Structured Review

Promega t4 dna polymerase
Validation of Kir isoform typing with reporter enzyme ScrF I. Degenerate PCR with sub-family centred primers was performed on Kir subclone templates and products were <t>T4</t> DNA polymerase end-labelled according to Materials and Methods . Diagnostic restriction digests were performed using ScrF I and an isoform specific duplex banding pattern generated consistent with the predicted banding patterns described in Figure 1 . Faint low MW fragments (
T4 Dna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t4 dna polymerase/product/Promega
Average 99 stars, based on 14 article reviews
Price from $9.99 to $1999.99
t4 dna polymerase - by Bioz Stars, 2020-08
99/100 stars

Images

1) Product Images from "Multigene family isoform profiling from blood cell lineages"

Article Title: Multigene family isoform profiling from blood cell lineages

Journal: BMC Genomics

doi: 10.1186/1471-2164-3-22

Validation of Kir isoform typing with reporter enzyme ScrF I. Degenerate PCR with sub-family centred primers was performed on Kir subclone templates and products were T4 DNA polymerase end-labelled according to Materials and Methods . Diagnostic restriction digests were performed using ScrF I and an isoform specific duplex banding pattern generated consistent with the predicted banding patterns described in Figure 1 . Faint low MW fragments (
Figure Legend Snippet: Validation of Kir isoform typing with reporter enzyme ScrF I. Degenerate PCR with sub-family centred primers was performed on Kir subclone templates and products were T4 DNA polymerase end-labelled according to Materials and Methods . Diagnostic restriction digests were performed using ScrF I and an isoform specific duplex banding pattern generated consistent with the predicted banding patterns described in Figure 1 . Faint low MW fragments (

Techniques Used: Polymerase Chain Reaction, Diagnostic Assay, Generated

2) Product Images from "The C-terminal Domain of the DNA Polymerase Catalytic Subunit Regulates the Primase and Polymerase Activities of the Human DNA Polymerase α-Primase Complex *"

Article Title: The C-terminal Domain of the DNA Polymerase Catalytic Subunit Regulates the Primase and Polymerase Activities of the Human DNA Polymerase α-Primase Complex *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M114.570333

Same efficiency of the extension of DNA and RNA primers on hetero-homopolymeric hybrid and heteropolymeric DNA templates by the p180ΔN-core. For control of the full extension of the primers, we used reactions with T4 DNA polymerase, which robustly
Figure Legend Snippet: Same efficiency of the extension of DNA and RNA primers on hetero-homopolymeric hybrid and heteropolymeric DNA templates by the p180ΔN-core. For control of the full extension of the primers, we used reactions with T4 DNA polymerase, which robustly

Techniques Used:

3) Product Images from "The C-terminal Domain of the DNA Polymerase Catalytic Subunit Regulates the Primase and Polymerase Activities of the Human DNA Polymerase α-Primase Complex *"

Article Title: The C-terminal Domain of the DNA Polymerase Catalytic Subunit Regulates the Primase and Polymerase Activities of the Human DNA Polymerase α-Primase Complex *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M114.570333

Same efficiency of the extension of DNA and RNA primers on hetero-homopolymeric hybrid and heteropolymeric DNA templates by the p180ΔN-core. For control of the full extension of the primers, we used reactions with T4 DNA polymerase, which robustly
Figure Legend Snippet: Same efficiency of the extension of DNA and RNA primers on hetero-homopolymeric hybrid and heteropolymeric DNA templates by the p180ΔN-core. For control of the full extension of the primers, we used reactions with T4 DNA polymerase, which robustly

Techniques Used:

4) Product Images from "Simple and Efficient Method for Heterologous Expression of Clostridial Proteins"

Article Title: Simple and Efficient Method for Heterologous Expression of Clostridial Proteins

Journal: Applied and Environmental Microbiology

doi:

Construction of plasmids encoding tRNAs. The ileX , argU , and leuW sequences encode tRNAs that recognize the ATA, AGA, and CTA codons, respectively. The Ap r , Tet r , and Cm r sequences encode genes for antibiotic resistance. The T7 and Sp6 sequences encode promoters from bacteriophages T7 and sp6, respectively. The shaded areas represent sequences of subB-E tRNA operons other than leuW . DNA pol Taq, Taq DNA polymerase; DNA polT4, T4 DNA polymerase.
Figure Legend Snippet: Construction of plasmids encoding tRNAs. The ileX , argU , and leuW sequences encode tRNAs that recognize the ATA, AGA, and CTA codons, respectively. The Ap r , Tet r , and Cm r sequences encode genes for antibiotic resistance. The T7 and Sp6 sequences encode promoters from bacteriophages T7 and sp6, respectively. The shaded areas represent sequences of subB-E tRNA operons other than leuW . DNA pol Taq, Taq DNA polymerase; DNA polT4, T4 DNA polymerase.

Techniques Used:

5) Product Images from "The Reovirus S4 Gene 3? Nontranslated Region Contains a Translational Operator Sequence †"

Article Title: The Reovirus S4 Gene 3? Nontranslated Region Contains a Translational Operator Sequence †

Journal: Journal of Virology

doi: 10.1128/JVI.75.14.6517-6526.2001

Diagram of templates used for transcription of full-length and deletion-mutant s4 mRNAs. (A) The relevant region of plasmid pGEM3z/f± used for cloning a full-length cDNA corresponding to the S4 gene of reovirus strain T3D. Indicated are a T7 RNA polymerase promoter (T7), which was cloned adjacent to the 5′-terminal guanosine of the S4 gene cDNA, the ς3 open reading frame (ORF), and a Pst I site, which was engineered adjacent to the 3′ terminus of the S4 gene cDNA. Digestion of plasmid constructs with Pst I followed by incubation with T4 DNA polymerase resulted in templates for transcription that initiate with the 5′ guanosine and terminate with the 3′ cytosine of the S4 gene. Capped s4 mRNAs and s4 3′Δ mRNAs were transcribed in vitro and used in translation studies. Nucleotide lengths are indicated on the right. The s4 3′Δ mRNA terminates with UAAC , corresponding to the stop codon of the transcript and the 3′-terminal cytosine of the full-length S4 gene. (B) Schematic of S4 gene 3′NTR deletion constructs generated from cDNA clones by PCR mutagenesis. The viral sequences deleted in each of the mutant S4 gene cDNAs are indicated on the left; the length of each mRNA transcript is indicated on the right.
Figure Legend Snippet: Diagram of templates used for transcription of full-length and deletion-mutant s4 mRNAs. (A) The relevant region of plasmid pGEM3z/f± used for cloning a full-length cDNA corresponding to the S4 gene of reovirus strain T3D. Indicated are a T7 RNA polymerase promoter (T7), which was cloned adjacent to the 5′-terminal guanosine of the S4 gene cDNA, the ς3 open reading frame (ORF), and a Pst I site, which was engineered adjacent to the 3′ terminus of the S4 gene cDNA. Digestion of plasmid constructs with Pst I followed by incubation with T4 DNA polymerase resulted in templates for transcription that initiate with the 5′ guanosine and terminate with the 3′ cytosine of the S4 gene. Capped s4 mRNAs and s4 3′Δ mRNAs were transcribed in vitro and used in translation studies. Nucleotide lengths are indicated on the right. The s4 3′Δ mRNA terminates with UAAC , corresponding to the stop codon of the transcript and the 3′-terminal cytosine of the full-length S4 gene. (B) Schematic of S4 gene 3′NTR deletion constructs generated from cDNA clones by PCR mutagenesis. The viral sequences deleted in each of the mutant S4 gene cDNAs are indicated on the left; the length of each mRNA transcript is indicated on the right.

Techniques Used: Mutagenesis, Plasmid Preparation, Clone Assay, Construct, Incubation, In Vitro, Generated, Polymerase Chain Reaction

Related Articles

Real-time Polymerase Chain Reaction:

Article Title: Gene Expression Profiles Controlled by the Alternative Splicing Factor Nova2 in Endothelial Cells
Article Snippet: .. An aliquot of the RT reaction (1–2 μL) was then PCR-amplified (with GoTaq DNA Polymerase, Promega, Madison, WI, USA), whereas, for quantitative PCR (qPCR), cDNAs were amplified with QuantiTect SYBR Green PCR (QIAGEN) or iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) by using LightCycler 480 (Roche). ..

Amplification:

Article Title: Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence
Article Snippet: .. For PTRG_10433, which contained two gaps, several attempts to fill the first gap in the sequence were not successful, but the second gap was filled in by polymerase chain reaction (PCR) amplification using primers NRPSF2 (5′-AACAGCCGGAGAGAACACAT-3′) and NRPSR2 (5′-AGTCCTGCAGCTCTGACTTG-3′) in a 50-µL reaction that contained 1.25 mM MgCl2 , 0.0025 mM each dNTP, 2 mM primers, 10 ng of BFP-ToxAC genomic DNA, 0.25 µL of GoTaq of DNA polymerase, and 1X GoTaq Flexi buffer (Promega). .. Cycling was performed in a Mastercycler gradient machine (Eppendorf) with the following parameters: 94° for 5 min, 30 cycles of 94° for 45 sec, 58° for 45 sec, 72° for 1 min 30 sec, followed by 1 cycle at 72° for 7 min and a 4° hold.

Article Title: Parallel action of AtDRB2 and RdDM in the control of transposable element expression
Article Snippet: .. 4 μl of cDNA were used in the PCR reaction (GoTaq DNA polymerase, Promega M300) in a final volume of 12.5 μl, and amplified for 37 cycles with the primers found in Additional file : Table S1. .. Mass spectrometry analysis Purified proteins were obtained as described in the immunoprecipitation segment with a starting amount of 1.5 grams of mixed floral tissues.

Article Title: Gene Expression Profiles Controlled by the Alternative Splicing Factor Nova2 in Endothelial Cells
Article Snippet: .. An aliquot of the RT reaction (1–2 μL) was then PCR-amplified (with GoTaq DNA Polymerase, Promega, Madison, WI, USA), whereas, for quantitative PCR (qPCR), cDNAs were amplified with QuantiTect SYBR Green PCR (QIAGEN) or iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) by using LightCycler 480 (Roche). ..

Sequencing:

Article Title: Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence
Article Snippet: .. For PTRG_10433, which contained two gaps, several attempts to fill the first gap in the sequence were not successful, but the second gap was filled in by polymerase chain reaction (PCR) amplification using primers NRPSF2 (5′-AACAGCCGGAGAGAACACAT-3′) and NRPSR2 (5′-AGTCCTGCAGCTCTGACTTG-3′) in a 50-µL reaction that contained 1.25 mM MgCl2 , 0.0025 mM each dNTP, 2 mM primers, 10 ng of BFP-ToxAC genomic DNA, 0.25 µL of GoTaq of DNA polymerase, and 1X GoTaq Flexi buffer (Promega). .. Cycling was performed in a Mastercycler gradient machine (Eppendorf) with the following parameters: 94° for 5 min, 30 cycles of 94° for 45 sec, 58° for 45 sec, 72° for 1 min 30 sec, followed by 1 cycle at 72° for 7 min and a 4° hold.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Comparative Genome Analysis Provides Insights into Both the Lifestyle of Acidithiobacillus ferrivorans Strain CF27 and the Chimeric Nature of the Iron-Oxidizing Acidithiobacilli Genomes
Article Snippet: .. For each RT-PCR experiment, the hybridisation (55–66°C) and elongation (68 or 72°C) temperatures, RNA concentration (from 0.1 to 20 ng), DNA polymerase (GoTaq or Tfl from Promega), and the number of cycles (30, 35, or 40) were adjusted. .. Three controls were used: one without template to detect potential contaminations, one with genomic DNA as a positive control for PCR amplification and one with RNA not treated with reverse transcriptase to check for DNA contamination during RNA preparation.

SYBR Green Assay:

Article Title: Gene Expression Profiles Controlled by the Alternative Splicing Factor Nova2 in Endothelial Cells
Article Snippet: .. An aliquot of the RT reaction (1–2 μL) was then PCR-amplified (with GoTaq DNA Polymerase, Promega, Madison, WI, USA), whereas, for quantitative PCR (qPCR), cDNAs were amplified with QuantiTect SYBR Green PCR (QIAGEN) or iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) by using LightCycler 480 (Roche). ..

Concentration Assay:

Article Title: Comparative Genome Analysis Provides Insights into Both the Lifestyle of Acidithiobacillus ferrivorans Strain CF27 and the Chimeric Nature of the Iron-Oxidizing Acidithiobacilli Genomes
Article Snippet: .. For each RT-PCR experiment, the hybridisation (55–66°C) and elongation (68 or 72°C) temperatures, RNA concentration (from 0.1 to 20 ng), DNA polymerase (GoTaq or Tfl from Promega), and the number of cycles (30, 35, or 40) were adjusted. .. Three controls were used: one without template to detect potential contaminations, one with genomic DNA as a positive control for PCR amplification and one with RNA not treated with reverse transcriptase to check for DNA contamination during RNA preparation.

Incubation:

Article Title: Visual and modular detection of pathogen nucleic acids with enzyme–DNA molecular complexes
Article Snippet: .. The mixture was incubated at 95 °C for 5 min and slowly cooled at 0.1 °C/s until the reaction reached 25 °C, before the addition of Taq DNA polymerase (GoTaq, Promega) to form the hybrid complex. .. To characterize the assembly and activity of the recognition nanostructure in the presence of DNA targets, varying concentrations of target oligonucleotides were added to this mixture.

Polymerase Chain Reaction:

Article Title: Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence
Article Snippet: .. For PTRG_10433, which contained two gaps, several attempts to fill the first gap in the sequence were not successful, but the second gap was filled in by polymerase chain reaction (PCR) amplification using primers NRPSF2 (5′-AACAGCCGGAGAGAACACAT-3′) and NRPSR2 (5′-AGTCCTGCAGCTCTGACTTG-3′) in a 50-µL reaction that contained 1.25 mM MgCl2 , 0.0025 mM each dNTP, 2 mM primers, 10 ng of BFP-ToxAC genomic DNA, 0.25 µL of GoTaq of DNA polymerase, and 1X GoTaq Flexi buffer (Promega). .. Cycling was performed in a Mastercycler gradient machine (Eppendorf) with the following parameters: 94° for 5 min, 30 cycles of 94° for 45 sec, 58° for 45 sec, 72° for 1 min 30 sec, followed by 1 cycle at 72° for 7 min and a 4° hold.

Article Title: Parallel action of AtDRB2 and RdDM in the control of transposable element expression
Article Snippet: .. 4 μl of cDNA were used in the PCR reaction (GoTaq DNA polymerase, Promega M300) in a final volume of 12.5 μl, and amplified for 37 cycles with the primers found in Additional file : Table S1. .. Mass spectrometry analysis Purified proteins were obtained as described in the immunoprecipitation segment with a starting amount of 1.5 grams of mixed floral tissues.

Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
Article Snippet: .. The PCR confirmation of the insert in the target vector (Figure ) was performed with the GoTaq DNA polymerase (Promega Corporation, Madison, WI) using the pGEMHE vector specific primer pair. ..

Article Title: Gene Expression Profiles Controlled by the Alternative Splicing Factor Nova2 in Endothelial Cells
Article Snippet: .. An aliquot of the RT reaction (1–2 μL) was then PCR-amplified (with GoTaq DNA Polymerase, Promega, Madison, WI, USA), whereas, for quantitative PCR (qPCR), cDNAs were amplified with QuantiTect SYBR Green PCR (QIAGEN) or iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) by using LightCycler 480 (Roche). ..

Article Title: The Broad-Spectrum Antiviral Protein ZAP Restricts Human Retrotransposition
Article Snippet: .. Subsequent PCR used GoTaq DNA polymerase (Promega). .. RT-PCR primers were: 1EGFPcass5P TGTTCTGCTGGTAGTGGTCG 2EGFPcass3P TATATCATGGCCGACAAGCAG, which span the intron of the 99-PUR-JM111-EGFP reporter cassette, and 13HSPA6for CAAAATGCAAGACAAGTGTCG 14HSPA6rev TTCTAGCTTTGGAGGGAAAG, which amplify HSPA6 (Accession No. NM_002155).

Plasmid Preparation:

Article Title: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method
Article Snippet: .. The PCR confirmation of the insert in the target vector (Figure ) was performed with the GoTaq DNA polymerase (Promega Corporation, Madison, WI) using the pGEMHE vector specific primer pair. ..

Hybridization:

Article Title: Comparative Genome Analysis Provides Insights into Both the Lifestyle of Acidithiobacillus ferrivorans Strain CF27 and the Chimeric Nature of the Iron-Oxidizing Acidithiobacilli Genomes
Article Snippet: .. For each RT-PCR experiment, the hybridisation (55–66°C) and elongation (68 or 72°C) temperatures, RNA concentration (from 0.1 to 20 ng), DNA polymerase (GoTaq or Tfl from Promega), and the number of cycles (30, 35, or 40) were adjusted. .. Three controls were used: one without template to detect potential contaminations, one with genomic DNA as a positive control for PCR amplification and one with RNA not treated with reverse transcriptase to check for DNA contamination during RNA preparation.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Promega dnase i
    MarR family protein Rv2887 binds to a sequence upstream of the Rv0560c gene. ( A ) EMSA experiment using a PCR-amplified DNA probe spanning the upstream region of Rv0560c. Migration of the DNA probe was retarded compared to free-labeled DNA on addition of Rv2887. A labeled random DNA sequence of the same length as the target probe was used as a control (lane 1) ( B ) Dye primer-based <t>DNase</t> I footprinting shows that Rv2887 binds directly to a sequence upstream of Rv0560c. Electropherograms indicating the protection pattern of the region upstream of Rv0560c on digestion with Dnase I after incubation with (I) 0 μg (II) 0.45 μg or (III) 0.9 μg Rv2887 protein. ( C ) The protected DNA sequence. The DNA sequence upstream of Rv0560c showing the Rv2887 binding site (highlighted in light green).
    Dnase I, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 560 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dnase i/product/Promega
    Average 92 stars, based on 560 article reviews
    Price from $9.99 to $1999.99
    dnase i - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    94
    Promega t4 dna ligase
    DNA cleavage is coordinated at 3′Dβ and Jβ RSSs. (A) Schematic of the Jβ1 ω , Jβ1 M2 , and Jβ1 M4 alleles as described in the legend to Fig. 1 with the BW linker ligated to cleaved 3′ Dβ1 and Jβ1.2 signal ends. The position of the oligonucleotide primers used to amplify linker ligated to the 3′ Dβ1 (BW-1H, 3A, and 3B) and Jβ1.2 (BWJ, JA, and JB) signal ends are shown as is the position of the oligonucleotide (P1) used to probe these PCR products. Genomic DNA from Jβ1 M4/ω or Jβ1 M2/ω DN thymocytes was incubated with the BW linker in the presence (+) or absence (−) or <t>T4</t> DNA ligase and heminested LMPCRs performed to detect 3′ Dβ1 (B) and Jβ1.2 (C) signal ends as described in the Materials and Methods section. Analyses of Jβ1.2 signal ends was performed on ligated thymocyte DNA that was serially diluted into nonligated DNA keeping the total amount of DNA constant. Cell equivalents of ligated template DNA are indicated. Products from ligation of the BW linker to signal ends from the Jβ1 ω (ω), Jβ1 M4 (M4), and Jβ1 M2 (M2) alleles are indicated. Molecular weight markers are shown. Also shown is a RAG-2 gene PCR performed on ligated and nonligated template DNA and probed with the R2P oligonucleotide.
    T4 Dna Ligase, supplied by Promega, used in various techniques. Bioz Stars score: 94/100, based on 704 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase/product/Promega
    Average 94 stars, based on 704 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    Image Search Results


    MarR family protein Rv2887 binds to a sequence upstream of the Rv0560c gene. ( A ) EMSA experiment using a PCR-amplified DNA probe spanning the upstream region of Rv0560c. Migration of the DNA probe was retarded compared to free-labeled DNA on addition of Rv2887. A labeled random DNA sequence of the same length as the target probe was used as a control (lane 1) ( B ) Dye primer-based DNase I footprinting shows that Rv2887 binds directly to a sequence upstream of Rv0560c. Electropherograms indicating the protection pattern of the region upstream of Rv0560c on digestion with Dnase I after incubation with (I) 0 μg (II) 0.45 μg or (III) 0.9 μg Rv2887 protein. ( C ) The protected DNA sequence. The DNA sequence upstream of Rv0560c showing the Rv2887 binding site (highlighted in light green).

    Journal: Scientific Reports

    Article Title: Structural analysis of the regulatory mechanism of MarR protein Rv2887 in M. tuberculosis

    doi: 10.1038/s41598-017-01705-4

    Figure Lengend Snippet: MarR family protein Rv2887 binds to a sequence upstream of the Rv0560c gene. ( A ) EMSA experiment using a PCR-amplified DNA probe spanning the upstream region of Rv0560c. Migration of the DNA probe was retarded compared to free-labeled DNA on addition of Rv2887. A labeled random DNA sequence of the same length as the target probe was used as a control (lane 1) ( B ) Dye primer-based DNase I footprinting shows that Rv2887 binds directly to a sequence upstream of Rv0560c. Electropherograms indicating the protection pattern of the region upstream of Rv0560c on digestion with Dnase I after incubation with (I) 0 μg (II) 0.45 μg or (III) 0.9 μg Rv2887 protein. ( C ) The protected DNA sequence. The DNA sequence upstream of Rv0560c showing the Rv2887 binding site (highlighted in light green).

    Article Snippet: After incubation for 30 min at 25 °C, 10 µl solution containing about 0.015 units DNase I (Promega) and 100 nM freshly prepared CaCl2 was added and further incubated for 1 min at 25 °C.

    Techniques: Sequencing, Polymerase Chain Reaction, Amplification, Migration, Labeling, Footprinting, Incubation, Binding Assay

    Gene expression and DNase I hypersensitivity analysis of Gpx6 and Hk1 . A) Relative expression of Gpx6 and Hk1 measured by real-time PCR. B) Maps depicting the genomic regions selected for analysis by DNase I digestion. Black rectangles indicate exon regions within the gene. Bars below the maps indicate the regions chosen for DNase I hypersensitivity analysis. (C) Recovery of Gpx6 amplicons following digestion with varying concentrations of DNase I (D). Recovery of Hk1 amplicons following digestion with varying concentrations of DNase I. P-values represent the significance testing for the effect of genotype as determined by two-way ANOVA, values in bold are significant at p

    Journal: PLoS ONE

    Article Title: Metabolomics Reveals a Role for the Chromatin-Binding Protein HMGN5 in Glutathione Metabolism

    doi: 10.1371/journal.pone.0084583

    Figure Lengend Snippet: Gene expression and DNase I hypersensitivity analysis of Gpx6 and Hk1 . A) Relative expression of Gpx6 and Hk1 measured by real-time PCR. B) Maps depicting the genomic regions selected for analysis by DNase I digestion. Black rectangles indicate exon regions within the gene. Bars below the maps indicate the regions chosen for DNase I hypersensitivity analysis. (C) Recovery of Gpx6 amplicons following digestion with varying concentrations of DNase I (D). Recovery of Hk1 amplicons following digestion with varying concentrations of DNase I. P-values represent the significance testing for the effect of genotype as determined by two-way ANOVA, values in bold are significant at p

    Article Snippet: Samples containing 50 µg genomic DNA were then diluted in buffer A containing 6 mM CaCl2 digested with various amounts of DNase I (Promega, Madison, WI) for 2 min at 37°C.

    Techniques: Expressing, Real-time Polymerase Chain Reaction

    DNA cleavage is coordinated at 3′Dβ and Jβ RSSs. (A) Schematic of the Jβ1 ω , Jβ1 M2 , and Jβ1 M4 alleles as described in the legend to Fig. 1 with the BW linker ligated to cleaved 3′ Dβ1 and Jβ1.2 signal ends. The position of the oligonucleotide primers used to amplify linker ligated to the 3′ Dβ1 (BW-1H, 3A, and 3B) and Jβ1.2 (BWJ, JA, and JB) signal ends are shown as is the position of the oligonucleotide (P1) used to probe these PCR products. Genomic DNA from Jβ1 M4/ω or Jβ1 M2/ω DN thymocytes was incubated with the BW linker in the presence (+) or absence (−) or T4 DNA ligase and heminested LMPCRs performed to detect 3′ Dβ1 (B) and Jβ1.2 (C) signal ends as described in the Materials and Methods section. Analyses of Jβ1.2 signal ends was performed on ligated thymocyte DNA that was serially diluted into nonligated DNA keeping the total amount of DNA constant. Cell equivalents of ligated template DNA are indicated. Products from ligation of the BW linker to signal ends from the Jβ1 ω (ω), Jβ1 M4 (M4), and Jβ1 M2 (M2) alleles are indicated. Molecular weight markers are shown. Also shown is a RAG-2 gene PCR performed on ligated and nonligated template DNA and probed with the R2P oligonucleotide.

    Journal: The Journal of Experimental Medicine

    Article Title: Restrictions Limiting the Generation of DNA Double Strand Breaks during Chromosomal V(D)J Recombination

    doi: 10.1084/jem.20011803

    Figure Lengend Snippet: DNA cleavage is coordinated at 3′Dβ and Jβ RSSs. (A) Schematic of the Jβ1 ω , Jβ1 M2 , and Jβ1 M4 alleles as described in the legend to Fig. 1 with the BW linker ligated to cleaved 3′ Dβ1 and Jβ1.2 signal ends. The position of the oligonucleotide primers used to amplify linker ligated to the 3′ Dβ1 (BW-1H, 3A, and 3B) and Jβ1.2 (BWJ, JA, and JB) signal ends are shown as is the position of the oligonucleotide (P1) used to probe these PCR products. Genomic DNA from Jβ1 M4/ω or Jβ1 M2/ω DN thymocytes was incubated with the BW linker in the presence (+) or absence (−) or T4 DNA ligase and heminested LMPCRs performed to detect 3′ Dβ1 (B) and Jβ1.2 (C) signal ends as described in the Materials and Methods section. Analyses of Jβ1.2 signal ends was performed on ligated thymocyte DNA that was serially diluted into nonligated DNA keeping the total amount of DNA constant. Cell equivalents of ligated template DNA are indicated. Products from ligation of the BW linker to signal ends from the Jβ1 ω (ω), Jβ1 M4 (M4), and Jβ1 M2 (M2) alleles are indicated. Molecular weight markers are shown. Also shown is a RAG-2 gene PCR performed on ligated and nonligated template DNA and probed with the R2P oligonucleotide.

    Article Snippet: Purified thymocyte genomic DNA (2–3 μg) was ligated to 100 pmoles of the BW linker in a volume of 50–60 μl with 1–3 units T4 DNA Ligase (Promega) at 16°C for 12–14 h. Ligated samples were extracted with phenol and chloroform before PCR analysis.

    Techniques: Polymerase Chain Reaction, Incubation, Ligation, Molecular Weight

    Circular permutation polymerase chain reaction (PCR) strategy used for preparing nucleosomal DNA with T 11 -tracts at specific superhelix locations (SHLs). ( A ) A 168-mer DNA duplex was designed to have a centrally located T 11 -tract (underlined), terminal EcoRI restriction sites (green italic), phased minor groove bending (T/A) 3 sequences in red and major groove bending (G/C) 3 sequences in blue. The T in orange in the T 11 -tract corresponds to the position at which the major groove is expected to bend toward the histone surface at the dyad axis. ( B ) The 168-mer DNA duplex was prepared by primer extension of two overlapping 95 and 96-mers, cleaved with EcoRI and multimerized with T4 DNA ligase and adenosine triphosphate. The dimer was then excised from a gel and cloned. Nucleosomal DNAs with T 11 -tracts at specific SHLs were prepared from the clone by PCR using specific pairs of forward and reverse primers ( Supplementary Figure S3 ) whose positions are shown as solid and dashed arrows respectively on the sequence in panel A. The SHLs are identified by the number of helical turns from the dyad axis on the blue strand containing the T 11 -tract. They are negative to correspond with the negative numbers assigned to nucleotides on the T 11 -tract strand that are 5΄-to the T at the dyad axis which is assigned as 0. The −3 (inside) and +3 (outside) nucleotide positions are shown in blue. The positions at which the major and minor grooves face the histone surface are indicated by M and m, respectively, and are colored coded blue and red to match the major groove and minor groove bending motifs in panel A.

    Journal: Nucleic Acids Research

    Article Title: Modulation of cyclobutane thymine photodimer formation in T11-tracts in rotationally phased nucleosome core particles and DNA minicircles

    doi: 10.1093/nar/gkx427

    Figure Lengend Snippet: Circular permutation polymerase chain reaction (PCR) strategy used for preparing nucleosomal DNA with T 11 -tracts at specific superhelix locations (SHLs). ( A ) A 168-mer DNA duplex was designed to have a centrally located T 11 -tract (underlined), terminal EcoRI restriction sites (green italic), phased minor groove bending (T/A) 3 sequences in red and major groove bending (G/C) 3 sequences in blue. The T in orange in the T 11 -tract corresponds to the position at which the major groove is expected to bend toward the histone surface at the dyad axis. ( B ) The 168-mer DNA duplex was prepared by primer extension of two overlapping 95 and 96-mers, cleaved with EcoRI and multimerized with T4 DNA ligase and adenosine triphosphate. The dimer was then excised from a gel and cloned. Nucleosomal DNAs with T 11 -tracts at specific SHLs were prepared from the clone by PCR using specific pairs of forward and reverse primers ( Supplementary Figure S3 ) whose positions are shown as solid and dashed arrows respectively on the sequence in panel A. The SHLs are identified by the number of helical turns from the dyad axis on the blue strand containing the T 11 -tract. They are negative to correspond with the negative numbers assigned to nucleotides on the T 11 -tract strand that are 5΄-to the T at the dyad axis which is assigned as 0. The −3 (inside) and +3 (outside) nucleotide positions are shown in blue. The positions at which the major and minor grooves face the histone surface are indicated by M and m, respectively, and are colored coded blue and red to match the major groove and minor groove bending motifs in panel A.

    Article Snippet: The 168-bp duplex DNA was then digested by EcoRI (Promega) in 90 mM Tris–HCl (pH 7.5), 50 mM NaCl and 10 mM MgCl2 , for 30 min at 37°C, and oligomerized with T4 DNA ligase (Promega) in 30 mM Tris–HCl (pH 7.8), 10 mM MgCl2 , 10 mM DTT and 1 mM adenosine triphosphate (ATP), for 3 h at room temperature.

    Techniques: Polymerase Chain Reaction, Clone Assay, Sequencing