no. V1016) Sodium carbonate anhydrous (VWR, cat. no. M138) Sodium bicarbonate (VWR, cat. no. 3509) EDTA (0.5 M; Life Technologies, cat. no. AM9260G) Isopropanol (Sigma, cat. no. 278475) RNA control ladder (0.1–2 kb; Life Technologies, cat. no. 15623-100) 2x TBU denaturing loading buffer (Life Technologies, cat. no. LC6876) TBE-urea gels, 15% (wt/vol) (Life Technologies, cat. no. EC68852BOX) TBE buffer, 10x (Life Technologies, cat. no. 15581-044) Orange G (Sigma, cat. no. O3756) SYBR Gold Nucleic Acid Gel Stain (10,000x concentrate; Life Technologies, cat. no. S-11494) PEG8000 (part of T4 RNA Ligase 2, truncated, NEB, cat. no. M0242S) DMSO (Sigma, cat. no. D8418) T4 RNA Ligase Buffer, 10x (part of T4 RNA Ligase 2, truncated, NEB, cat. no. M0242S) T4 RNA Ligase 2, truncated (NEB, cat. no. M0242S) GlycoBlue (15 mg/ml; Life Technologies, cat. no. AM9515) Sodium acetate, RNase-free (3 M; Life Technologies, cat. no. AM9740) T4 PNK Buffer, 10x (part of T4 Polynucleotide Kinase, NEB, cat. no. M0201S) T4 Polynucleotide Kinase (10,000 U/ml; NEB, cat. no. M0201S) DTT (0.1 M; part of the SuperScript III First-Strand Synthesis System, Life Technologies, cat. no. 18080-051) SUPERase.In (20 U/μl; Life Technologies, cat. no. AM2696) 5x First-Strand Buffer (part of SuperScript III First-Strand Synthesis System, Life Technologies, cat. no. 18080-051) dNTP mix (10 mM; Life Technologies, cat. no. 18427-013) SuperScript III First-Strand Synthesis System (Life Technologies, cat. no. 18080-051) TBE-urea gels, 10% (wt/vol) (Life Technologies, cat. no. EC68752BOX) CircLigase Reaction Buffer, 10x (part of CircLigase ssDNA Ligase, Epicentre, cat. no. CL4111K) ATP, 1 mM (part of CircLigase ssDNA Ligase, Epicentre, cat. no. CL4111K) MnCl2 , 50 mM (part of CircLigase ssDNA Ligase, Epicentre, cat. no. CL4111K) CircLigase ssDNA Ligase (100 U/μl; Epicentre, cat. no. CL4111K) Phusion HF Buffer, 5x (part of Phusion High-Fidelity DNA Polymerase, NEB, cat. no. M0530S) Phusion DNA Polymerase (2,000 U/ml; NEB, cat. no. M0530S) DNA control ladder (10 bp; Life Technologies, cat. no. 10821-015) TBE gels, 8% (wt/vol) (Life Technologies, cat. no. EC62152BOX) Qubit dsDNA HS Assay Kit (Life Technologies, cat. no. ) High Sensitivity DNA Analysis Kit (Agilent Technologies, cat. no. 5067-4626) Scalpels (Electron Microscopy Sciences, cat. no. 72042-11) 20G Needle (BD, cat. no. 305175) Microfuge tube filter: Costar Spin-X centrifuge tube filters (Sigma, cat. no. CLS8162-96EA) CAUTION: Sodium carbonate causes irritations. .. Solutions containing sodium carbonate should be used with care.

    cDNA Library Assay:

    Article Title: A Genome-Wide Survey of Highly Expressed Non-Coding RNAs and Biological Validation of Selected Candidates in Agrobacterium tumefaciens
    Article Snippet: Paragraph title: cDNA library preparation ... Next, a master mix of 4 µl was prepared as following before adding to the 6 µl reaction: 2 µl Ligation Buffer (HML) (part#15013206, Illumina), 1 µl RNase Inhibitor (part#15003548, Illumina), and 1 µl T4 RNA Ligase 2 Deletion Mutant (part# M0242S, NEB).

    Mouse Assay:

    Article Title: Bone Marrow Niche Trafficking of miR-126 Controls Self-Renewal of Leukemia Stem Cells in Chronic Myelogenous Leukemia
    Article Snippet: LSK cells from non-induced and induced CML mice were sorted and total RNA was extracted using the miRNeasy Mini Kit (Qiagen, Valencia, CA). .. Total RNA was ligated to the modified 3′ Adapter (5′ TCTGGAATTCTCGGGTGCCAAGGAACTCC) with T4 RNA Ligase 2, truncated (NEB, M0242L) for 1 h at 22°C.

    RNA Extraction:

    Article Title: The mammalian ribo-interactome reveals ribosome functional diversity and heterogeneity
    Article Snippet: Gel slices were crushed and extracted at room temperature overnight in 400 uL RNA extraction buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.25% SDS). .. The denatured sample was then incubated with 1 uL T4 RNA Ligase 2, truncated (NEB, catalog no. M0242S), 2 uL 10× buffer, 1 uL SUPERase In, and 6 uL 50% PEG 8000 for 2.5 hours at room temperature.

    Binding Assay:

    Article Title: Rules of RNA specificity of hnRNP A1 revealed by global and quantitative analysis of its affinity distribution
    Article Snippet: For the binding assay, 1 μM SL3ESS3R was mixed with increasing concentrations of UP1 to make the molar ratios 0, 0.25, 0.5, and 0.75. .. Following separation of unbound and UP1 bound SL3ESS3 variants, the unbound RNAs were ligated to a 17-nt adapter, 5′-rAppCTGTAGGCACCATCAAT-NH2-3′ (NEB S1315S; New England Biolabs) by T4 RNA ligase 2 (NEB M0242S; New England Biolabs), and gel purification was used to remove the unreacted sequences.

    Article Title: The mammalian ribo-interactome reveals ribosome functional diversity and heterogeneity
    Article Snippet: The fragmented total RNA and ribosome protected fragments were then purified using Zymo RNA Clean & Concentrator 5 columns using a protocol in which 100 uL sample, 200 uL RNA binding buffer, and 450 uL 100% ethanol were used for binding (see above). .. The denatured sample was then incubated with 1 uL T4 RNA Ligase 2, truncated (NEB, catalog no. M0242S), 2 uL 10× buffer, 1 uL SUPERase In, and 6 uL 50% PEG 8000 for 2.5 hours at room temperature.

    Sample Prep:

    Article Title: Bone Marrow Niche Trafficking of miR-126 Controls Self-Renewal of Leukemia Stem Cells in Chronic Myelogenous Leukemia
    Article Snippet: Small RNA sequencing was performed using Illumina HiSeq2500 at the COH Integrative Genomics Core following the manufacturer’s sample preparation protocol (TruSeq Small RNA Sample Prep kit, Illumina, Inc.) with some modifications. .. Total RNA was ligated to the modified 3′ Adapter (5′ TCTGGAATTCTCGGGTGCCAAGGAACTCC) with T4 RNA Ligase 2, truncated (NEB, M0242L) for 1 h at 22°C.

    Article Title: Rules of RNA specificity of hnRNP A1 revealed by global and quantitative analysis of its affinity distribution
    Article Snippet: Following separation of unbound and UP1 bound SL3ESS3 variants, the unbound RNAs were ligated to a 17-nt adapter, 5′-rAppCTGTAGGCACCATCAAT-NH2-3′ (NEB S1315S; New England Biolabs) by T4 RNA ligase 2 (NEB M0242S; New England Biolabs), and gel purification was used to remove the unreacted sequences. .. Following separation of unbound and UP1 bound SL3ESS3 variants, the unbound RNAs were ligated to a 17-nt adapter, 5′-rAppCTGTAGGCACCATCAAT-NH2-3′ (NEB S1315S; New England Biolabs) by T4 RNA ligase 2 (NEB M0242S; New England Biolabs), and gel purification was used to remove the unreacted sequences.

    In Vitro:

    Article Title: DNA damage response inhibition at dysfunctional telomeres by modulation of telomeric DNA damage response RNAs
    Article Snippet: The 3′-end of the starting RNA was ligated to a monoadenylated DNA linker by a T4 RNA ligase 2-truncated enzyme (NEB) incubated for 1 h at 25 °C. .. To capture the amplified cDNA targets, complementary RNA baits containing biotin-labelled nucleotides were used.

    Spectrophotometry:

    Article Title: Landscape of Fluid Sets of Hairpin-Derived 21-/24-nt-Long Small RNAs at Seed Set Uncovers Special Epigenetic Features in Picea glauca
    Article Snippet: The integrity and the quantity of the RNAs were assessed by BioAnalyser 2100 (Agilent Technologies) and Nanodrop ND-1000 spectrophotometer (Thermo Fisher Scientific). .. A 3′ adapter that is an adenylated single-stranded DNA was selectively ligated to the sRNA template using a truncated T4 RNA ligase 2 (NEB Canada, cat. M0242L).

    Produced:

    Article Title: DNA damage response inhibition at dysfunctional telomeres by modulation of telomeric DNA damage response RNAs
    Article Snippet: The 3′-end of the starting RNA was ligated to a monoadenylated DNA linker by a T4 RNA ligase 2-truncated enzyme (NEB) incubated for 1 h at 25 °C. .. To capture the amplified cDNA targets, complementary RNA baits containing biotin-labelled nucleotides were used.

    Concentration Assay:

    Article Title: High-efficiency RNA cloning enables accurate quantification of miRNA expression by deep sequencing
    Article Snippet: Initial reactions (Figure A) were composed of 25 femtomoles of labeled RNA, 1 picomole of 5′ adenylated DNA cloning linker, 50 mM Tris-HCl pH 7.5, 10 mM MgCl2 , 1 mM dithiothreitol, 20 units truncated T4 RNA Ligase 2 (residues 1 to 249, K227Q point mutant) (New England Biolabs M0242S Waltham, Massachusetts, USA), and 20 units RNase Inhibitor (Invitrogen N2611 Carlsbad, California, USA). .. Initial reactions (Figure A) were composed of 25 femtomoles of labeled RNA, 1 picomole of 5′ adenylated DNA cloning linker, 50 mM Tris-HCl pH 7.5, 10 mM MgCl2 , 1 mM dithiothreitol, 20 units truncated T4 RNA Ligase 2 (residues 1 to 249, K227Q point mutant) (New England Biolabs M0242S Waltham, Massachusetts, USA), and 20 units RNase Inhibitor (Invitrogen N2611 Carlsbad, California, USA).

    Marker:

    Article Title: Evaluating bias-reducing protocols for RNA sequencing library preparation
    Article Snippet: Ligation with 200 U T4 RNA Ligase 2 truncated K227Q mutant (trRnl2 K227Q; NEB) was performed in the presence of 1X RNA ligase buffer (NEB), 15% PEG8000, 20 U SuperaseIn (Ambion), at 25°C for 3 hr. .. Ligation with 200 U T4 RNA Ligase 2 truncated K227Q mutant (trRnl2 K227Q; NEB) was performed in the presence of 1X RNA ligase buffer (NEB), 15% PEG8000, 20 U SuperaseIn (Ambion), at 25°C for 3 hr.

    Lysis:

    Article Title: Genome-wide profiling of RNA polymerase transcription at nucleotide resolution in human cells with native elongating transcript sequencing
    Article Snippet: The Qiazol Lysis Reagent is toxic and corrosive. .. RNase-Free DNase Set (50) (Qiagen, cat. no. 79254) PEG8000, molecular biology grade (part of T4 RNA Ligase 2, truncated, NEB, cat. no. M0242S) CRITICAL: Store PEG8000 solution at −20°C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs t4 rna ligase 2
    Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.
    T4 Rna Ligase 2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase 2/product/New England Biolabs
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 2 - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs t4 rna ligase 2 truncated k227q
    Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.
    T4 Rna Ligase 2 Truncated K227q, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase 2 truncated k227q/product/New England Biolabs
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 2 truncated k227q - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Activity Assay, Labeling, Ligation, Binding Assay

    Deadenylation activity of T4 RNA ligase 2 truncated mutants . 5'-adenylated DNA adapters were incubated with an excess of ligase (13.8 pmol), and 12.5% PEG 8000 at 16°C overnight. Oligonucleotide substrates are depicted schematically above the gel. The contents of each sample were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold to visualize nucleic acid. Deadenylation of the DNA adapter (loss of 5'-App) is indicated by a band shift of ~1 nt towards the bottom of the gel. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Deadenylation activity of T4 RNA ligase 2 truncated mutants . 5'-adenylated DNA adapters were incubated with an excess of ligase (13.8 pmol), and 12.5% PEG 8000 at 16°C overnight. Oligonucleotide substrates are depicted schematically above the gel. The contents of each sample were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold to visualize nucleic acid. Deadenylation of the DNA adapter (loss of 5'-App) is indicated by a band shift of ~1 nt towards the bottom of the gel. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Activity Assay, Incubation, Staining, Electrophoretic Mobility Shift Assay, Binding Assay

    Assaying the formation of side products by T4 RNA ligases . Intermolecular strand-joining reactions containing 5'-adenylated adapters, 21-mer 5'-PO 4  RNA acceptors, and ligase (1 pmol) were incubated at 16°C overnight in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. Products of the reaction were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Ladder = size standard ladder, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Assaying the formation of side products by T4 RNA ligases . Intermolecular strand-joining reactions containing 5'-adenylated adapters, 21-mer 5'-PO 4 RNA acceptors, and ligase (1 pmol) were incubated at 16°C overnight in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. Products of the reaction were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Ladder = size standard ladder, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Incubation, Staining, Ligation, Binding Assay

    Following AMP during ligation reactions with T4 RNA ligases .  (A)  22-mer DNA adapters were 5'-adenylated with α- 32 P-labeled ATP (see materials and methods). Intermolecular strand-joining reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 21-mer 5'-PO 4  RNA acceptor, and ligase (1 pmol) were incubated overnight at 16°C in the presence of PEG 8000. Reaction products were resolved on a denaturing 15% acrylamide gel and radioactive molecules were visualized by exposure to Phosphor screens. The resulting products were either free AMP in solution (AMP*) or the adapter remaining adenylated (Ap*p-DNA). Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes  32 P-phosphate.  (B)  Determining the fate of AMP upon T4 RNA ligase-dependent deadenylation. Reactions containing radiolabeled DNA adapter (10 pmol) and ligase (14 pmol) were incubated overnight at 16°C in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. P* denotes  32 P-phosphate. Reaction products were resolved and visualized as in (A). The resulting products were either free AMP in solution (AMP*), the adapter remaining adenylated (Ap*p-DNA), or AMP covalently bound to the ligase (AMP*-ligase). The lane labeled input contains only Ap*p-DNA.  (C)  Reactions identical to those in (B) were treated with Proteinase K prior to gel electrophoresis and detection.  (D)  Reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 28-mer [5'-PO 4 , 3'-blocked] RNA acceptor, and ligase (1 pmol) were incubated, resolved and detected as in (A). The resulting products were either free AMP in solution (AMP*), adenylated adapter (Ap*p-DNA), or Ap*p-28-mer RNA. The lane labeled RNA size control contains 5'- 32 PO 4  RNA, and the lane labeled input contains only Ap*p-DNA. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes  32 P-phosphate. In all panels, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Following AMP during ligation reactions with T4 RNA ligases . (A) 22-mer DNA adapters were 5'-adenylated with α- 32 P-labeled ATP (see materials and methods). Intermolecular strand-joining reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 21-mer 5'-PO 4 RNA acceptor, and ligase (1 pmol) were incubated overnight at 16°C in the presence of PEG 8000. Reaction products were resolved on a denaturing 15% acrylamide gel and radioactive molecules were visualized by exposure to Phosphor screens. The resulting products were either free AMP in solution (AMP*) or the adapter remaining adenylated (Ap*p-DNA). Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. (B) Determining the fate of AMP upon T4 RNA ligase-dependent deadenylation. Reactions containing radiolabeled DNA adapter (10 pmol) and ligase (14 pmol) were incubated overnight at 16°C in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. P* denotes 32 P-phosphate. Reaction products were resolved and visualized as in (A). The resulting products were either free AMP in solution (AMP*), the adapter remaining adenylated (Ap*p-DNA), or AMP covalently bound to the ligase (AMP*-ligase). The lane labeled input contains only Ap*p-DNA. (C) Reactions identical to those in (B) were treated with Proteinase K prior to gel electrophoresis and detection. (D) Reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 28-mer [5'-PO 4 , 3'-blocked] RNA acceptor, and ligase (1 pmol) were incubated, resolved and detected as in (A). The resulting products were either free AMP in solution (AMP*), adenylated adapter (Ap*p-DNA), or Ap*p-28-mer RNA. The lane labeled RNA size control contains 5'- 32 PO 4 RNA, and the lane labeled input contains only Ap*p-DNA. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. In all panels, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Ligation, Labeling, Incubation, Acrylamide Gel Assay, Nucleic Acid Electrophoresis, Binding Assay

    Production of ligation side products by T4 RNA ligases . Intermolecular ligation reactions containing 5'-adenylated DNA adapters, 21-mer 5'-PO 4  RNA acceptors and ligase (1 pmol) were incubated at 16°C overnight with 12.5% PEG 8000. Products of the reactions were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Production of ligation side products by T4 RNA ligases . Intermolecular ligation reactions containing 5'-adenylated DNA adapters, 21-mer 5'-PO 4 RNA acceptors and ligase (1 pmol) were incubated at 16°C overnight with 12.5% PEG 8000. Products of the reactions were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Ligation, Incubation, Staining, Binding Assay

    Purification and activity of T4 RNA Ligase 2 truncated mutants .  (A)  Aliquots of T4 RNA ligase 2 truncated and mutants were separated on 10-20% Tris-glycine SDS polyacrylamide gels and stained with Coomassie blue. The size (in kDa) of marker polypeptides are indicated on the left.  (B)  Intermolecular strand-joining activity of T4 RNA ligase 2 truncated mutants under multiple turnover conditions. 10 pmol 5'-adenylated 17-mer DNA was incubated for one hour at 25°C with 5 pmol 5'- FAM-labeled 31-mer RNA. 1 pmol of each ligase was added into reaction mixture. The reaction products were resolved on denaturing 15% acrylamide gels, scanned and quantified as described in the methods section. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments. * denotes difference in means p

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Purification and activity of T4 RNA Ligase 2 truncated mutants . (A) Aliquots of T4 RNA ligase 2 truncated and mutants were separated on 10-20% Tris-glycine SDS polyacrylamide gels and stained with Coomassie blue. The size (in kDa) of marker polypeptides are indicated on the left. (B) Intermolecular strand-joining activity of T4 RNA ligase 2 truncated mutants under multiple turnover conditions. 10 pmol 5'-adenylated 17-mer DNA was incubated for one hour at 25°C with 5 pmol 5'- FAM-labeled 31-mer RNA. 1 pmol of each ligase was added into reaction mixture. The reaction products were resolved on denaturing 15% acrylamide gels, scanned and quantified as described in the methods section. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments. * denotes difference in means p

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Purification, Activity Assay, Staining, Marker, Incubation, Labeling, Binding Assay

    Effect of pH on ligase intermolecular strand-joining activity .  (A-D)  Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid.  (E-H)  Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (13.8 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Effect of pH on ligase intermolecular strand-joining activity . (A-D) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. (E-H) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (13.8 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Activity Assay, Labeling, Ligation, Binding Assay

    Analysis of intermolecular strand-joining over time . Strand-joining reactions were carried out with 10 pmol 5'-adenylated adapter, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) over a span of 24 hours at 25°C to assess the progress of ligation reactions. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Analysis of intermolecular strand-joining over time . Strand-joining reactions were carried out with 10 pmol 5'-adenylated adapter, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) over a span of 24 hours at 25°C to assess the progress of ligation reactions. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Labeling, Ligation, Binding Assay

    Identification of maternal and paternal mRNAs. ( A ) To identify maternal and paternal mRNAs, crosses of two different strains of zebrafish were used. A female SAT was crossed with a male WIK and the reciprocal cross of female WIK and male SAT was also performed. The four adults used were fin clipped and then subjected to exon enrichment and Illumina sequencing. On average, ∼95 million (M) reads were obtained for each sample/individual. Each sample was then run through our single-nucleotide polymorphism (SNP) calling pipeline. The exon-enriched sequences for the male and female in each cross were compared to identify homozygous SNPs that distinguished male and female alleles. ( B ) One hundred zebrafish embryos were collected at five different developmental stages from each cross: 2-cell, 64-cell, 3.5 hpf, 6 hpf and 9 hpf. Polyadenylated RNA was then extracted from total RNA and subjected to Illumina sequencing to produce ∼70 million reads per stage per cross. Reads were mapped to the zebrafish genome (Zv9) using TopHat and quantified using Cufflinks. SNPs identified were then used to identify maternal and paternal mRNAs. FPKM, fragments per kb per million reads; m, male; f, female.

    Journal: Development (Cambridge, England)

    Article Title: Identification of the zebrafish maternal and paternal transcriptomes

    doi: 10.1242/dev.095091

    Figure Lengend Snippet: Identification of maternal and paternal mRNAs. ( A ) To identify maternal and paternal mRNAs, crosses of two different strains of zebrafish were used. A female SAT was crossed with a male WIK and the reciprocal cross of female WIK and male SAT was also performed. The four adults used were fin clipped and then subjected to exon enrichment and Illumina sequencing. On average, ∼95 million (M) reads were obtained for each sample/individual. Each sample was then run through our single-nucleotide polymorphism (SNP) calling pipeline. The exon-enriched sequences for the male and female in each cross were compared to identify homozygous SNPs that distinguished male and female alleles. ( B ) One hundred zebrafish embryos were collected at five different developmental stages from each cross: 2-cell, 64-cell, 3.5 hpf, 6 hpf and 9 hpf. Polyadenylated RNA was then extracted from total RNA and subjected to Illumina sequencing to produce ∼70 million reads per stage per cross. Reads were mapped to the zebrafish genome (Zv9) using TopHat and quantified using Cufflinks. SNPs identified were then used to identify maternal and paternal mRNAs. FPKM, fragments per kb per million reads; m, male; f, female.

    Article Snippet: Primer p1 (0.4 μg) (see supplementary material Table S13) was ligated to mRNAs by incubating with 4 μg total RNA and T4 RNA ligase (New England BioLabs) in a total volume of 10 μl.

    Techniques: Sequencing

    Cytoplasmic polyadenylation elements drive the post-transcriptional regulation of maternal mRNAs. ( A ) To map the elements controlling polyadenylation of the maternal mRNA sox19b , four different fragments of the 3′ UTR were cloned downstream of the coding sequence of the fluorescent protein Venus. The positions of a cytoplasmic polyadenylation element (CPE) and hexamer, which were contained within fragment 3, are shown. ( B ) Injection of fertilised zebrafish embryos with Venus-sox19b 3′ UTR RNA demonstrated that only fragment 3 is polyadenylated. The ratio of quantitative PCR levels at the 64-cell stage to 2-cell stage are shown. cDNA was generated with oligo(dT) primers. As a negative control (neg. con.), embryos were injected with Venus RNA without a 3′ UTR. Error bars indicate s.d. ( C ) A CPE is present within fragment 3 of the sox19b 3′ UTR, which when deleted abolishes polyadenylation. ( D ) To study the cell cycle-dependent post-transcriptional regulation of cyclin B1 , quantitative PCR was performed on cDNA, generated with oligo(dT) primers, derived from embryos synchronised by IVF. Embryos were collected every 3 minutes, starting just after the 2-cell stage. cyclin B1 polyadenylation levels are regulated in a cell cycle-dependent manner, with levels peaking during mitosis.

    Journal: Development (Cambridge, England)

    Article Title: Identification of the zebrafish maternal and paternal transcriptomes

    doi: 10.1242/dev.095091

    Figure Lengend Snippet: Cytoplasmic polyadenylation elements drive the post-transcriptional regulation of maternal mRNAs. ( A ) To map the elements controlling polyadenylation of the maternal mRNA sox19b , four different fragments of the 3′ UTR were cloned downstream of the coding sequence of the fluorescent protein Venus. The positions of a cytoplasmic polyadenylation element (CPE) and hexamer, which were contained within fragment 3, are shown. ( B ) Injection of fertilised zebrafish embryos with Venus-sox19b 3′ UTR RNA demonstrated that only fragment 3 is polyadenylated. The ratio of quantitative PCR levels at the 64-cell stage to 2-cell stage are shown. cDNA was generated with oligo(dT) primers. As a negative control (neg. con.), embryos were injected with Venus RNA without a 3′ UTR. Error bars indicate s.d. ( C ) A CPE is present within fragment 3 of the sox19b 3′ UTR, which when deleted abolishes polyadenylation. ( D ) To study the cell cycle-dependent post-transcriptional regulation of cyclin B1 , quantitative PCR was performed on cDNA, generated with oligo(dT) primers, derived from embryos synchronised by IVF. Embryos were collected every 3 minutes, starting just after the 2-cell stage. cyclin B1 polyadenylation levels are regulated in a cell cycle-dependent manner, with levels peaking during mitosis.

    Article Snippet: Primer p1 (0.4 μg) (see supplementary material Table S13) was ligated to mRNAs by incubating with 4 μg total RNA and T4 RNA ligase (New England BioLabs) in a total volume of 10 μl.

    Techniques: Clone Assay, Sequencing, Injection, Real-time Polymerase Chain Reaction, Generated, Negative Control, Derivative Assay

    Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Activity Assay, Labeling, Ligation, Binding Assay

    Deadenylation activity of T4 RNA ligase 2 truncated mutants . 5'-adenylated DNA adapters were incubated with an excess of ligase (13.8 pmol), and 12.5% PEG 8000 at 16°C overnight. Oligonucleotide substrates are depicted schematically above the gel. The contents of each sample were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold to visualize nucleic acid. Deadenylation of the DNA adapter (loss of 5'-App) is indicated by a band shift of ~1 nt towards the bottom of the gel. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Deadenylation activity of T4 RNA ligase 2 truncated mutants . 5'-adenylated DNA adapters were incubated with an excess of ligase (13.8 pmol), and 12.5% PEG 8000 at 16°C overnight. Oligonucleotide substrates are depicted schematically above the gel. The contents of each sample were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold to visualize nucleic acid. Deadenylation of the DNA adapter (loss of 5'-App) is indicated by a band shift of ~1 nt towards the bottom of the gel. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Activity Assay, Incubation, Staining, Electrophoretic Mobility Shift Assay, Binding Assay

    Assaying the formation of side products by T4 RNA ligases . Intermolecular strand-joining reactions containing 5'-adenylated adapters, 21-mer 5'-PO 4  RNA acceptors, and ligase (1 pmol) were incubated at 16°C overnight in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. Products of the reaction were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Ladder = size standard ladder, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Assaying the formation of side products by T4 RNA ligases . Intermolecular strand-joining reactions containing 5'-adenylated adapters, 21-mer 5'-PO 4 RNA acceptors, and ligase (1 pmol) were incubated at 16°C overnight in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. Products of the reaction were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Ladder = size standard ladder, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Incubation, Staining, Ligation, Binding Assay

    Following AMP during ligation reactions with T4 RNA ligases .  (A)  22-mer DNA adapters were 5'-adenylated with α- 32 P-labeled ATP (see materials and methods). Intermolecular strand-joining reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 21-mer 5'-PO 4  RNA acceptor, and ligase (1 pmol) were incubated overnight at 16°C in the presence of PEG 8000. Reaction products were resolved on a denaturing 15% acrylamide gel and radioactive molecules were visualized by exposure to Phosphor screens. The resulting products were either free AMP in solution (AMP*) or the adapter remaining adenylated (Ap*p-DNA). Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes  32 P-phosphate.  (B)  Determining the fate of AMP upon T4 RNA ligase-dependent deadenylation. Reactions containing radiolabeled DNA adapter (10 pmol) and ligase (14 pmol) were incubated overnight at 16°C in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. P* denotes  32 P-phosphate. Reaction products were resolved and visualized as in (A). The resulting products were either free AMP in solution (AMP*), the adapter remaining adenylated (Ap*p-DNA), or AMP covalently bound to the ligase (AMP*-ligase). The lane labeled input contains only Ap*p-DNA.  (C)  Reactions identical to those in (B) were treated with Proteinase K prior to gel electrophoresis and detection.  (D)  Reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 28-mer [5'-PO 4 , 3'-blocked] RNA acceptor, and ligase (1 pmol) were incubated, resolved and detected as in (A). The resulting products were either free AMP in solution (AMP*), adenylated adapter (Ap*p-DNA), or Ap*p-28-mer RNA. The lane labeled RNA size control contains 5'- 32 PO 4  RNA, and the lane labeled input contains only Ap*p-DNA. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes  32 P-phosphate. In all panels, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Following AMP during ligation reactions with T4 RNA ligases . (A) 22-mer DNA adapters were 5'-adenylated with α- 32 P-labeled ATP (see materials and methods). Intermolecular strand-joining reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 21-mer 5'-PO 4 RNA acceptor, and ligase (1 pmol) were incubated overnight at 16°C in the presence of PEG 8000. Reaction products were resolved on a denaturing 15% acrylamide gel and radioactive molecules were visualized by exposure to Phosphor screens. The resulting products were either free AMP in solution (AMP*) or the adapter remaining adenylated (Ap*p-DNA). Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. (B) Determining the fate of AMP upon T4 RNA ligase-dependent deadenylation. Reactions containing radiolabeled DNA adapter (10 pmol) and ligase (14 pmol) were incubated overnight at 16°C in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. P* denotes 32 P-phosphate. Reaction products were resolved and visualized as in (A). The resulting products were either free AMP in solution (AMP*), the adapter remaining adenylated (Ap*p-DNA), or AMP covalently bound to the ligase (AMP*-ligase). The lane labeled input contains only Ap*p-DNA. (C) Reactions identical to those in (B) were treated with Proteinase K prior to gel electrophoresis and detection. (D) Reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 28-mer [5'-PO 4 , 3'-blocked] RNA acceptor, and ligase (1 pmol) were incubated, resolved and detected as in (A). The resulting products were either free AMP in solution (AMP*), adenylated adapter (Ap*p-DNA), or Ap*p-28-mer RNA. The lane labeled RNA size control contains 5'- 32 PO 4 RNA, and the lane labeled input contains only Ap*p-DNA. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. In all panels, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Ligation, Labeling, Incubation, Acrylamide Gel Assay, Nucleic Acid Electrophoresis, Binding Assay

    Production of ligation side products by T4 RNA ligases . Intermolecular ligation reactions containing 5'-adenylated DNA adapters, 21-mer 5'-PO 4  RNA acceptors and ligase (1 pmol) were incubated at 16°C overnight with 12.5% PEG 8000. Products of the reactions were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Production of ligation side products by T4 RNA ligases . Intermolecular ligation reactions containing 5'-adenylated DNA adapters, 21-mer 5'-PO 4 RNA acceptors and ligase (1 pmol) were incubated at 16°C overnight with 12.5% PEG 8000. Products of the reactions were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Ligation, Incubation, Staining, Binding Assay

    Purification and activity of T4 RNA Ligase 2 truncated mutants .  (A)  Aliquots of T4 RNA ligase 2 truncated and mutants were separated on 10-20% Tris-glycine SDS polyacrylamide gels and stained with Coomassie blue. The size (in kDa) of marker polypeptides are indicated on the left.  (B)  Intermolecular strand-joining activity of T4 RNA ligase 2 truncated mutants under multiple turnover conditions. 10 pmol 5'-adenylated 17-mer DNA was incubated for one hour at 25°C with 5 pmol 5'- FAM-labeled 31-mer RNA. 1 pmol of each ligase was added into reaction mixture. The reaction products were resolved on denaturing 15% acrylamide gels, scanned and quantified as described in the methods section. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments. * denotes difference in means p

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Purification and activity of T4 RNA Ligase 2 truncated mutants . (A) Aliquots of T4 RNA ligase 2 truncated and mutants were separated on 10-20% Tris-glycine SDS polyacrylamide gels and stained with Coomassie blue. The size (in kDa) of marker polypeptides are indicated on the left. (B) Intermolecular strand-joining activity of T4 RNA ligase 2 truncated mutants under multiple turnover conditions. 10 pmol 5'-adenylated 17-mer DNA was incubated for one hour at 25°C with 5 pmol 5'- FAM-labeled 31-mer RNA. 1 pmol of each ligase was added into reaction mixture. The reaction products were resolved on denaturing 15% acrylamide gels, scanned and quantified as described in the methods section. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments. * denotes difference in means p

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Purification, Activity Assay, Staining, Marker, Incubation, Labeling, Binding Assay

    Effect of pH on ligase intermolecular strand-joining activity .  (A-D)  Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid.  (E-H)  Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (13.8 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Effect of pH on ligase intermolecular strand-joining activity . (A-D) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. (E-H) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (13.8 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Activity Assay, Labeling, Ligation, Binding Assay

    Analysis of intermolecular strand-joining over time . Strand-joining reactions were carried out with 10 pmol 5'-adenylated adapter, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) over a span of 24 hours at 25°C to assess the progress of ligation reactions. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Analysis of intermolecular strand-joining over time . Strand-joining reactions were carried out with 10 pmol 5'-adenylated adapter, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) over a span of 24 hours at 25°C to assess the progress of ligation reactions. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Labeling, Ligation, Binding Assay