Structured Review

Thermo Fisher rlm race
Fig. 3 . <t>RLM-RACE</t> analysis of the BEV genome and sg mRNAs. ( A ) RLM-RACE products obtained for the purified viral genome (1) and for sg mRNAs 2–5 were separated in 2% agarose gels. ( B ) Purification of BEV genomic RNA. Tissue culture supernatant of BEV-infected Ederm cells was harvested and cleared by low speed centrifugation. Subsequently, virions were pelleted through a 10% (w/v) sucrose cushion. Genomic RNA was extracted and analyzed by RNA hybridization with oligonucleotide 294 (V); intracellular BEV mRNAs (IC) served as a marker.
Rlm Race, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 16733 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rlm race/product/Thermo Fisher
Average 95 stars, based on 16733 article reviews
Price from $9.99 to $1999.99
rlm race - by Bioz Stars, 2020-04
95/100 stars

Images

1) Product Images from "Discontinuous and non-discontinuous subgenomic RNA transcription in a nidovirus"

Article Title: Discontinuous and non-discontinuous subgenomic RNA transcription in a nidovirus

Journal: The EMBO Journal

doi: 10.1093/emboj/cdf635

Fig. 3 . RLM-RACE analysis of the BEV genome and sg mRNAs. ( A ) RLM-RACE products obtained for the purified viral genome (1) and for sg mRNAs 2–5 were separated in 2% agarose gels. ( B ) Purification of BEV genomic RNA. Tissue culture supernatant of BEV-infected Ederm cells was harvested and cleared by low speed centrifugation. Subsequently, virions were pelleted through a 10% (w/v) sucrose cushion. Genomic RNA was extracted and analyzed by RNA hybridization with oligonucleotide 294 (V); intracellular BEV mRNAs (IC) served as a marker.
Figure Legend Snippet: Fig. 3 . RLM-RACE analysis of the BEV genome and sg mRNAs. ( A ) RLM-RACE products obtained for the purified viral genome (1) and for sg mRNAs 2–5 were separated in 2% agarose gels. ( B ) Purification of BEV genomic RNA. Tissue culture supernatant of BEV-infected Ederm cells was harvested and cleared by low speed centrifugation. Subsequently, virions were pelleted through a 10% (w/v) sucrose cushion. Genomic RNA was extracted and analyzed by RNA hybridization with oligonucleotide 294 (V); intracellular BEV mRNAs (IC) served as a marker.

Techniques Used: Purification, Infection, Centrifugation, Hybridization, Marker

Fig. 7 . Hybridization analysis of the 5′ terminus of mRNA 2. Upper panel: total cytoplasmic RNA, extracted from BEV-infected cells, was separated in denaturing formaldehyde–1% agarose gels and hybridized to the indicated radiolabeled oligonucleotide probes. Hybridization with probes 294 and 1746 was performed at 5°C below the T m . Hybridization with probe 1553 was performed at the indicated temperatures. Lower panel: nucleotide sequence comparison of the mRNA 2 RLM-RACE product, the corresponding ORF1b region and the 5′ terminus of the BEV genome. Asterisks indicate identical residues. Also given are the sequences of the oligonucleotide probes. Mismatches with the BEV 5′ terminus or the ORF1b sequence are italicized. Nucleotide positions on the viral genome are indicated.
Figure Legend Snippet: Fig. 7 . Hybridization analysis of the 5′ terminus of mRNA 2. Upper panel: total cytoplasmic RNA, extracted from BEV-infected cells, was separated in denaturing formaldehyde–1% agarose gels and hybridized to the indicated radiolabeled oligonucleotide probes. Hybridization with probes 294 and 1746 was performed at 5°C below the T m . Hybridization with probe 1553 was performed at the indicated temperatures. Lower panel: nucleotide sequence comparison of the mRNA 2 RLM-RACE product, the corresponding ORF1b region and the 5′ terminus of the BEV genome. Asterisks indicate identical residues. Also given are the sequences of the oligonucleotide probes. Mismatches with the BEV 5′ terminus or the ORF1b sequence are italicized. Nucleotide positions on the viral genome are indicated.

Techniques Used: Hybridization, Infection, Sequencing

2) Product Images from "High Expression of a C Protein ? Antigen Gene among Invasive Strains from Certain Clonally Related Groups of Type Ia and Ib Group B Streptococci "

Article Title: High Expression of a C Protein ? Antigen Gene among Invasive Strains from Certain Clonally Related Groups of Type Ia and Ib Group B Streptococci

Journal: Infection and Immunity

doi: 10.1128/IAI.70.8.4643-4649.2002

Quantification of β antigen mRNA transcripts by cRT-PCR. (A) Agarose gel profile of β antigen transcripts of samples from a representative strain, strain no. 23 (RDP Ib-1), which shows the level of binding of anti-β monoclonal antibody to be +++. A constant amount of total RNA (0.25 ng) was reverse transcribed and amplified with twofold serial dilutions of control RNA (0.8 to 27 amol). Amplified products were visualized by staining with SYBER Green I after electrophoresis as described in Materials and Methods. The positions of the cRT-PCR products from 540-bp target RNA and 480-bp control RNA are indicated. (B) Plotting of the logarithm of the ratio of target to control intensities against the logarithm of the amount of control RNA added to the reaction mixture. The amounts of β antigen mRNA transcripts were determined from linear regression analysis of the plotted data. Scanning of the gels and quantitative analyses were done as described in Materials and Methods. (C) Quantification of β antigen mRNA transcripts and levels of anti-β monoclonal antibody binding. The quantification results are plotted as mean values. Symbols:•, RDP Ia-3 strains; ▪, RDP Ib-1 strains. A significant difference in the amount of transcripts was obtained for strains with anti-β monoclonal antibody binding levels of ++ and +++ compared to those with binding levels of − and ± or +.
Figure Legend Snippet: Quantification of β antigen mRNA transcripts by cRT-PCR. (A) Agarose gel profile of β antigen transcripts of samples from a representative strain, strain no. 23 (RDP Ib-1), which shows the level of binding of anti-β monoclonal antibody to be +++. A constant amount of total RNA (0.25 ng) was reverse transcribed and amplified with twofold serial dilutions of control RNA (0.8 to 27 amol). Amplified products were visualized by staining with SYBER Green I after electrophoresis as described in Materials and Methods. The positions of the cRT-PCR products from 540-bp target RNA and 480-bp control RNA are indicated. (B) Plotting of the logarithm of the ratio of target to control intensities against the logarithm of the amount of control RNA added to the reaction mixture. The amounts of β antigen mRNA transcripts were determined from linear regression analysis of the plotted data. Scanning of the gels and quantitative analyses were done as described in Materials and Methods. (C) Quantification of β antigen mRNA transcripts and levels of anti-β monoclonal antibody binding. The quantification results are plotted as mean values. Symbols:•, RDP Ia-3 strains; ▪, RDP Ib-1 strains. A significant difference in the amount of transcripts was obtained for strains with anti-β monoclonal antibody binding levels of ++ and +++ compared to those with binding levels of − and ± or +.

Techniques Used: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Binding Assay, Amplification, Staining, Electrophoresis, IA

3) Product Images from "MDA-9/Syntenin and IGFBP-2 Promote Angiogenesis in Human Melanoma"

Article Title: MDA-9/Syntenin and IGFBP-2 Promote Angiogenesis in Human Melanoma

Journal: Cancer research

doi: 10.1158/0008-5472.CAN-12-1681

Hypothetical model of MDA-9/syntenin induction of angiogenesis. MDA-9/syntenin upon interaction with c-Src, activates HIF-1α in an AKT-dependent pathway and induces IGFBP-2 expression. IGFBP-2 acts as a chemo-attractant for endothelial cells and
Figure Legend Snippet: Hypothetical model of MDA-9/syntenin induction of angiogenesis. MDA-9/syntenin upon interaction with c-Src, activates HIF-1α in an AKT-dependent pathway and induces IGFBP-2 expression. IGFBP-2 acts as a chemo-attractant for endothelial cells and

Techniques Used: Multiple Displacement Amplification, Expressing

Effect of mda -9/syntenin on the angiogenic phenotype of human vascular endothelial cells (HuVECs). A) Time course analysis of growth of HuVECs in co-culture with either C8161.9-con-sh or C8161.9-sh mda -9 clones. B) Analysis of tube formation by HuVECs
Figure Legend Snippet: Effect of mda -9/syntenin on the angiogenic phenotype of human vascular endothelial cells (HuVECs). A) Time course analysis of growth of HuVECs in co-culture with either C8161.9-con-sh or C8161.9-sh mda -9 clones. B) Analysis of tube formation by HuVECs

Techniques Used: Multiple Displacement Amplification, Co-Culture Assay

mda -9/syntenin enhances IGFBP-2 expression through c-Src- and AKT-dependent pathways. A) Expression levels of IGFBP-2 in the indicated cell-derived CM were determined by ELISA and the levels of MDA-9/syntenin protein in cell lysates were determined by
Figure Legend Snippet: mda -9/syntenin enhances IGFBP-2 expression through c-Src- and AKT-dependent pathways. A) Expression levels of IGFBP-2 in the indicated cell-derived CM were determined by ELISA and the levels of MDA-9/syntenin protein in cell lysates were determined by

Techniques Used: Multiple Displacement Amplification, Expressing, Derivative Assay, Enzyme-linked Immunosorbent Assay

In vivo assessment of tumor formation in mice and growth in the chicken embryo chorioallantoic membrane (CAM) assay after modulation of mda -9/syntenin expression. A) Subcutaneous xenografts were established in athymic nude mice (n=15) and tumor volume
Figure Legend Snippet: In vivo assessment of tumor formation in mice and growth in the chicken embryo chorioallantoic membrane (CAM) assay after modulation of mda -9/syntenin expression. A) Subcutaneous xenografts were established in athymic nude mice (n=15) and tumor volume

Techniques Used: In Vivo, Mouse Assay, Chick Chorioallantoic Membrane Assay, Multiple Displacement Amplification, Expressing

4) Product Images from "Zcchc11 Uridylates Mature miRNAs to Enhance Neonatal IGF-1 Expression, Growth, and Survival"

Article Title: Zcchc11 Uridylates Mature miRNAs to Enhance Neonatal IGF-1 Expression, Growth, and Survival

Journal: PLoS Genetics

doi: 10.1371/journal.pgen.1003105

Zcchc11 deficiency does not affect quantities of mature miRNAs or miRNA–related proteins in the liver. Three deep sequencing libraries were created from livers of sex- and littermate-matched 8-day-old Zcchc11 +/+ or Zcchc11 −/− mice. (A) Mature miRNA content, expressed as reads per million (RPM) was compared for wild type and Zcchc11-deficient livers (correlation coefficient, r = 0.975). (B) Quantitative RT-PCR was used to measure the expression of several miRNAs including some implicated in Zcchc11 pre-miRNA uridylation (Let-7), those highly expressed in the livers (miR-122), and those showing trends towards change in the deep sequencing data (miR-139 and miR-379), revealing no difference between genotypes. (C) As another approach to examining Let-7 content, Let-7a in the livers of 8-day old mice was measured by Northern blotting, and did not increase due to Zcchc11 deficiency. An adult wild type mouse was also included for comparison. (D) Immunoblots for RISC-related proteins in tissue homogenates were prepared from the livers of 8 day-old mice, showing no differences due to genotype. (E) Immunoblots for Lin-28 family members in the livers and skeletal muscles of 8 day old Zcchc11 +/+ and Zcchc11 −/− mice revealed no effects of Zcchc11 deficiency. Actin was measured as a loading control. For all blots, each lane represents the RNA or protein from a separate individual of the indicated age and genotype.
Figure Legend Snippet: Zcchc11 deficiency does not affect quantities of mature miRNAs or miRNA–related proteins in the liver. Three deep sequencing libraries were created from livers of sex- and littermate-matched 8-day-old Zcchc11 +/+ or Zcchc11 −/− mice. (A) Mature miRNA content, expressed as reads per million (RPM) was compared for wild type and Zcchc11-deficient livers (correlation coefficient, r = 0.975). (B) Quantitative RT-PCR was used to measure the expression of several miRNAs including some implicated in Zcchc11 pre-miRNA uridylation (Let-7), those highly expressed in the livers (miR-122), and those showing trends towards change in the deep sequencing data (miR-139 and miR-379), revealing no difference between genotypes. (C) As another approach to examining Let-7 content, Let-7a in the livers of 8-day old mice was measured by Northern blotting, and did not increase due to Zcchc11 deficiency. An adult wild type mouse was also included for comparison. (D) Immunoblots for RISC-related proteins in tissue homogenates were prepared from the livers of 8 day-old mice, showing no differences due to genotype. (E) Immunoblots for Lin-28 family members in the livers and skeletal muscles of 8 day old Zcchc11 +/+ and Zcchc11 −/− mice revealed no effects of Zcchc11 deficiency. Actin was measured as a loading control. For all blots, each lane represents the RNA or protein from a separate individual of the indicated age and genotype.

Techniques Used: Sequencing, Mouse Assay, Quantitative RT-PCR, Expressing, Northern Blot, Western Blot

5) Product Images from "Practical and general synthesis of 5?-adenylated RNA (5?-AppRNA)"

Article Title: Practical and general synthesis of 5?-adenylated RNA (5?-AppRNA)

Journal: RNA

doi: 10.1261/rna.5247704

5′-adenylation of long RNA substrates. ( A ) Schematic diagram of the experimental strategy. The > 100-mer RNA substrate is too long for 5′-AppRNA formation to induce a measurable gel shift relative to a 5′-monophosphate. Therefore, an appropriate 8–17 deoxyribozyme is used to cleave the 5′-portion of the RNA substrate, leaving a small fragment for which 5′-AppRNA formation does cause a gel shift. ( B ) The strategy in A applied to the 160-nt P4–P6 domain of the Tetrahymena group I intron RNA. Blocking oligos were uncapped. The three time points are at 0.5 min, 10 min, and 1 h (6% PAGE). The RNA substrate was internally radiolabeled by transcription incorporating α- 32 P-ATP; the 5′-monophosphate was provided by performing the transcription in the presence of excess GMP (see Materials and Methods). Although the side products have not been studied in great detail, the side product formed in the first experiment (P4–P6 with no DNA blocking oligo) is tentatively assigned as circularized P4–P6 on the basis of attempted 5′- 32 P-radiolabeling with T4 polynucleotide kinase and γ- 32 P-ATP; no reaction was observed alongside a positive control. Only the lower band (a mixture of 5′-monophosphate and 5′-AppRNA) was carried to the 8–17 deoxyribozyme cleavage experiment. std, P4–P6 standard RNA carried through all reactions with no blocking oligo, except that T4 RNA ligase was omitted. ( C ) The strategy in A ).
Figure Legend Snippet: 5′-adenylation of long RNA substrates. ( A ) Schematic diagram of the experimental strategy. The > 100-mer RNA substrate is too long for 5′-AppRNA formation to induce a measurable gel shift relative to a 5′-monophosphate. Therefore, an appropriate 8–17 deoxyribozyme is used to cleave the 5′-portion of the RNA substrate, leaving a small fragment for which 5′-AppRNA formation does cause a gel shift. ( B ) The strategy in A applied to the 160-nt P4–P6 domain of the Tetrahymena group I intron RNA. Blocking oligos were uncapped. The three time points are at 0.5 min, 10 min, and 1 h (6% PAGE). The RNA substrate was internally radiolabeled by transcription incorporating α- 32 P-ATP; the 5′-monophosphate was provided by performing the transcription in the presence of excess GMP (see Materials and Methods). Although the side products have not been studied in great detail, the side product formed in the first experiment (P4–P6 with no DNA blocking oligo) is tentatively assigned as circularized P4–P6 on the basis of attempted 5′- 32 P-radiolabeling with T4 polynucleotide kinase and γ- 32 P-ATP; no reaction was observed alongside a positive control. Only the lower band (a mixture of 5′-monophosphate and 5′-AppRNA) was carried to the 8–17 deoxyribozyme cleavage experiment. std, P4–P6 standard RNA carried through all reactions with no blocking oligo, except that T4 RNA ligase was omitted. ( C ) The strategy in A ).

Techniques Used: Electrophoretic Mobility Shift Assay, Blocking Assay, Polyacrylamide Gel Electrophoresis, Radioactivity, Positive Control

5′-Adenylated RNA. ( A ) The structure of 5′-AppRNA. X is the 5′-terminal nucleotide of the RNA substrate before adenylation. ( B ) The T4 RNA ligase mechanism, showing the 5′-AppRNA intermediate 2 . X and X′ may be any nucleotides. ( C ) Nucleophilic displacement reaction on 5′-triphosphorylated RNA (5′-pppRNA). Nu, nucleophile. The 5′-terminal nucleotide of the RNA is shown as guanosine G because 5′-triphosphorylated RNAs are most typically prepared by in vitro transcription, which introduces G at this position. The nucleophilic substitution reaction on 5′-AppRNA is analogous, except with displacement of AMP instead of PP i (cf. 2 → 3 in B ).
Figure Legend Snippet: 5′-Adenylated RNA. ( A ) The structure of 5′-AppRNA. X is the 5′-terminal nucleotide of the RNA substrate before adenylation. ( B ) The T4 RNA ligase mechanism, showing the 5′-AppRNA intermediate 2 . X and X′ may be any nucleotides. ( C ) Nucleophilic displacement reaction on 5′-triphosphorylated RNA (5′-pppRNA). Nu, nucleophile. The 5′-terminal nucleotide of the RNA is shown as guanosine G because 5′-triphosphorylated RNAs are most typically prepared by in vitro transcription, which introduces G at this position. The nucleophilic substitution reaction on 5′-AppRNA is analogous, except with displacement of AMP instead of PP i (cf. 2 → 3 in B ).

Techniques Used: In Vitro

Possible reaction products from 5′-adenylation of an RNA substrate with T4 RNA ligase and ATP. 5′-monophosphate and 5′-adenyl pyrophosphate termini are abbreviated p and App, respectively. The 5′-to-3′ polarity of each strand is shown by an arrowhead pointing in the 3′-direction. The desired 5′-AppRNA is boxed, and the three possible side reactions starting from 5′-AppRNA are illustrated (circularization, oligomerization, and blocking oligo ligation). The abbreviations used for the other products in the remaining figures of this article are given in boldface within parentheses. For the oligomerization reaction, the RNA substrate that does not provide the reactive 5′-App may itself have either 5′-p or 5′-App. Therefore, two different oligomerization products of any given nucleotide length are possible; only one is shown here.
Figure Legend Snippet: Possible reaction products from 5′-adenylation of an RNA substrate with T4 RNA ligase and ATP. 5′-monophosphate and 5′-adenyl pyrophosphate termini are abbreviated p and App, respectively. The 5′-to-3′ polarity of each strand is shown by an arrowhead pointing in the 3′-direction. The desired 5′-AppRNA is boxed, and the three possible side reactions starting from 5′-AppRNA are illustrated (circularization, oligomerization, and blocking oligo ligation). The abbreviations used for the other products in the remaining figures of this article are given in boldface within parentheses. For the oligomerization reaction, the RNA substrate that does not provide the reactive 5′-App may itself have either 5′-p or 5′-App. Therefore, two different oligomerization products of any given nucleotide length are possible; only one is shown here.

Techniques Used: Blocking Assay, Ligation

6) Product Images from "Thermal Stability of siRNA Modulates Aptamer- conjugated siRNA Inhibition"

Article Title: Thermal Stability of siRNA Modulates Aptamer- conjugated siRNA Inhibition

Journal: Molecular Therapy. Nucleic Acids

doi: 10.1038/mtna.2012.41

Small interfering RNA (siRNA) activity in conjugates prescreened for siRNAs with reduced melting temperature (T m ). Candidate siRNAs were predicted by the algorithms described in Methods and confirmed to have high efficiency knockdown of respective targets—murine Blimp-1 (#7, #9, #10, and #11) and T-bet (#12, #13, #14, and #15) in siCHECK assay. ( a ) Highest scoring candidates, all which had a relative T m of 57–58 °C, were conjugated to a 4-1BB-binding aptamer using the more favorable Apt-S/AS configuration and tested for target inhibition using the siCHECK assay. White bars, control siRNA as free duplex or conjugate. ( b ) Same as a except that siRNAs with reduced T m were used. ( c ) Candidate siRNAs targeted to murine Smad3 and Rnf111 genes were conjugated to 4-1BB binding aptamer (Apt-S/AS configuration) and tested for target inhibition using the ψcheck assay (left panels) or downregulation of endogenous transcripts measured by quantitative reverse-transcription-PCR (right panels). White bar, aptamer-conjugated control siRNAs and control siRNAs duplex. Conditions transfected in triplicate and data representative of at least two independent experiments.
Figure Legend Snippet: Small interfering RNA (siRNA) activity in conjugates prescreened for siRNAs with reduced melting temperature (T m ). Candidate siRNAs were predicted by the algorithms described in Methods and confirmed to have high efficiency knockdown of respective targets—murine Blimp-1 (#7, #9, #10, and #11) and T-bet (#12, #13, #14, and #15) in siCHECK assay. ( a ) Highest scoring candidates, all which had a relative T m of 57–58 °C, were conjugated to a 4-1BB-binding aptamer using the more favorable Apt-S/AS configuration and tested for target inhibition using the siCHECK assay. White bars, control siRNA as free duplex or conjugate. ( b ) Same as a except that siRNAs with reduced T m were used. ( c ) Candidate siRNAs targeted to murine Smad3 and Rnf111 genes were conjugated to 4-1BB binding aptamer (Apt-S/AS configuration) and tested for target inhibition using the ψcheck assay (left panels) or downregulation of endogenous transcripts measured by quantitative reverse-transcription-PCR (right panels). White bar, aptamer-conjugated control siRNAs and control siRNAs duplex. Conditions transfected in triplicate and data representative of at least two independent experiments.

Techniques Used: Small Interfering RNA, Activity Assay, Binding Assay, Inhibition, Polymerase Chain Reaction, Transfection

Effect of aptamer sequence, linker sequence and sense strand 3 ′ overhang, on small interfering RNA (siRNA) activity. ( a ) Either of two siRNAs were conjugated to two distinct prostate specific membrane antigen (PSMA)-binding or 4-1BB-binding aptamers, or to a scrambled aptamer using the Apt-S/AS configuration, and tested for siRNA inhibition in the siCHECK assay. ( b ) PSMA aptamer-raptor siRNA or 4-1BB aptamer-TGFβRII siRNA conjugated using varying linker sequences between the aptamer and siRNA were tested for siRNA inhibition in the ψcheck assay. ( c ) 4-1BB aptamer-TGFβRII siRNA, OX40 aptamer-Cbl-b siRNA and 4-1BB aptamer-GFP siRNAs with or without a template-encoded UU overhang at the 3′ end of the sense sequence were tested in the ψcheck assay. Conditions transfected in triplicate and data representative of at least two independent experiments. GFP, green fluorescent protein.
Figure Legend Snippet: Effect of aptamer sequence, linker sequence and sense strand 3 ′ overhang, on small interfering RNA (siRNA) activity. ( a ) Either of two siRNAs were conjugated to two distinct prostate specific membrane antigen (PSMA)-binding or 4-1BB-binding aptamers, or to a scrambled aptamer using the Apt-S/AS configuration, and tested for siRNA inhibition in the siCHECK assay. ( b ) PSMA aptamer-raptor siRNA or 4-1BB aptamer-TGFβRII siRNA conjugated using varying linker sequences between the aptamer and siRNA were tested for siRNA inhibition in the ψcheck assay. ( c ) 4-1BB aptamer-TGFβRII siRNA, OX40 aptamer-Cbl-b siRNA and 4-1BB aptamer-GFP siRNAs with or without a template-encoded UU overhang at the 3′ end of the sense sequence were tested in the ψcheck assay. Conditions transfected in triplicate and data representative of at least two independent experiments. GFP, green fluorescent protein.

Techniques Used: Sequencing, Small Interfering RNA, Activity Assay, Binding Assay, Inhibition, Transfection

Effect of conjugation on small interfering RNA (siRNA) inhibition. ( a ) Two configurations of aptamer-siRNA conjugates and unconjugated, unmodified siRNA that did not contain 5′-fluoro-modified pyrimidines were transfected into HEK293T cells and target inhibition assayed. ( b ) Cells were co-transfected with siRNA duplex or 4-1BB aptamer-siRNA conjugates and reporter plasmid containing short sequences corresponding to the murine TGFβRII siRNA targets cloned into the 3′ untranslated region (3′-untranslated region) of Renilla luciferase. After 48 hours, the normalized Renilla luciferase activity was measured in the siCHECK assay as described in Methods. White bars: conjugated and unconjugated control siRNA and untreated respectively. Conditions transfected in triplicate and data representative of at least two independent experiments. ( c ) Unmodified sense strand of raptor siRNA #23 ( Table 1 ) was hybridized to unmodified or 2′-fluoropyrimidine modified antisense strand, or to unmodified aptamer-antisense fusion or 2′-fluoropyrimidine modifed aptamer-antisense fusion. Silencing activity was determined in the siCHECK system.
Figure Legend Snippet: Effect of conjugation on small interfering RNA (siRNA) inhibition. ( a ) Two configurations of aptamer-siRNA conjugates and unconjugated, unmodified siRNA that did not contain 5′-fluoro-modified pyrimidines were transfected into HEK293T cells and target inhibition assayed. ( b ) Cells were co-transfected with siRNA duplex or 4-1BB aptamer-siRNA conjugates and reporter plasmid containing short sequences corresponding to the murine TGFβRII siRNA targets cloned into the 3′ untranslated region (3′-untranslated region) of Renilla luciferase. After 48 hours, the normalized Renilla luciferase activity was measured in the siCHECK assay as described in Methods. White bars: conjugated and unconjugated control siRNA and untreated respectively. Conditions transfected in triplicate and data representative of at least two independent experiments. ( c ) Unmodified sense strand of raptor siRNA #23 ( Table 1 ) was hybridized to unmodified or 2′-fluoropyrimidine modified antisense strand, or to unmodified aptamer-antisense fusion or 2′-fluoropyrimidine modifed aptamer-antisense fusion. Silencing activity was determined in the siCHECK system.

Techniques Used: Conjugation Assay, Small Interfering RNA, Inhibition, Modification, Transfection, Plasmid Preparation, Clone Assay, Luciferase, Activity Assay

Introducing a C→U wobble enhances the inhibitory activity of the conjugated small interfering RNA (siRNA). A wobble was generated by replacing C with U in the 3′ region of the siRNA sense strand. The unmodified and wobble-containing 4-1BB aptamer-S transcripts were conjugated to an AS siRNA strand in the Apt-S/AS configuration (TGFβRII (#4, #5, and #6), Blimp-1 (#7), and green fluorescent protein (#8) siRNAs). The inhibitory activities of the aptamer-conjugated siRNAs and siRNA duplexes were tested in the siCHECK assay. White bar, aptamer-conjugated control siRNAs and control siRNAs duplex. Conditions transfected in triplicate and data representative of at least two independent experiments.
Figure Legend Snippet: Introducing a C→U wobble enhances the inhibitory activity of the conjugated small interfering RNA (siRNA). A wobble was generated by replacing C with U in the 3′ region of the siRNA sense strand. The unmodified and wobble-containing 4-1BB aptamer-S transcripts were conjugated to an AS siRNA strand in the Apt-S/AS configuration (TGFβRII (#4, #5, and #6), Blimp-1 (#7), and green fluorescent protein (#8) siRNAs). The inhibitory activities of the aptamer-conjugated siRNAs and siRNA duplexes were tested in the siCHECK assay. White bar, aptamer-conjugated control siRNAs and control siRNAs duplex. Conditions transfected in triplicate and data representative of at least two independent experiments.

Techniques Used: Activity Assay, Small Interfering RNA, Generated, Transfection

7) Product Images from "Practical Synthesis of Cap‐4 RNA"

Article Title: Practical Synthesis of Cap‐4 RNA

Journal: Chembiochem

doi: 10.1002/cbic.201900590

Enzymatic ligation of T. cruzi cap‐4 spliced leader RNA using T4 DNA ligase. A) RNA sequences and sequence of the 20‐nt DNA splint; B) HPLC analysis of a typical ligation reaction after 3 h reaction time; reaction conditions: 10 μ m RNA 10 , 12.5 μ m RNA 11 , 12.5 μ m splint; 0.5 m m ATP, 40 m m Tris ⋅ HCl (pH 7.8), 10 m m MgCl 2 , 10 m m DTT, 5 % ( w / v ) PEG 4000, 0.5 U μL −1 T4 DNA ligase; C) LC–ESI mass spectrum of the purified 39‐nt cap‐4 RNA ligation product.
Figure Legend Snippet: Enzymatic ligation of T. cruzi cap‐4 spliced leader RNA using T4 DNA ligase. A) RNA sequences and sequence of the 20‐nt DNA splint; B) HPLC analysis of a typical ligation reaction after 3 h reaction time; reaction conditions: 10 μ m RNA 10 , 12.5 μ m RNA 11 , 12.5 μ m splint; 0.5 m m ATP, 40 m m Tris ⋅ HCl (pH 7.8), 10 m m MgCl 2 , 10 m m DTT, 5 % ( w / v ) PEG 4000, 0.5 U μL −1 T4 DNA ligase; C) LC–ESI mass spectrum of the purified 39‐nt cap‐4 RNA ligation product.

Techniques Used: Ligation, Sequencing, High Performance Liquid Chromatography, Purification

8) Product Images from "Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain"

Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

Journal: PLoS ONE

doi: 10.1371/journal.pone.0039251

15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.
Figure Legend Snippet: 15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.

Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.
Figure Legend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.

Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Positive Control, Negative Control

12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.
Figure Legend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.

Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.
Figure Legend Snippet: The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.

Techniques Used: Polyacrylamide Gel Electrophoresis, Electrophoresis, Negative Control, Positive Control

9) Product Images from "Acidic domain of WRNp is critical for autophagy and up-regulates age associated proteins"

Article Title: Acidic domain of WRNp is critical for autophagy and up-regulates age associated proteins

Journal: DNA repair

doi: 10.1016/j.dnarep.2018.05.003

(A) Silencing of WRN protein using WRN siRNA in Wi-38 cell. (A) Western blot analysis of expression of WRN protein in siWRN and scrambled siRNA transfected cell. (B) Graphical representation of inhibition of WRN protein. ** p
Figure Legend Snippet: (A) Silencing of WRN protein using WRN siRNA in Wi-38 cell. (A) Western blot analysis of expression of WRN protein in siWRN and scrambled siRNA transfected cell. (B) Graphical representation of inhibition of WRN protein. ** p

Techniques Used: Western Blot, Expressing, Transfection, Inhibition

10) Product Images from "Practical and general synthesis of 5?-adenylated RNA (5?-AppRNA)"

Article Title: Practical and general synthesis of 5?-adenylated RNA (5?-AppRNA)

Journal: RNA

doi: 10.1261/rna.5247704

5′-adenylation of long RNA substrates. ( A ) Schematic diagram of the experimental strategy. The > 100-mer RNA substrate is too long for 5′-AppRNA formation to induce a measurable gel shift relative to a 5′-monophosphate. Therefore, an appropriate 8–17 deoxyribozyme is used to cleave the 5′-portion of the RNA substrate, leaving a small fragment for which 5′-AppRNA formation does cause a gel shift. ( B ) The strategy in A applied to the 160-nt P4–P6 domain of the Tetrahymena group I intron RNA. Blocking oligos were uncapped. The three time points are at 0.5 min, 10 min, and 1 h (6% PAGE). The RNA substrate was internally radiolabeled by transcription incorporating α- 32 P-ATP; the 5′-monophosphate was provided by performing the transcription in the presence of excess GMP (see Materials and Methods). Although the side products have not been studied in great detail, the side product formed in the first experiment (P4–P6 with no DNA blocking oligo) is tentatively assigned as circularized P4–P6 on the basis of attempted 5′- 32 P-radiolabeling with T4 polynucleotide kinase and γ- 32 P-ATP; no reaction was observed alongside a positive control. Only the lower band (a mixture of 5′-monophosphate and 5′-AppRNA) was carried to the 8–17 deoxyribozyme cleavage experiment. std, P4–P6 standard RNA carried through all reactions with no blocking oligo, except that T4 RNA ligase was omitted. ( C ) The strategy in A ).
Figure Legend Snippet: 5′-adenylation of long RNA substrates. ( A ) Schematic diagram of the experimental strategy. The > 100-mer RNA substrate is too long for 5′-AppRNA formation to induce a measurable gel shift relative to a 5′-monophosphate. Therefore, an appropriate 8–17 deoxyribozyme is used to cleave the 5′-portion of the RNA substrate, leaving a small fragment for which 5′-AppRNA formation does cause a gel shift. ( B ) The strategy in A applied to the 160-nt P4–P6 domain of the Tetrahymena group I intron RNA. Blocking oligos were uncapped. The three time points are at 0.5 min, 10 min, and 1 h (6% PAGE). The RNA substrate was internally radiolabeled by transcription incorporating α- 32 P-ATP; the 5′-monophosphate was provided by performing the transcription in the presence of excess GMP (see Materials and Methods). Although the side products have not been studied in great detail, the side product formed in the first experiment (P4–P6 with no DNA blocking oligo) is tentatively assigned as circularized P4–P6 on the basis of attempted 5′- 32 P-radiolabeling with T4 polynucleotide kinase and γ- 32 P-ATP; no reaction was observed alongside a positive control. Only the lower band (a mixture of 5′-monophosphate and 5′-AppRNA) was carried to the 8–17 deoxyribozyme cleavage experiment. std, P4–P6 standard RNA carried through all reactions with no blocking oligo, except that T4 RNA ligase was omitted. ( C ) The strategy in A ).

Techniques Used: Electrophoretic Mobility Shift Assay, Blocking Assay, Polyacrylamide Gel Electrophoresis, Radioactivity, Positive Control

5′-Adenylated RNA. ( A ) The structure of 5′-AppRNA. X is the 5′-terminal nucleotide of the RNA substrate before adenylation. ( B ) The T4 RNA ligase mechanism, showing the 5′-AppRNA intermediate 2 . X and X′ may be any nucleotides. ( C ) Nucleophilic displacement reaction on 5′-triphosphorylated RNA (5′-pppRNA). Nu, nucleophile. The 5′-terminal nucleotide of the RNA is shown as guanosine G because 5′-triphosphorylated RNAs are most typically prepared by in vitro transcription, which introduces G at this position. The nucleophilic substitution reaction on 5′-AppRNA is analogous, except with displacement of AMP instead of PP i (cf. 2 → 3 in B ).
Figure Legend Snippet: 5′-Adenylated RNA. ( A ) The structure of 5′-AppRNA. X is the 5′-terminal nucleotide of the RNA substrate before adenylation. ( B ) The T4 RNA ligase mechanism, showing the 5′-AppRNA intermediate 2 . X and X′ may be any nucleotides. ( C ) Nucleophilic displacement reaction on 5′-triphosphorylated RNA (5′-pppRNA). Nu, nucleophile. The 5′-terminal nucleotide of the RNA is shown as guanosine G because 5′-triphosphorylated RNAs are most typically prepared by in vitro transcription, which introduces G at this position. The nucleophilic substitution reaction on 5′-AppRNA is analogous, except with displacement of AMP instead of PP i (cf. 2 → 3 in B ).

Techniques Used: In Vitro

Possible reaction products from 5′-adenylation of an RNA substrate with T4 RNA ligase and ATP. 5′-monophosphate and 5′-adenyl pyrophosphate termini are abbreviated p and App, respectively. The 5′-to-3′ polarity of each strand is shown by an arrowhead pointing in the 3′-direction. The desired 5′-AppRNA is boxed, and the three possible side reactions starting from 5′-AppRNA are illustrated (circularization, oligomerization, and blocking oligo ligation). The abbreviations used for the other products in the remaining figures of this article are given in boldface within parentheses. For the oligomerization reaction, the RNA substrate that does not provide the reactive 5′-App may itself have either 5′-p or 5′-App. Therefore, two different oligomerization products of any given nucleotide length are possible; only one is shown here.
Figure Legend Snippet: Possible reaction products from 5′-adenylation of an RNA substrate with T4 RNA ligase and ATP. 5′-monophosphate and 5′-adenyl pyrophosphate termini are abbreviated p and App, respectively. The 5′-to-3′ polarity of each strand is shown by an arrowhead pointing in the 3′-direction. The desired 5′-AppRNA is boxed, and the three possible side reactions starting from 5′-AppRNA are illustrated (circularization, oligomerization, and blocking oligo ligation). The abbreviations used for the other products in the remaining figures of this article are given in boldface within parentheses. For the oligomerization reaction, the RNA substrate that does not provide the reactive 5′-App may itself have either 5′-p or 5′-App. Therefore, two different oligomerization products of any given nucleotide length are possible; only one is shown here.

Techniques Used: Blocking Assay, Ligation

11) Product Images from "An RNA ligase-mediated method for the efficient creation of large, synthetic RNAs"

Article Title: An RNA ligase-mediated method for the efficient creation of large, synthetic RNAs

Journal: RNA

doi: 10.1261/rna.93506

Ligation of 128-nt, synthetic pre-mRNA. ( A ) Strategy for making synthetic YOL047c transcript. The YOL047c gene contains a single 63-nt intron near the 5′ end of the gene. Dashed lines indicate boundaries of the splicing reporter. The 128-nt splicing reporter contains 35 nt of exon 1, the entire intron (branch point nucleotide, BP), and 30 nt of exon 2. Synthetic oligoribonucleotides (labeled A, B, C) for generating the splicing reporter contain, respectively, the 5′ splice junction, the branch point, and the 3′ splice junction. ( B ) Two-step ligation of transcript (lanes 1 , 2 ). Gel-purified AB product (lane 1 , “AB”) was ligated with oligo C and splint S2, yielding full-length ABC product (lane 2 , “ABC”). One-step ligation of transcript (lanes 3 , 4 ). All three RNA oligonucleotides and both splints were incubated in a single reaction. Reactions were treated with DNAse I after ligation, so no splints are visible.
Figure Legend Snippet: Ligation of 128-nt, synthetic pre-mRNA. ( A ) Strategy for making synthetic YOL047c transcript. The YOL047c gene contains a single 63-nt intron near the 5′ end of the gene. Dashed lines indicate boundaries of the splicing reporter. The 128-nt splicing reporter contains 35 nt of exon 1, the entire intron (branch point nucleotide, BP), and 30 nt of exon 2. Synthetic oligoribonucleotides (labeled A, B, C) for generating the splicing reporter contain, respectively, the 5′ splice junction, the branch point, and the 3′ splice junction. ( B ) Two-step ligation of transcript (lanes 1 , 2 ). Gel-purified AB product (lane 1 , “AB”) was ligated with oligo C and splint S2, yielding full-length ABC product (lane 2 , “ABC”). One-step ligation of transcript (lanes 3 , 4 ). All three RNA oligonucleotides and both splints were incubated in a single reaction. Reactions were treated with DNAse I after ligation, so no splints are visible.

Techniques Used: Ligation, Labeling, Purification, Incubation

12) Product Images from "CLIP-seq to identify KSHV ORF57-binding RNA in host B cells"

Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells

Journal: Current protocols in microbiology

doi: 10.1002/cpmc.3

Optimization of ORF57 immunoprecipitation and RNase digestion. (A) ORF57-RNA complexes were immunoprecipitated by a rabbit anti-ORF57 antibody from cells extract of BCBL-1 cells treated with valproic acid for 24 h (input), normal rabbit IgG served as a negative control. The levels of ORF57 in input (1%) and immunoprecipitates (3%) in CLIP experiment were detected by Western blot with mouse anti-ORF57 antibody detecting both full-length ORF57 protein (upper band) and its caspase-cleavage product (lower band). (B) To determine an optimal RNase digestion condition, the immunoprecipitated ORF57 complexes were incubated with various amounts of RNase A/T1 mix for 5 sec at room temperature and followed by proteinase K treatment and RNA extraction. The RNase A/T1 digestion efficiency was checked by RT-PCR for the remaining KSHV PAN RNA, a known ORF57 target.
Figure Legend Snippet: Optimization of ORF57 immunoprecipitation and RNase digestion. (A) ORF57-RNA complexes were immunoprecipitated by a rabbit anti-ORF57 antibody from cells extract of BCBL-1 cells treated with valproic acid for 24 h (input), normal rabbit IgG served as a negative control. The levels of ORF57 in input (1%) and immunoprecipitates (3%) in CLIP experiment were detected by Western blot with mouse anti-ORF57 antibody detecting both full-length ORF57 protein (upper band) and its caspase-cleavage product (lower band). (B) To determine an optimal RNase digestion condition, the immunoprecipitated ORF57 complexes were incubated with various amounts of RNase A/T1 mix for 5 sec at room temperature and followed by proteinase K treatment and RNA extraction. The RNase A/T1 digestion efficiency was checked by RT-PCR for the remaining KSHV PAN RNA, a known ORF57 target.

Techniques Used: Immunoprecipitation, Negative Control, Cross-linking Immunoprecipitation, Western Blot, Incubation, Size-exclusion Chromatography, RNA Extraction, Reverse Transcription Polymerase Chain Reaction

13) Product Images from "Single prokaryotic cell isolation and total transcript amplification protocol for transcriptomic analysis"

Article Title: Single prokaryotic cell isolation and total transcript amplification protocol for transcriptomic analysis

Journal: Nature protocols

doi: 10.1038/nprot.2015.058

Process of single cell isolation using LCM (Step 4). ( a ) Zeiss Laser Capture Microdissection (P.A.L.M.) system used. ( b, c , followed by step 3A in this protocol (Live/Dead® BacLight stain, paraformaldehyde fixation, and spreading on to membrane slide). Fluorescent bacteria were observed under 1000x oil immersion objective lens. DIC and fluorescence image overlays before ( b ) and after ( c ) single-cell laser micro-dissection and catapulting. Black bars equal 10 μm.
Figure Legend Snippet: Process of single cell isolation using LCM (Step 4). ( a ) Zeiss Laser Capture Microdissection (P.A.L.M.) system used. ( b, c , followed by step 3A in this protocol (Live/Dead® BacLight stain, paraformaldehyde fixation, and spreading on to membrane slide). Fluorescent bacteria were observed under 1000x oil immersion objective lens. DIC and fluorescence image overlays before ( b ) and after ( c ) single-cell laser micro-dissection and catapulting. Black bars equal 10 μm.

Techniques Used: Single-cell Isolation, Laser Capture Microdissection, Staining, Fluorescence, Dissection

14) Product Images from "Extract of Nippostrongylus brasiliensis Stimulates Polyclonal Type-2 Immunoglobulin Response by Inducing De Novo Class Switch"

Article Title: Extract of Nippostrongylus brasiliensis Stimulates Polyclonal Type-2 Immunoglobulin Response by Inducing De Novo Class Switch

Journal: Infection and Immunity

doi:

AWH-induced IgG1 production is associated with an increase in the number of IgG1-switched cells. Genomic DNA was isolated from either the TSI-18 and IB4 hybridomas (A) or the spleen cells of mice treated with either AWH, worms ( Nb ), or FIA (B) as described in Materials and Methods. The DNA was digested with Eco RI, ligated with T4 DNA ligase, and amplified by PCR using primers specific for the recombined switch regions. nAChRe levels in all samples were also determined by DC-PCR to control for equal template loading and allow semiquantitation (comparison) of the Sμ-Sγ1 product. PCR amplicons were resolved on a 1.5% agarose gel with ethidium bromide staining. Results are representative of six experiments. (A) Lane 1, TSI-18 (IgG1-producing hybridoma); lane 2, IB4 (IgG2a-producing hybridoma); lane 3, no DNA (control for PCR contamination); lane 4, TSI-18 (nAChRe amplicon from IgG1-producing hybridoma).
Figure Legend Snippet: AWH-induced IgG1 production is associated with an increase in the number of IgG1-switched cells. Genomic DNA was isolated from either the TSI-18 and IB4 hybridomas (A) or the spleen cells of mice treated with either AWH, worms ( Nb ), or FIA (B) as described in Materials and Methods. The DNA was digested with Eco RI, ligated with T4 DNA ligase, and amplified by PCR using primers specific for the recombined switch regions. nAChRe levels in all samples were also determined by DC-PCR to control for equal template loading and allow semiquantitation (comparison) of the Sμ-Sγ1 product. PCR amplicons were resolved on a 1.5% agarose gel with ethidium bromide staining. Results are representative of six experiments. (A) Lane 1, TSI-18 (IgG1-producing hybridoma); lane 2, IB4 (IgG2a-producing hybridoma); lane 3, no DNA (control for PCR contamination); lane 4, TSI-18 (nAChRe amplicon from IgG1-producing hybridoma).

Techniques Used: Isolation, Mouse Assay, Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining

15) Product Images from "Translational control and target recognition by Escherichia coli small RNAs in vivo"

Article Title: Translational control and target recognition by Escherichia coli small RNAs in vivo

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkl1040

E.coli as a host to assay heterologous sRNA/target interactions. ( A ) Alignments of E.coli and V.cholerae RyhB RNA and sodB fusion mRNA (the cloned sodB DNA fragment is shown). Sequence information is based on (20,21,63). Note that the native +1 site of sodB mRNA in V.cholerae is unknown (B. Davis and M. K. Waldor, personal communication). The nucleotides of the RyhB/ sodB pairing regions, as experimentally determined for E.coli (21), are boxed. Note that a different interaction has been proposed for the Vibrio RyhB/ sodB pair (63). The sodB coding region is set in boldface. ( B ) Western blot detection of GFP and SodB::GFP fusion proteins from E.coli strains that expressed GFP (control plasmid pXG-1), a V.cholerae sodB fusion, or the E.coli sodB fusion, each in combination with the control plasmid pJV300 (−), the V.cholerae RyhB (V) or the E.coli RyhB (E) expression plasmid. Samples were taken at an OD 600 of 1.
Figure Legend Snippet: E.coli as a host to assay heterologous sRNA/target interactions. ( A ) Alignments of E.coli and V.cholerae RyhB RNA and sodB fusion mRNA (the cloned sodB DNA fragment is shown). Sequence information is based on (20,21,63). Note that the native +1 site of sodB mRNA in V.cholerae is unknown (B. Davis and M. K. Waldor, personal communication). The nucleotides of the RyhB/ sodB pairing regions, as experimentally determined for E.coli (21), are boxed. Note that a different interaction has been proposed for the Vibrio RyhB/ sodB pair (63). The sodB coding region is set in boldface. ( B ) Western blot detection of GFP and SodB::GFP fusion proteins from E.coli strains that expressed GFP (control plasmid pXG-1), a V.cholerae sodB fusion, or the E.coli sodB fusion, each in combination with the control plasmid pJV300 (−), the V.cholerae RyhB (V) or the E.coli RyhB (E) expression plasmid. Samples were taken at an OD 600 of 1.

Techniques Used: Sequencing, Western Blot, Plasmid Preparation, Expressing

16) Product Images from "Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides"

Article Title: Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides

Journal: Nucleic Acids Research

doi: 10.1093/nar/gku1317

Size-exclusion HPLC chromatograms for individual RNA species. BCG total RNA was resolved on an Agilent Bio Size Exclusion Column SEC5, 1000 Å ( A ), or on an Agilent Bio Size Exclusion Column SEC3, 300 Å ( B ). Panels (A) and (B) are representative of six independent HPLC runs. ( C ) Cellular quantities of 5S, 16S and 23S rRNA and tRNA species based on HPLC UV absorbance interpolated from a standard curve based on purified human 28S rRNa. An asterisk indicates a significant difference in the quantity of RNA from exponentially growing cells compared to hypoxic cells on day 21 (unpaired T-test, P ≤ 0.05). Data represent mean ± SD for three biological replicates.
Figure Legend Snippet: Size-exclusion HPLC chromatograms for individual RNA species. BCG total RNA was resolved on an Agilent Bio Size Exclusion Column SEC5, 1000 Å ( A ), or on an Agilent Bio Size Exclusion Column SEC3, 300 Å ( B ). Panels (A) and (B) are representative of six independent HPLC runs. ( C ) Cellular quantities of 5S, 16S and 23S rRNA and tRNA species based on HPLC UV absorbance interpolated from a standard curve based on purified human 28S rRNa. An asterisk indicates a significant difference in the quantity of RNA from exponentially growing cells compared to hypoxic cells on day 21 (unpaired T-test, P ≤ 0.05). Data represent mean ± SD for three biological replicates.

Techniques Used: High Performance Liquid Chromatography, Purification

17) Product Images from "Purifying mRNAs with a high-affinity eIF4E mutant identifies the short 3? poly(A) end phenotype"

Article Title: Purifying mRNAs with a high-affinity eIF4E mutant identifies the short 3? poly(A) end phenotype

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.1232347100

( A ) Relative ability of GST-4E wild-type and GST-4E K119A to bind 5′ capped mRNA. Batch mRNA-binding assays were performed to compare binding affinities of GST-4E wild-type and GST-4E K119A . 5′ capped 32 P-labeled mRNA was incubated in binding buffer with increasing amounts of GST-4E wild-type and GST-4E K119A bound to agarose beads (see Materials and Methods ). The quantity of mRNA bound to GST-4E agarose beads was measured by Cerenkov counts. The estimated dissociation constants ( K d ) of GST-4E wild-type and GST-4E K119A were 0.15 and 0.06 nM for capped mRNA, respectively. ( B ) Specificity of GST-4E K119A for 5′ capped mRNA. The batch purification of mRNA using GST-4E K119A was tested for its ability to bind both 5′ capped and uncapped mRNAs. Capped and uncapped mRNA synthesized in vitro using T7 polymerase were mixed with GST-4E K119A agarose beads (50 μl), washed with 1× binding buffer, 500 μM GDP, and eluted with 1 mM m 7 GDP (see Materials and Methods ). mRNA that remained bound to GST-4E beads despite the m 7 GDP elution step was recovered by extraction with acid phenol/chloroform. mRNA isolated by using GST-4E K119A agarose beads are shown for purifications where 5′ capped (10–30%) and uncapped mRNA were used as starting material. mRNA present in each fraction was precipitated with ethanol and analyzed by 7 M urea/polyacrylamide (6%) gel electrophoresis and autoradiography. As determined by Cerenkov counts, the 1 mM m 7 GDP eluant (capped mRNA, lane 7) contained 85% of the total RNA recovered from the GST-4E K119A beads. The arrow indicates the size of the mRNA (50 nt) used as starting material.
Figure Legend Snippet: ( A ) Relative ability of GST-4E wild-type and GST-4E K119A to bind 5′ capped mRNA. Batch mRNA-binding assays were performed to compare binding affinities of GST-4E wild-type and GST-4E K119A . 5′ capped 32 P-labeled mRNA was incubated in binding buffer with increasing amounts of GST-4E wild-type and GST-4E K119A bound to agarose beads (see Materials and Methods ). The quantity of mRNA bound to GST-4E agarose beads was measured by Cerenkov counts. The estimated dissociation constants ( K d ) of GST-4E wild-type and GST-4E K119A were 0.15 and 0.06 nM for capped mRNA, respectively. ( B ) Specificity of GST-4E K119A for 5′ capped mRNA. The batch purification of mRNA using GST-4E K119A was tested for its ability to bind both 5′ capped and uncapped mRNAs. Capped and uncapped mRNA synthesized in vitro using T7 polymerase were mixed with GST-4E K119A agarose beads (50 μl), washed with 1× binding buffer, 500 μM GDP, and eluted with 1 mM m 7 GDP (see Materials and Methods ). mRNA that remained bound to GST-4E beads despite the m 7 GDP elution step was recovered by extraction with acid phenol/chloroform. mRNA isolated by using GST-4E K119A agarose beads are shown for purifications where 5′ capped (10–30%) and uncapped mRNA were used as starting material. mRNA present in each fraction was precipitated with ethanol and analyzed by 7 M urea/polyacrylamide (6%) gel electrophoresis and autoradiography. As determined by Cerenkov counts, the 1 mM m 7 GDP eluant (capped mRNA, lane 7) contained 85% of the total RNA recovered from the GST-4E K119A beads. The arrow indicates the size of the mRNA (50 nt) used as starting material.

Techniques Used: Binding Assay, Labeling, Incubation, Purification, Synthesized, In Vitro, Isolation, Nucleic Acid Electrophoresis, Autoradiography

18) Product Images from "Practical Synthesis of Cap‐4 RNA"

Article Title: Practical Synthesis of Cap‐4 RNA

Journal: Chembiochem

doi: 10.1002/cbic.201900590

Enzymatic ligation of T. cruzi cap‐4 spliced leader RNA using T4 DNA ligase. A) RNA sequences and sequence of the 20‐nt DNA splint; B) HPLC analysis of a typical ligation reaction after 3 h reaction time; reaction conditions: 10 μ m RNA 10 , 12.5 μ m RNA 11 , 12.5 μ m splint; 0.5 m m ATP, 40 m m Tris ⋅ HCl (pH 7.8), 10 m m MgCl 2 , 10 m m DTT, 5 % ( w / v ) PEG 4000, 0.5 U μL −1 T4 DNA ligase; C) LC–ESI mass spectrum of the purified 39‐nt cap‐4 RNA ligation product.
Figure Legend Snippet: Enzymatic ligation of T. cruzi cap‐4 spliced leader RNA using T4 DNA ligase. A) RNA sequences and sequence of the 20‐nt DNA splint; B) HPLC analysis of a typical ligation reaction after 3 h reaction time; reaction conditions: 10 μ m RNA 10 , 12.5 μ m RNA 11 , 12.5 μ m splint; 0.5 m m ATP, 40 m m Tris ⋅ HCl (pH 7.8), 10 m m MgCl 2 , 10 m m DTT, 5 % ( w / v ) PEG 4000, 0.5 U μL −1 T4 DNA ligase; C) LC–ESI mass spectrum of the purified 39‐nt cap‐4 RNA ligation product.

Techniques Used: Ligation, Sequencing, High Performance Liquid Chromatography, Purification

19) Product Images from "Duality of polynucleotide substrates for Phi29 DNA polymerase: 3′→5′ RNase activity of the enzyme"

Article Title: Duality of polynucleotide substrates for Phi29 DNA polymerase: 3′→5′ RNase activity of the enzyme

Journal: RNA

doi: 10.1261/rna.622108

The polarity of Phi29 DNA polymerase exoribonuclease activity. RNA hydrolysis studies were carried out under the conditions described in “Materials and Methods,” using 5′-end labeled ( A ) or 3′-end labeled ( B ) RNA1 oligonucleotides
Figure Legend Snippet: The polarity of Phi29 DNA polymerase exoribonuclease activity. RNA hydrolysis studies were carried out under the conditions described in “Materials and Methods,” using 5′-end labeled ( A ) or 3′-end labeled ( B ) RNA1 oligonucleotides

Techniques Used: Activity Assay, Labeling

3′→5′ Exonucleolytic activity of Phi29 DNA polymerase on RNA and DNA substrates. The experiments were performed under the conditions described in “Materials and Methods,” using 5′-end-labeled 16-mer DNA
Figure Legend Snippet: 3′→5′ Exonucleolytic activity of Phi29 DNA polymerase on RNA and DNA substrates. The experiments were performed under the conditions described in “Materials and Methods,” using 5′-end-labeled 16-mer DNA

Techniques Used: Activity Assay, Labeling

Phi29 DNA polymerase 3′→5′ exoribonuclease activity on the RNA–DNA hybrids. The RNA–DNA hybrid hydrolysis studies were carried out under the conditions described in “Materials and Methods,” using
Figure Legend Snippet: Phi29 DNA polymerase 3′→5′ exoribonuclease activity on the RNA–DNA hybrids. The RNA–DNA hybrid hydrolysis studies were carried out under the conditions described in “Materials and Methods,” using

Techniques Used: Activity Assay

Sequence comparison and active sites superposition of Phi29 DNA polymerase and RNaseT orthologs. ( A ), Escherichia
Figure Legend Snippet: Sequence comparison and active sites superposition of Phi29 DNA polymerase and RNaseT orthologs. ( A ), Escherichia

Techniques Used: Sequencing

The target RNA conversion into a primer for RCA. The experiments ( A ) were performed under the conditions described in “Materials and Methods.” The 5′-end-labeled RNA1–DNA hybrids were incubated with Phi29 DNA polymerase
Figure Legend Snippet: The target RNA conversion into a primer for RCA. The experiments ( A ) were performed under the conditions described in “Materials and Methods.” The 5′-end-labeled RNA1–DNA hybrids were incubated with Phi29 DNA polymerase

Techniques Used: Labeling, Incubation

( A ) Sequencing of Phi29 DNA polymerase 3′→5′ exoribonuclecleolytic degradation products. The experiments were performed under the conditions described in “Materials and Methods.” The RNA degradation products of
Figure Legend Snippet: ( A ) Sequencing of Phi29 DNA polymerase 3′→5′ exoribonuclecleolytic degradation products. The experiments were performed under the conditions described in “Materials and Methods.” The RNA degradation products of

Techniques Used: Sequencing

20) Product Images from "In Vitro Selection of Proteins with Desired Characteristics Using mRNA-display"

Article Title: In Vitro Selection of Proteins with Desired Characteristics Using mRNA-display

Journal: Methods (San Diego, Calif.)

doi: 10.1016/j.ymeth.2012.11.004

Identification of two granzyme B substrates by using a selection procedure that allows the identification of family member specific substrates. Prior to selection, the mRNA-displayed proteome library is immobilized on a streptavidin-agarose matrix and cleaved with other caspase members to remove the overlapping substrates. After stringent washing, the pre-cleared proteome library was used to enrich for the family member-specific substrates that are cleaved by the protease of interest, in this case, granzyme B (GB). The numbers 1 to 10 indicate the caspase used in the proteolytic assay. Caspase-10a and 10b refer the two isoforms of caspase-10. The 35 S-labeled full-length proteins are shown below (arrow).
Figure Legend Snippet: Identification of two granzyme B substrates by using a selection procedure that allows the identification of family member specific substrates. Prior to selection, the mRNA-displayed proteome library is immobilized on a streptavidin-agarose matrix and cleaved with other caspase members to remove the overlapping substrates. After stringent washing, the pre-cleared proteome library was used to enrich for the family member-specific substrates that are cleaved by the protease of interest, in this case, granzyme B (GB). The numbers 1 to 10 indicate the caspase used in the proteolytic assay. Caspase-10a and 10b refer the two isoforms of caspase-10. The 35 S-labeled full-length proteins are shown below (arrow).

Techniques Used: Selection, Labeling

Sample selection types. Schematic representation of the selection procedure for the natural substrates of a protease of interest from an mRNA-displayed proteome library (Option A). Schematic representation of the selection procedure for the binding partners of a target of interest from an mRNA-displayed proteome library (Option B). mRNA, blue; DNA, black; protein, orange; puromycin, pink circle labeled with a P; biotin, black circle labeled with a B; streptavidin, black circle labeled with an S; agarose beads, yellow circle labeled as agarose; protease, black scissors; target protein, red.
Figure Legend Snippet: Sample selection types. Schematic representation of the selection procedure for the natural substrates of a protease of interest from an mRNA-displayed proteome library (Option A). Schematic representation of the selection procedure for the binding partners of a target of interest from an mRNA-displayed proteome library (Option B). mRNA, blue; DNA, black; protein, orange; puromycin, pink circle labeled with a P; biotin, black circle labeled with a B; streptavidin, black circle labeled with an S; agarose beads, yellow circle labeled as agarose; protease, black scissors; target protein, red.

Techniques Used: Selection, Binding Assay, Labeling

21) Product Images from "Delineation of the Exact Transcription Termination Signal for Type 3 Polymerase III"

Article Title: Delineation of the Exact Transcription Termination Signal for Type 3 Polymerase III

Journal: Molecular Therapy. Nucleic Acids

doi: 10.1016/j.omtn.2017.11.006

Mapping the Pol III Termination Site in the U6 System (A) The GeneScan procedure to map the termination site. Two days after transfection of HEK293T cells, total RNA was harvested. Total cellular RNA was ligated to a 3′ adaptor and then reverse transcribed using an adaptor primer. The 5′ FAM forward primer and the adaptor primer are subsequently used for PCR, and the resulting products together with a size marker are subjected to GeneScan, which measures the FAM fluorescence and provides a signal with a resolution of 1 nt. (B) The GeneScan output. The control yields a single peak of the size expected for the termination at the T1 position. Each peak represents the termination activity at the corresponding T position. (C) Quantitation of the signals in (B). All results were reproduced in two independent experiments with similar trends.
Figure Legend Snippet: Mapping the Pol III Termination Site in the U6 System (A) The GeneScan procedure to map the termination site. Two days after transfection of HEK293T cells, total RNA was harvested. Total cellular RNA was ligated to a 3′ adaptor and then reverse transcribed using an adaptor primer. The 5′ FAM forward primer and the adaptor primer are subsequently used for PCR, and the resulting products together with a size marker are subjected to GeneScan, which measures the FAM fluorescence and provides a signal with a resolution of 1 nt. (B) The GeneScan output. The control yields a single peak of the size expected for the termination at the T1 position. Each peak represents the termination activity at the corresponding T position. (C) Quantitation of the signals in (B). All results were reproduced in two independent experiments with similar trends.

Techniques Used: Transfection, Polymerase Chain Reaction, Marker, Fluorescence, Activity Assay, Quantitation Assay

22) Product Images from "The RNA methyltransferase Dnmt2 methylates DNA in the structural context of a tRNA"

Article Title: The RNA methyltransferase Dnmt2 methylates DNA in the structural context of a tRNA

Journal: RNA Biology

doi: 10.1080/15476286.2016.1236170

Methylation of an RNA-guided DNA oligonucleotide by Dnmt2. (A) Structure of the hybridized construct. DNA shown in red. (B) Average values and standard deviations of 3 tritium incorporation assays are shown.
Figure Legend Snippet: Methylation of an RNA-guided DNA oligonucleotide by Dnmt2. (A) Structure of the hybridized construct. DNA shown in red. (B) Average values and standard deviations of 3 tritium incorporation assays are shown.

Techniques Used: Methylation, Construct

(A) Two-dimensional thin-layer chromatography of nucleosides on a 10 cm x 10 cm cellulose TLC plate. The starting point is marked by an X. (B) Methylation of an RNA-guided DNA oligonucleotide by Dnmt2. The oligonucleotides were hydrolyzed to nucleosides after the tritium incorporation assay, separated by 2D thin-layer chromatography and analyzed with the Cherenkov counter. Tritium could only be detected in m 5 dC. Average values and standard deviations of 3 experiments are shown. Control corresponds to background signal of the TLC plate. Note that an identical Fig. S4 with enhanced contrast can be found in the supplement.
Figure Legend Snippet: (A) Two-dimensional thin-layer chromatography of nucleosides on a 10 cm x 10 cm cellulose TLC plate. The starting point is marked by an X. (B) Methylation of an RNA-guided DNA oligonucleotide by Dnmt2. The oligonucleotides were hydrolyzed to nucleosides after the tritium incorporation assay, separated by 2D thin-layer chromatography and analyzed with the Cherenkov counter. Tritium could only be detected in m 5 dC. Average values and standard deviations of 3 experiments are shown. Control corresponds to background signal of the TLC plate. Note that an identical Fig. S4 with enhanced contrast can be found in the supplement.

Techniques Used: Thin Layer Chromatography, Methylation

23) Product Images from "RNA topoisomerase is prevalent in all domains of life and associates with polyribosomes in animals"

Article Title: RNA topoisomerase is prevalent in all domains of life and associates with polyribosomes in animals

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkw508

Type IA topoisomerases have evolved from enzymes with dual activities in microorganisms to multi-protein complexes with distinct functions in animals; RNA topoisomerases may originate in the RNA world and are conserved through evolution. ( A ) Schematic representation of evolution of Type IA topoisomerases in DNA and RNA metabolism. In E. coli , both Type IA enzymes (Top1 and Top3) have dual activities that can catalyze topoisomerase reactions on DNA and RNA. In yeast, the only Type IA enzyme is part of a complex (Top3-Rmi1) that also has dual activities for DNA and RNA. In human, only one of the two Type IA paralogs, Top3β, has RNA topoisomerase activity, whereas Top3α does not. Interestingly, Top3β, but not Top3α, has acquired during evolution a bona fide RNA-binding domain (RGG box) that is required for its RNA topoisomerase activity. Moreover, the two Top3 paralogs comprise two distinct complexes, with the Top3β complex containing a RNA binding protein (FMRP), whereas the Top3α complex containing a DNA helicase (BLM). These data argue that Type IA topoisomerases have evolved into two functional distinct complexes in animals, one for RNA and DNA (Top3β-TDRD3-FMRP), and one for DNA only (Top3α-Rmi1-Rmi2-BLM). ( B ) A model of origin and evolution of Type IA topoisomerases and their activity for RNA and DNA. It has been postulated that life starts with a pool of self-replicating RNAs; and there exists an RNA world with RNA genome prior to the current DNA world. We propose that Type IA enzymes may originate in the RNA world to solve topological problems during RNA metabolism. When the RNA world evolved and was eventually replaced by the DNA world, many of these enzymes retained their RNA topoisomerase activity while developing a new activity for DNA. This may explain the prevalence of the RNA topoisomerase activity in Type IA enzymes from all three domains.
Figure Legend Snippet: Type IA topoisomerases have evolved from enzymes with dual activities in microorganisms to multi-protein complexes with distinct functions in animals; RNA topoisomerases may originate in the RNA world and are conserved through evolution. ( A ) Schematic representation of evolution of Type IA topoisomerases in DNA and RNA metabolism. In E. coli , both Type IA enzymes (Top1 and Top3) have dual activities that can catalyze topoisomerase reactions on DNA and RNA. In yeast, the only Type IA enzyme is part of a complex (Top3-Rmi1) that also has dual activities for DNA and RNA. In human, only one of the two Type IA paralogs, Top3β, has RNA topoisomerase activity, whereas Top3α does not. Interestingly, Top3β, but not Top3α, has acquired during evolution a bona fide RNA-binding domain (RGG box) that is required for its RNA topoisomerase activity. Moreover, the two Top3 paralogs comprise two distinct complexes, with the Top3β complex containing a RNA binding protein (FMRP), whereas the Top3α complex containing a DNA helicase (BLM). These data argue that Type IA topoisomerases have evolved into two functional distinct complexes in animals, one for RNA and DNA (Top3β-TDRD3-FMRP), and one for DNA only (Top3α-Rmi1-Rmi2-BLM). ( B ) A model of origin and evolution of Type IA topoisomerases and their activity for RNA and DNA. It has been postulated that life starts with a pool of self-replicating RNAs; and there exists an RNA world with RNA genome prior to the current DNA world. We propose that Type IA enzymes may originate in the RNA world to solve topological problems during RNA metabolism. When the RNA world evolved and was eventually replaced by the DNA world, many of these enzymes retained their RNA topoisomerase activity while developing a new activity for DNA. This may explain the prevalence of the RNA topoisomerase activity in Type IA enzymes from all three domains.

Techniques Used: IA, Activity Assay, RNA Binding Assay, Functional Assay

24) Product Images from "Isolation and genome-wide characterization of cellular DNA:RNA triplex structures"

Article Title: Isolation and genome-wide characterization of cellular DNA:RNA triplex structures

Journal: Nucleic Acids Research

doi: 10.1093/nar/gky1305

Identification and global characterization of DNA-associated RNA. ( A ) Scatter plots showing the correlation between TriplexRNA isolated by DNA-IP and SPRI selection (left) and TriplexRNA (DNA-IP) and control RNA (middle, right). Pearson correlation coefficient ( R ) across 7148 genes overlapping peaks is shown. Green diagonal line x = y . Some representative genes that overlap TriplexRNAs and control RNAs are highlighted. ( B ) Pie charts depicting the genomic distribution of TriplexRNA (DNA-IP) compared to chromatin-associated and nuclear RNA peaks, excluding intronic and exonic gene regions. Upstream and downstream regions are defined within 2.5 kb proximity of the closest gene. ( C ) Pie chart showing classification of long noncoding RNAs that overlap TriplexRNA (DNA-IP), chromatin-associated and nuclear RNA. ( D ) Association of TriplexRNA (DNA-IP) and control RNA with ChromHMM promoter states and transcribed states. Active transcription start site (TssA), flanking active TSS (TssAFlnk), strong (Tx) and weak (TxWk) transcription regions are shown. ( E ) Left: Overlap of TriplexRNA (DNA-IP), chromatin-associated RNA and nuclear RNA with different classes of repeat elements. Right: Abundance of simple repeat subclasses. ( F ) Abundance of TriplexRNA (DNA-IP) and control RNAs overlapping super-enhancers in HeLa S3 cells. Data are from HeLa S3 cells. Adjusted P -values
Figure Legend Snippet: Identification and global characterization of DNA-associated RNA. ( A ) Scatter plots showing the correlation between TriplexRNA isolated by DNA-IP and SPRI selection (left) and TriplexRNA (DNA-IP) and control RNA (middle, right). Pearson correlation coefficient ( R ) across 7148 genes overlapping peaks is shown. Green diagonal line x = y . Some representative genes that overlap TriplexRNAs and control RNAs are highlighted. ( B ) Pie charts depicting the genomic distribution of TriplexRNA (DNA-IP) compared to chromatin-associated and nuclear RNA peaks, excluding intronic and exonic gene regions. Upstream and downstream regions are defined within 2.5 kb proximity of the closest gene. ( C ) Pie chart showing classification of long noncoding RNAs that overlap TriplexRNA (DNA-IP), chromatin-associated and nuclear RNA. ( D ) Association of TriplexRNA (DNA-IP) and control RNA with ChromHMM promoter states and transcribed states. Active transcription start site (TssA), flanking active TSS (TssAFlnk), strong (Tx) and weak (TxWk) transcription regions are shown. ( E ) Left: Overlap of TriplexRNA (DNA-IP), chromatin-associated RNA and nuclear RNA with different classes of repeat elements. Right: Abundance of simple repeat subclasses. ( F ) Abundance of TriplexRNA (DNA-IP) and control RNAs overlapping super-enhancers in HeLa S3 cells. Data are from HeLa S3 cells. Adjusted P -values

Techniques Used: Isolation, Selection

NEAT1 forms triplexes at numerous genomic sites. ( A ) NEAT1 profiles in TriplexRNA-seq (DNA-IP) (red) and nuclear RNA (blue) from HeLa S3 and U2OS cells with shaded TFR1 and TFR2. Minus (-) and plus (+) strands are shown. The position and sequence of NEAT1-TFR1 and -TFR2 are shown below. ( B ) EMSAs using 10 or 100 pmol of synthetic NEAT1 versions comprising TFR1 (40 or 52 nt) or TFR2 incubated with 0.25 pmol of double–stranded 32 P-labeled oligonucleotides which harbor sequences of NEAT1 target genes predicted from CHART-seq ( Supplementary Table S2 ). Reactions marked with an asterisk (*) were treated with 0.5 U RNase H. As a control, RNA without a putative TFR was used. Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). ( C ) Schematic depiction of the TFR-based capture assay. Biotinylated RNA oligos covering NEAT1-TFR1 and NEAT1-TFR2 were used to capture genomic DNA. ( D ) MEME motif analysis identifying consensus motifs in DNA captured by NEAT1-TFR1 (399 of top 500 peaks) and by NEAT1-TFR2 (500 of top 500 peaks ranked by peak P -value). Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). ( E ) TDF analysis of the triplex-forming potential of NEAT1-TFR1 and NEAT1-TFR2 RNAs with top 500 TFR-associated and control DNA peaks (ranked by peak P -value) compared to 500 randomized regions ( N = 1000, colored grey). P -values were obtained from one-tailed Mann–Whitney test. ( F ) Scheme presenting antisense oligo (ASO)-based capture of NEAT1-associated DNA. ( G ) Consensus motif in NEAT1-associated DNA sites (314 of top 500 peaks ranked by peak P -value). ( H ) TDF analysis predicting the triplex-forming potential of NEAT1 on ASO-captured DNA regions. Significant TFRs along NEAT1 are shown in orange, the number of target sites (DBS) for each TFR in purple. For TFR- and ASO-based capture assays nucleic acids isolated from HeLa S3 chromatin were used.
Figure Legend Snippet: NEAT1 forms triplexes at numerous genomic sites. ( A ) NEAT1 profiles in TriplexRNA-seq (DNA-IP) (red) and nuclear RNA (blue) from HeLa S3 and U2OS cells with shaded TFR1 and TFR2. Minus (-) and plus (+) strands are shown. The position and sequence of NEAT1-TFR1 and -TFR2 are shown below. ( B ) EMSAs using 10 or 100 pmol of synthetic NEAT1 versions comprising TFR1 (40 or 52 nt) or TFR2 incubated with 0.25 pmol of double–stranded 32 P-labeled oligonucleotides which harbor sequences of NEAT1 target genes predicted from CHART-seq ( Supplementary Table S2 ). Reactions marked with an asterisk (*) were treated with 0.5 U RNase H. As a control, RNA without a putative TFR was used. Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). ( C ) Schematic depiction of the TFR-based capture assay. Biotinylated RNA oligos covering NEAT1-TFR1 and NEAT1-TFR2 were used to capture genomic DNA. ( D ) MEME motif analysis identifying consensus motifs in DNA captured by NEAT1-TFR1 (399 of top 500 peaks) and by NEAT1-TFR2 (500 of top 500 peaks ranked by peak P -value). Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). ( E ) TDF analysis of the triplex-forming potential of NEAT1-TFR1 and NEAT1-TFR2 RNAs with top 500 TFR-associated and control DNA peaks (ranked by peak P -value) compared to 500 randomized regions ( N = 1000, colored grey). P -values were obtained from one-tailed Mann–Whitney test. ( F ) Scheme presenting antisense oligo (ASO)-based capture of NEAT1-associated DNA. ( G ) Consensus motif in NEAT1-associated DNA sites (314 of top 500 peaks ranked by peak P -value). ( H ) TDF analysis predicting the triplex-forming potential of NEAT1 on ASO-captured DNA regions. Significant TFRs along NEAT1 are shown in orange, the number of target sites (DBS) for each TFR in purple. For TFR- and ASO-based capture assays nucleic acids isolated from HeLa S3 chromatin were used.

Techniques Used: Sequencing, Incubation, Labeling, One-tailed Test, MANN-WHITNEY, Allele-specific Oligonucleotide, Isolation

Enrichment of triplex-forming RNAs. ( A ) Schematic overview of the method to enrich DNA-associated RNA. ( B ) RT-qPCR monitoring the indicated RNAs recovered from HeLa S3 cells, nuclei and purified chromatin. Values are normalized to cellular RNA (±SEM, N = 3). ( C ) Polyacrylamide gel electrophoresis of 5′-labeled RNA enriched by SPRI-size selection. Control samples were treated with DNase I before size selection or with RNase A before gel loading. ( D ) RT-qPCR analysis of DNA-associated RNA from HeLa S3 cells isolated by SPRI-size selection. Values are normalized to cellular RNA. Control samples were treated with DNase I before size selection (±SEM, N = 3). ( E ) RNA-seq profiles for KHPS1 in DNA-associated RNAs (DNA-IP) and nuclear RNA from U2OS cells. The overlap with the TFR of KHPS1 is shaded. Minus (–) and plus (+) strands are shown.
Figure Legend Snippet: Enrichment of triplex-forming RNAs. ( A ) Schematic overview of the method to enrich DNA-associated RNA. ( B ) RT-qPCR monitoring the indicated RNAs recovered from HeLa S3 cells, nuclei and purified chromatin. Values are normalized to cellular RNA (±SEM, N = 3). ( C ) Polyacrylamide gel electrophoresis of 5′-labeled RNA enriched by SPRI-size selection. Control samples were treated with DNase I before size selection or with RNase A before gel loading. ( D ) RT-qPCR analysis of DNA-associated RNA from HeLa S3 cells isolated by SPRI-size selection. Values are normalized to cellular RNA. Control samples were treated with DNase I before size selection (±SEM, N = 3). ( E ) RNA-seq profiles for KHPS1 in DNA-associated RNAs (DNA-IP) and nuclear RNA from U2OS cells. The overlap with the TFR of KHPS1 is shaded. Minus (–) and plus (+) strands are shown.

Techniques Used: Quantitative RT-PCR, Purification, Polyacrylamide Gel Electrophoresis, Labeling, Selection, Isolation, RNA Sequencing Assay

Isolation and identification of RNA-associated DNAs. ( A ) Scheme illustrating the method used to isolate RNA-associated DNA (TriplexDNA). ( B ) Pie chart depicting the genomic distribution of TriplexDNA peaks. Upstream and downstream regions are defined within 2.5 kb proximity of the closest gene. The bar diagrams at the right display the fold change in the distribution of the respective regions in TriplexDNA compared to control DNA. ( C ) Line plots depicting the mean values of TriplexDNA-seq signals over TSS and TTS of 890 genes that overlap RNA-associated DNA peaks. Interval defined by maximum and minimum values is shaded. ( D ) TriplexDNA-seq regions overlapping DNase Hypersensitive Sites (DNase HS) in HeLa S3 cells provided by ENCODE. ( E ) Abundance of TriplexDNA regions associated with the indicated ChromHMM states. Active transcription start site (TssA), flanking active TSS (TssAFlnk), strong and weak (Tx, TxWk) transcription, heterochromatin (Het) and Polycomb-repressed (RepPC) regions are shown. ( F ) Top: Overlap of TriplexDNA and control DNA with different classes of repeat elements. Bottom: Abundance of predominating repeat subclasses in TriplexDNA. (G) MEME motif analysis identifying purine-rich consensus motifs in randomly selected 500 TriplexDNA peaks. Data are from HeLa S3 cells. Adjusted P -values
Figure Legend Snippet: Isolation and identification of RNA-associated DNAs. ( A ) Scheme illustrating the method used to isolate RNA-associated DNA (TriplexDNA). ( B ) Pie chart depicting the genomic distribution of TriplexDNA peaks. Upstream and downstream regions are defined within 2.5 kb proximity of the closest gene. The bar diagrams at the right display the fold change in the distribution of the respective regions in TriplexDNA compared to control DNA. ( C ) Line plots depicting the mean values of TriplexDNA-seq signals over TSS and TTS of 890 genes that overlap RNA-associated DNA peaks. Interval defined by maximum and minimum values is shaded. ( D ) TriplexDNA-seq regions overlapping DNase Hypersensitive Sites (DNase HS) in HeLa S3 cells provided by ENCODE. ( E ) Abundance of TriplexDNA regions associated with the indicated ChromHMM states. Active transcription start site (TssA), flanking active TSS (TssAFlnk), strong and weak (Tx, TxWk) transcription, heterochromatin (Het) and Polycomb-repressed (RepPC) regions are shown. ( F ) Top: Overlap of TriplexDNA and control DNA with different classes of repeat elements. Bottom: Abundance of predominating repeat subclasses in TriplexDNA. (G) MEME motif analysis identifying purine-rich consensus motifs in randomly selected 500 TriplexDNA peaks. Data are from HeLa S3 cells. Adjusted P -values

Techniques Used: Isolation

Validation of triplex-forming RNA and DNAs. ( A ) TDF analysis predicting the potential of top 1000 enriched TriplexRNA (DNA-IP) regions (ranked by peak P -value) to bind to active promoters defined by ChromHMM. Number of TFRs in RNA (per kilobase of RNA, left) and the number of putative DBSs at promoters (per kilobase of RNA, right) are shown. Boxplot borders are defined by the 1st and 3rd quantiles of the distributions, the middle line corresponds to the median value. The top whisker denotes the maximum value within the third quartile plus 1.5 times the interquartile range (bottom whisker is defined analogously). Dark gray dots represent outliers with values higher or lower than whiskers. Further box plots are based on the same definitions. ( B ) Motif analysis of triplexes formed between TriplexRNA (DNA-IP) and active promoters. The diagram depicts the fraction of antiparallel and parallel triplexes with the respective motif and nucleotide composition of TFRs in TriplexRNA. ( C ) TDF analysis comparing the triplex-forming potential of top 2000 TriplexDNA-seq regions with top 1000 TriplexRNA (DNA-IP) (ranked by peak P -value). The number of putative DBSs (per kilobase of RNA) is shown. ( D ) Motif analysis of predicted triplexes formed between TriplexRNAs (DNA-IP) and TriplexDNA. The diagram depicts the fraction of antiparallel and parallel triplexes, with the respective motif and nucleotide composition of TFRs in TriplexRNA. ( E ) Box plot classifying triplex interactions between TriplexRNAs (DNA-IP) and TriplexDNA-seq regions as cis ( > 10 kb in the same chromosome) and trans (at different chromosomes) interactions, excluding underrepresented local interactions (within 10 kb distance). ( F ) EMSAs using 10 or 100 pmol of synthetic TriplexRNAs and 0.25 pmol of double–stranded 32 P-labeled oligonucleotides comprising target regions from TriplexDNA ( Supplementary Table S2 ). Reactions marked with an asterisk (*) were treated with 0.5 U RNase H. As a control (C), RNA without a putative TFR was used. Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). TriplexRNA-seq and TriplexDNA-seq data are from HeLa S3 cells. Adjusted P -values
Figure Legend Snippet: Validation of triplex-forming RNA and DNAs. ( A ) TDF analysis predicting the potential of top 1000 enriched TriplexRNA (DNA-IP) regions (ranked by peak P -value) to bind to active promoters defined by ChromHMM. Number of TFRs in RNA (per kilobase of RNA, left) and the number of putative DBSs at promoters (per kilobase of RNA, right) are shown. Boxplot borders are defined by the 1st and 3rd quantiles of the distributions, the middle line corresponds to the median value. The top whisker denotes the maximum value within the third quartile plus 1.5 times the interquartile range (bottom whisker is defined analogously). Dark gray dots represent outliers with values higher or lower than whiskers. Further box plots are based on the same definitions. ( B ) Motif analysis of triplexes formed between TriplexRNA (DNA-IP) and active promoters. The diagram depicts the fraction of antiparallel and parallel triplexes with the respective motif and nucleotide composition of TFRs in TriplexRNA. ( C ) TDF analysis comparing the triplex-forming potential of top 2000 TriplexDNA-seq regions with top 1000 TriplexRNA (DNA-IP) (ranked by peak P -value). The number of putative DBSs (per kilobase of RNA) is shown. ( D ) Motif analysis of predicted triplexes formed between TriplexRNAs (DNA-IP) and TriplexDNA. The diagram depicts the fraction of antiparallel and parallel triplexes, with the respective motif and nucleotide composition of TFRs in TriplexRNA. ( E ) Box plot classifying triplex interactions between TriplexRNAs (DNA-IP) and TriplexDNA-seq regions as cis ( > 10 kb in the same chromosome) and trans (at different chromosomes) interactions, excluding underrepresented local interactions (within 10 kb distance). ( F ) EMSAs using 10 or 100 pmol of synthetic TriplexRNAs and 0.25 pmol of double–stranded 32 P-labeled oligonucleotides comprising target regions from TriplexDNA ( Supplementary Table S2 ). Reactions marked with an asterisk (*) were treated with 0.5 U RNase H. As a control (C), RNA without a putative TFR was used. Potential Hoogsteen base pairing between motifs and respective TFR sequences are shown; mismatches are marked (*). TriplexRNA-seq and TriplexDNA-seq data are from HeLa S3 cells. Adjusted P -values

Techniques Used: Whisker Assay, Labeling

25) Product Images from "MDA-9/syntenin is a key regulator of glioma pathogenesis"

Article Title: MDA-9/syntenin is a key regulator of glioma pathogenesis

Journal: Neuro-Oncology

doi: 10.1093/neuonc/not157

Stable MDA-9/syntenin knockdown in GBM results in decreased invasion, migration, and anchorage-independent growth. (A) MDA-9/syntenin protein levels were decreased by stable expression of sh mda-9 in GBM6 cells. (B) Results from Matrigel invasion of GBM6–sh
Figure Legend Snippet: Stable MDA-9/syntenin knockdown in GBM results in decreased invasion, migration, and anchorage-independent growth. (A) MDA-9/syntenin protein levels were decreased by stable expression of sh mda-9 in GBM6 cells. (B) Results from Matrigel invasion of GBM6–sh

Techniques Used: Multiple Displacement Amplification, Migration, Expressing

MDA-9/syntenin activates NF-κB through an Src, P38MAPK-dependent pathway. (A) Protein expression following overexpression (left columns) or knockdown (right columns) in the indicated cell lines. β-actin is used as an internal control for
Figure Legend Snippet: MDA-9/syntenin activates NF-κB through an Src, P38MAPK-dependent pathway. (A) Protein expression following overexpression (left columns) or knockdown (right columns) in the indicated cell lines. β-actin is used as an internal control for

Techniques Used: Multiple Displacement Amplification, Expressing, Over Expression

MDA-9/syntenin knockdown decreases tumor size in vivo and angiogenesis in vitro. (A) (Left) Tumor volume from subcutaneous injection of GBM6 control and sh mda-9 expressing clones. (Right) Weight of resected subcutaneous tumors after 21 days. a differs
Figure Legend Snippet: MDA-9/syntenin knockdown decreases tumor size in vivo and angiogenesis in vitro. (A) (Left) Tumor volume from subcutaneous injection of GBM6 control and sh mda-9 expressing clones. (Right) Weight of resected subcutaneous tumors after 21 days. a differs

Techniques Used: Multiple Displacement Amplification, In Vivo, In Vitro, Injection, Expressing

mda-9 /syntenin is overexpressed in glioma clinical samples and cell lines. (A) mda-9 dataset.
Figure Legend Snippet: mda-9 /syntenin is overexpressed in glioma clinical samples and cell lines. (A) mda-9 dataset.

Techniques Used: Multiple Displacement Amplification

MDA-9/syntenin regulates astrocytoma invasion. (A) Knockdown of MDA-9/syntenin leads to decreases in invasion. (Left) Protein expression of MDA-9/syntenin after viral infection, 200 plaque-forming unit (pfu)/cell. (Center) Representative images of Matrigel
Figure Legend Snippet: MDA-9/syntenin regulates astrocytoma invasion. (A) Knockdown of MDA-9/syntenin leads to decreases in invasion. (Left) Protein expression of MDA-9/syntenin after viral infection, 200 plaque-forming unit (pfu)/cell. (Center) Representative images of Matrigel

Techniques Used: Multiple Displacement Amplification, Expressing, Infection

Elevated MDA-9/syntenin Expression Is Common in Neuroepithelial Tumors of the CNS and Correlates With Astrocytoma Tumor Grade
Figure Legend Snippet: Elevated MDA-9/syntenin Expression Is Common in Neuroepithelial Tumors of the CNS and Correlates With Astrocytoma Tumor Grade

Techniques Used: Multiple Displacement Amplification, Expressing

MDA-9/syntenin knockdown improves survival and reduces, invasion, and angiogenesis in vivo. (A) Survival time for mice injected with GBM6-control or GBM6–sh mda-9 Cl 3 ( P = .0086). (B) MDA-9/syntenin and CD31 protein levels from GBM6-control tumors
Figure Legend Snippet: MDA-9/syntenin knockdown improves survival and reduces, invasion, and angiogenesis in vivo. (A) Survival time for mice injected with GBM6-control or GBM6–sh mda-9 Cl 3 ( P = .0086). (B) MDA-9/syntenin and CD31 protein levels from GBM6-control tumors

Techniques Used: Multiple Displacement Amplification, In Vivo, Mouse Assay, Injection

26) Product Images from "Practical Synthesis of Cap‐4 RNA"

Article Title: Practical Synthesis of Cap‐4 RNA

Journal: Chembiochem

doi: 10.1002/cbic.201900590

Preparation of short cap‐4 RNAs on solid phase. A) Schematics of the individual steps involved. B) Reaction control of the individual steps based on small portions of RNA assembled on solid‐support ( I to IV ) that were withdrawn and individually deprotected and analyzed by anion‐exchange chromatography (Dionex DNAPac PA‐100 (4×250 mm) column; temperature: 40 °C; flow rate: 1 mL min −1 ; eluent A: 25 m m Tris ⋅ HCl (pH 8.0), 6 m urea; eluent B: 25 m m Tris ⋅ HCl (pH 8.0), 6 m urea, 500 m m NaClO 4 ; gradient: 0–60 % B in A within 45 min; UV detection at 260 nm.
Figure Legend Snippet: Preparation of short cap‐4 RNAs on solid phase. A) Schematics of the individual steps involved. B) Reaction control of the individual steps based on small portions of RNA assembled on solid‐support ( I to IV ) that were withdrawn and individually deprotected and analyzed by anion‐exchange chromatography (Dionex DNAPac PA‐100 (4×250 mm) column; temperature: 40 °C; flow rate: 1 mL min −1 ; eluent A: 25 m m Tris ⋅ HCl (pH 8.0), 6 m urea; eluent B: 25 m m Tris ⋅ HCl (pH 8.0), 6 m urea, 500 m m NaClO 4 ; gradient: 0–60 % B in A within 45 min; UV detection at 260 nm.

Techniques Used: Chromatography

Enzymatic ligation of T. cruzi cap‐4 spliced leader RNA using T4 DNA ligase. A) RNA sequences and sequence of the 20‐nt DNA splint; B) HPLC analysis of a typical ligation reaction after 3 h reaction time; reaction conditions: 10 μ m RNA 10 , 12.5 μ m RNA 11 , 12.5 μ m splint; 0.5 m m ATP, 40 m m Tris ⋅ HCl (pH 7.8), 10 m m MgCl 2 , 10 m m DTT, 5 % ( w / v ) PEG 4000, 0.5 U μL −1 T4 DNA ligase; C) LC–ESI mass spectrum of the purified 39‐nt cap‐4 RNA ligation product.
Figure Legend Snippet: Enzymatic ligation of T. cruzi cap‐4 spliced leader RNA using T4 DNA ligase. A) RNA sequences and sequence of the 20‐nt DNA splint; B) HPLC analysis of a typical ligation reaction after 3 h reaction time; reaction conditions: 10 μ m RNA 10 , 12.5 μ m RNA 11 , 12.5 μ m splint; 0.5 m m ATP, 40 m m Tris ⋅ HCl (pH 7.8), 10 m m MgCl 2 , 10 m m DTT, 5 % ( w / v ) PEG 4000, 0.5 U μL −1 T4 DNA ligase; C) LC–ESI mass spectrum of the purified 39‐nt cap‐4 RNA ligation product.

Techniques Used: Ligation, Sequencing, High Performance Liquid Chromatography, Purification

Enzymatic methylation of cap‐4 RNA using Ecm1 methyltransferase. A) RNA sequences and reaction scheme. B) Anion‐exchange HPLC analysis of a typical methylation reaction (start and after 45 min; see the Experimental Section for reaction conditions), inset shows methylated product after purification. C) LC–ESI mass spectrum of Gppp‐RNA 10 and purified m 7 GpppRNA 11 .
Figure Legend Snippet: Enzymatic methylation of cap‐4 RNA using Ecm1 methyltransferase. A) RNA sequences and reaction scheme. B) Anion‐exchange HPLC analysis of a typical methylation reaction (start and after 45 min; see the Experimental Section for reaction conditions), inset shows methylated product after purification. C) LC–ESI mass spectrum of Gppp‐RNA 10 and purified m 7 GpppRNA 11 .

Techniques Used: Methylation, High Performance Liquid Chromatography, Purification

27) Product Images from "A fast, efficient and sequence-independent method for flexible multiple segmental isotope labeling of RNA using ribozyme and RNase H cleavage"

Article Title: A fast, efficient and sequence-independent method for flexible multiple segmental isotope labeling of RNA using ribozyme and RNase H cleavage

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkq756

Principle, reaction efficiencies and NMR evidence for isotope labeling of each stem-loop of the RsmZ RNA separately. ( a ) Sequence-specific RNase H cleavages to obtain all four isotopically labeled stem-loop fragments. The yields of the cleavage reactions before HPLC purification are indicated, the values in brackets are expressing the yield after purification. The different stem-loops are colored (SL1: magenta, SL2: green, SL3: orange, SL4: cyan). ( b ) Splinted T4 DNA ligase mediated ligations of isotope labeled (in color) and unlabeled (in black) fragments. The unlabeled fragments were obtained in a similar way as the labeled fragments. ( c ) NMR evidence for the successful segmental isotope labeling of each stem-loop separately. 1 H- 15 N-HSQC NMR spectrum of the uniformly 15 N-labeled RsmZ RNA (left) and overlay of the 1 H- 15 N-HSQC NMR spectra of the four segmentally labeled RsmZ RNAs with each stem-loop labeled separately (right). The spectra were recorded on a Bruker 600 MHz spectrometer at 10°C.
Figure Legend Snippet: Principle, reaction efficiencies and NMR evidence for isotope labeling of each stem-loop of the RsmZ RNA separately. ( a ) Sequence-specific RNase H cleavages to obtain all four isotopically labeled stem-loop fragments. The yields of the cleavage reactions before HPLC purification are indicated, the values in brackets are expressing the yield after purification. The different stem-loops are colored (SL1: magenta, SL2: green, SL3: orange, SL4: cyan). ( b ) Splinted T4 DNA ligase mediated ligations of isotope labeled (in color) and unlabeled (in black) fragments. The unlabeled fragments were obtained in a similar way as the labeled fragments. ( c ) NMR evidence for the successful segmental isotope labeling of each stem-loop separately. 1 H- 15 N-HSQC NMR spectrum of the uniformly 15 N-labeled RsmZ RNA (left) and overlay of the 1 H- 15 N-HSQC NMR spectra of the four segmentally labeled RsmZ RNAs with each stem-loop labeled separately (right). The spectra were recorded on a Bruker 600 MHz spectrometer at 10°C.

Techniques Used: Nuclear Magnetic Resonance, Labeling, Sequencing, High Performance Liquid Chromatography, Purification, Expressing

28) Product Images from "Isolation and genome-wide characterization of cellular DNA:RNA triplex structures"

Article Title: Isolation and genome-wide characterization of cellular DNA:RNA triplex structures

Journal: Nucleic Acids Research

doi: 10.1093/nar/gky1305

Enrichment of triplex-forming RNAs. ( A ) Schematic overview of the method to enrich DNA-associated RNA. ( B ) RT-qPCR monitoring the indicated RNAs recovered from HeLa S3 cells, nuclei and purified chromatin. Values are normalized to cellular RNA (±SEM, N = 3). ( C ) Polyacrylamide gel electrophoresis of 5′-labeled RNA enriched by SPRI-size selection. Control samples were treated with DNase I before size selection or with RNase A before gel loading. ( D ) RT-qPCR analysis of DNA-associated RNA from HeLa S3 cells isolated by SPRI-size selection. Values are normalized to cellular RNA. Control samples were treated with DNase I before size selection (±SEM, N = 3). ( E ) RNA-seq profiles for KHPS1 in DNA-associated RNAs (DNA-IP) and nuclear RNA from U2OS cells. The overlap with the TFR of KHPS1 is shaded. Minus (–) and plus (+) strands are shown.
Figure Legend Snippet: Enrichment of triplex-forming RNAs. ( A ) Schematic overview of the method to enrich DNA-associated RNA. ( B ) RT-qPCR monitoring the indicated RNAs recovered from HeLa S3 cells, nuclei and purified chromatin. Values are normalized to cellular RNA (±SEM, N = 3). ( C ) Polyacrylamide gel electrophoresis of 5′-labeled RNA enriched by SPRI-size selection. Control samples were treated with DNase I before size selection or with RNase A before gel loading. ( D ) RT-qPCR analysis of DNA-associated RNA from HeLa S3 cells isolated by SPRI-size selection. Values are normalized to cellular RNA. Control samples were treated with DNase I before size selection (±SEM, N = 3). ( E ) RNA-seq profiles for KHPS1 in DNA-associated RNAs (DNA-IP) and nuclear RNA from U2OS cells. The overlap with the TFR of KHPS1 is shaded. Minus (–) and plus (+) strands are shown.

Techniques Used: Quantitative RT-PCR, Purification, Polyacrylamide Gel Electrophoresis, Labeling, Selection, Isolation, RNA Sequencing Assay

29) Product Images from "Decreasing miRNA sequencing bias using a single adapter and circularization approach"

Article Title: Decreasing miRNA sequencing bias using a single adapter and circularization approach

Journal: Genome Biology

doi: 10.1186/s13059-018-1488-z

Bias in miRNA detection using various small-RNA library preparation kits. For each kit, sequencing libraries were prepared from the miRXplore™ pool and sequenced; the sequence data were then used to calculate fold-deviations from the equimolar input and plotted as log 2 values. Densities of miRNAs within a two-fold deviation from the expected values (between vertical lines ) are considered unbiased according to [ 8 ]. Under-represented, over-represented, and accurately quantified percentages of miRNAs are shown in red font . Results for two-adapter schemes are a TruSeq® Small RNA, b NEBNext®, and c QIAseq. d NEXTFlex™, a scheme using two adapters with randomized sequences. e SMARTer, which uses template switching. f RealSeq®-AC, which uses a single-adapter and circularization (* p value vs other kits
Figure Legend Snippet: Bias in miRNA detection using various small-RNA library preparation kits. For each kit, sequencing libraries were prepared from the miRXplore™ pool and sequenced; the sequence data were then used to calculate fold-deviations from the equimolar input and plotted as log 2 values. Densities of miRNAs within a two-fold deviation from the expected values (between vertical lines ) are considered unbiased according to [ 8 ]. Under-represented, over-represented, and accurately quantified percentages of miRNAs are shown in red font . Results for two-adapter schemes are a TruSeq® Small RNA, b NEBNext®, and c QIAseq. d NEXTFlex™, a scheme using two adapters with randomized sequences. e SMARTer, which uses template switching. f RealSeq®-AC, which uses a single-adapter and circularization (* p value vs other kits

Techniques Used: Sequencing

Differential quantification of brain samples between different small RNA library preparation kits. Data obtained with either a TruSeq®, b NEBNext®, c NEXTFlex™, d QIAseq, or e SMARTer kits were compared with data obtained with RealSeq®-AC to obtain differential quantification (log 2 ) values for 276 high-confidence miRNAs. These values were plotted against the accuracy of detection of that miRNA when profiling the equimolar pool of synthetic miRNAs (Fig. 2 a–c). f–j The reverse comparison, with the differential quantification of RealSeq®-AC versus each of the other kits plotted against the accuracy of RealSeq®-AC when quantifying the synthetic pool of miRNAs. FN false negative, FP false positive. See Methods for more details
Figure Legend Snippet: Differential quantification of brain samples between different small RNA library preparation kits. Data obtained with either a TruSeq®, b NEBNext®, c NEXTFlex™, d QIAseq, or e SMARTer kits were compared with data obtained with RealSeq®-AC to obtain differential quantification (log 2 ) values for 276 high-confidence miRNAs. These values were plotted against the accuracy of detection of that miRNA when profiling the equimolar pool of synthetic miRNAs (Fig. 2 a–c). f–j The reverse comparison, with the differential quantification of RealSeq®-AC versus each of the other kits plotted against the accuracy of RealSeq®-AC when quantifying the synthetic pool of miRNAs. FN false negative, FP false positive. See Methods for more details

Techniques Used:

Correlation of miRNA reads between libraries created with 100 ng, 10 ng, or 1 ng inputs of Human Reference RNA (Agilent). Raw reads mapping to miRNAs were used to calculate the Pearson correlation between libraries
Figure Legend Snippet: Correlation of miRNA reads between libraries created with 100 ng, 10 ng, or 1 ng inputs of Human Reference RNA (Agilent). Raw reads mapping to miRNAs were used to calculate the Pearson correlation between libraries

Techniques Used:

30) Product Images from "Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain"

Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

Journal: PLoS ONE

doi: 10.1371/journal.pone.0039251

15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.
Figure Legend Snippet: 15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.

Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.
Figure Legend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.

Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Positive Control, Negative Control

12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.
Figure Legend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.

Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.
Figure Legend Snippet: The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.

Techniques Used: Polyacrylamide Gel Electrophoresis, Electrophoresis, Negative Control, Positive Control

31) Product Images from "Practical and general synthesis of 5?-adenylated RNA (5?-AppRNA)"

Article Title: Practical and general synthesis of 5?-adenylated RNA (5?-AppRNA)

Journal: RNA

doi: 10.1261/rna.5247704

5′-adenylation of long RNA substrates. ( A ) Schematic diagram of the experimental strategy. The > 100-mer RNA substrate is too long for 5′-AppRNA formation to induce a measurable gel shift relative to a 5′-monophosphate. Therefore, an appropriate 8–17 deoxyribozyme is used to cleave the 5′-portion of the RNA substrate, leaving a small fragment for which 5′-AppRNA formation does cause a gel shift. ( B ) The strategy in A applied to the 160-nt P4–P6 domain of the Tetrahymena group I intron RNA. Blocking oligos were uncapped. The three time points are at 0.5 min, 10 min, and 1 h (6% PAGE). The RNA substrate was internally radiolabeled by transcription incorporating α- 32 P-ATP; the 5′-monophosphate was provided by performing the transcription in the presence of excess GMP (see Materials and Methods). Although the side products have not been studied in great detail, the side product formed in the first experiment (P4–P6 with no DNA blocking oligo) is tentatively assigned as circularized P4–P6 on the basis of attempted 5′- 32 P-radiolabeling with T4 polynucleotide kinase and γ- 32 P-ATP; no reaction was observed alongside a positive control. Only the lower band (a mixture of 5′-monophosphate and 5′-AppRNA) was carried to the 8–17 deoxyribozyme cleavage experiment. std, P4–P6 standard RNA carried through all reactions with no blocking oligo, except that T4 RNA ligase was omitted. ( C ) The strategy in A ).
Figure Legend Snippet: 5′-adenylation of long RNA substrates. ( A ) Schematic diagram of the experimental strategy. The > 100-mer RNA substrate is too long for 5′-AppRNA formation to induce a measurable gel shift relative to a 5′-monophosphate. Therefore, an appropriate 8–17 deoxyribozyme is used to cleave the 5′-portion of the RNA substrate, leaving a small fragment for which 5′-AppRNA formation does cause a gel shift. ( B ) The strategy in A applied to the 160-nt P4–P6 domain of the Tetrahymena group I intron RNA. Blocking oligos were uncapped. The three time points are at 0.5 min, 10 min, and 1 h (6% PAGE). The RNA substrate was internally radiolabeled by transcription incorporating α- 32 P-ATP; the 5′-monophosphate was provided by performing the transcription in the presence of excess GMP (see Materials and Methods). Although the side products have not been studied in great detail, the side product formed in the first experiment (P4–P6 with no DNA blocking oligo) is tentatively assigned as circularized P4–P6 on the basis of attempted 5′- 32 P-radiolabeling with T4 polynucleotide kinase and γ- 32 P-ATP; no reaction was observed alongside a positive control. Only the lower band (a mixture of 5′-monophosphate and 5′-AppRNA) was carried to the 8–17 deoxyribozyme cleavage experiment. std, P4–P6 standard RNA carried through all reactions with no blocking oligo, except that T4 RNA ligase was omitted. ( C ) The strategy in A ).

Techniques Used: Electrophoretic Mobility Shift Assay, Blocking Assay, Polyacrylamide Gel Electrophoresis, Radioactivity, Positive Control

5′-Adenylated RNA. ( A ) The structure of 5′-AppRNA. X is the 5′-terminal nucleotide of the RNA substrate before adenylation. ( B ) The T4 RNA ligase mechanism, showing the 5′-AppRNA intermediate 2 . X and X′ may be any nucleotides. ( C ) Nucleophilic displacement reaction on 5′-triphosphorylated RNA (5′-pppRNA). Nu, nucleophile. The 5′-terminal nucleotide of the RNA is shown as guanosine G because 5′-triphosphorylated RNAs are most typically prepared by in vitro transcription, which introduces G at this position. The nucleophilic substitution reaction on 5′-AppRNA is analogous, except with displacement of AMP instead of PP i (cf. 2 → 3 in B ).
Figure Legend Snippet: 5′-Adenylated RNA. ( A ) The structure of 5′-AppRNA. X is the 5′-terminal nucleotide of the RNA substrate before adenylation. ( B ) The T4 RNA ligase mechanism, showing the 5′-AppRNA intermediate 2 . X and X′ may be any nucleotides. ( C ) Nucleophilic displacement reaction on 5′-triphosphorylated RNA (5′-pppRNA). Nu, nucleophile. The 5′-terminal nucleotide of the RNA is shown as guanosine G because 5′-triphosphorylated RNAs are most typically prepared by in vitro transcription, which introduces G at this position. The nucleophilic substitution reaction on 5′-AppRNA is analogous, except with displacement of AMP instead of PP i (cf. 2 → 3 in B ).

Techniques Used: In Vitro

Possible reaction products from 5′-adenylation of an RNA substrate with T4 RNA ligase and ATP. 5′-monophosphate and 5′-adenyl pyrophosphate termini are abbreviated p and App, respectively. The 5′-to-3′ polarity of each strand is shown by an arrowhead pointing in the 3′-direction. The desired 5′-AppRNA is boxed, and the three possible side reactions starting from 5′-AppRNA are illustrated (circularization, oligomerization, and blocking oligo ligation). The abbreviations used for the other products in the remaining figures of this article are given in boldface within parentheses. For the oligomerization reaction, the RNA substrate that does not provide the reactive 5′-App may itself have either 5′-p or 5′-App. Therefore, two different oligomerization products of any given nucleotide length are possible; only one is shown here.
Figure Legend Snippet: Possible reaction products from 5′-adenylation of an RNA substrate with T4 RNA ligase and ATP. 5′-monophosphate and 5′-adenyl pyrophosphate termini are abbreviated p and App, respectively. The 5′-to-3′ polarity of each strand is shown by an arrowhead pointing in the 3′-direction. The desired 5′-AppRNA is boxed, and the three possible side reactions starting from 5′-AppRNA are illustrated (circularization, oligomerization, and blocking oligo ligation). The abbreviations used for the other products in the remaining figures of this article are given in boldface within parentheses. For the oligomerization reaction, the RNA substrate that does not provide the reactive 5′-App may itself have either 5′-p or 5′-App. Therefore, two different oligomerization products of any given nucleotide length are possible; only one is shown here.

Techniques Used: Blocking Assay, Ligation

32) Product Images from "Full-Length Enriched cDNA Libraries and ORFeome Analysis of Sugarcane Hybrid and Ancestor Genotypes"

Article Title: Full-Length Enriched cDNA Libraries and ORFeome Analysis of Sugarcane Hybrid and Ancestor Genotypes

Journal: PLoS ONE

doi: 10.1371/journal.pone.0107351

Full-length enrichment for library cloning and next generation sequencing (NGS). Full-length (blue line with 5′ cap) or truncated (short blue line without 5′ cap) mRNAs were reverse transcribed into first-strand cDNA using oligo-dT primers (red arrow). The mRNA:cDNA hybrid was treated with RNase I (scissor) to remove the single-stranded RNA that was not fully extended by the first-strand cDNA, followed by selection for full-length transcripts using Cap-antibody magnetic beads to enrich the full-length mRNA:cDNA. The full-length single-stranded DNA (FLssDNA) was eluted from beads and used for both cDNA library cloning (lower left) and NGS (lower right). For full-length library cloning, a double-stranded adaptor (green) was linked to the 5′ end of ssDNA. Second-strand cDNA synthesis was then carried out, followed by cloning into a vector. For NGS, the full-length enriched ssDNA was fragmented by sonication to target fragments in the range of 200–400 bp, followed by ligation of the double-stranded DNA sequencing adaptor mixture (purple) to 3′ and 5′ ends of ssDNA. To maintain the complexity of the library while enriching the full-length cDNA for NGS, the original polyA mRNA was also fragmented using RNAse III, followed by ligation of the double-stranded RNA sequencing adaptor mixture (brown) to 3′ and 5′ ends of mRNA. After first- and second-strand synthesis, the polyA and capped mRNA and polyA and non-capped mRNA samples were mixed in a 3∶1 ratio and applied to the downstream NGS procedure.
Figure Legend Snippet: Full-length enrichment for library cloning and next generation sequencing (NGS). Full-length (blue line with 5′ cap) or truncated (short blue line without 5′ cap) mRNAs were reverse transcribed into first-strand cDNA using oligo-dT primers (red arrow). The mRNA:cDNA hybrid was treated with RNase I (scissor) to remove the single-stranded RNA that was not fully extended by the first-strand cDNA, followed by selection for full-length transcripts using Cap-antibody magnetic beads to enrich the full-length mRNA:cDNA. The full-length single-stranded DNA (FLssDNA) was eluted from beads and used for both cDNA library cloning (lower left) and NGS (lower right). For full-length library cloning, a double-stranded adaptor (green) was linked to the 5′ end of ssDNA. Second-strand cDNA synthesis was then carried out, followed by cloning into a vector. For NGS, the full-length enriched ssDNA was fragmented by sonication to target fragments in the range of 200–400 bp, followed by ligation of the double-stranded DNA sequencing adaptor mixture (purple) to 3′ and 5′ ends of ssDNA. To maintain the complexity of the library while enriching the full-length cDNA for NGS, the original polyA mRNA was also fragmented using RNAse III, followed by ligation of the double-stranded RNA sequencing adaptor mixture (brown) to 3′ and 5′ ends of mRNA. After first- and second-strand synthesis, the polyA and capped mRNA and polyA and non-capped mRNA samples were mixed in a 3∶1 ratio and applied to the downstream NGS procedure.

Techniques Used: Clone Assay, Next-Generation Sequencing, Selection, Magnetic Beads, cDNA Library Assay, Plasmid Preparation, Sonication, Ligation, DNA Sequencing, RNA Sequencing Assay

33) Product Images from "A central role for PI3K-AKT signaling pathway in linking SAMHD1-deficiency to the type I interferon signature"

Article Title: A central role for PI3K-AKT signaling pathway in linking SAMHD1-deficiency to the type I interferon signature

Journal: Scientific Reports

doi: 10.1038/s41598-017-18308-8

Accumulated RNAs in SAMHD1 -deficient cells function as immune stimuli. ( A , B ) PMA-differentiated wild-type THP-1 cells were stimulated with poly dA:dT, poly I:C, an equal amount (5 μg/ml) of isolated total DNA and RNA from wild-type and SAMHD1 -deficient cells, or left unstimulated ( A ). Total RNA isolated from wild-type and SAMHD1 -deficient cells were further size-fractionated and an equal amount of RNA from each fraction was used to stimulate PMA-differentiated wild-type THP-1 cells ( B ), followed by qRT-PCR analysis of IFN-α , IFN-β , IFITM1 and IL6 mRNA levels. ( C , D ) In vitro RNase activity assay for SAMHD1 immunopurified from undifferentiated THP-1 cells using A20 single-stranded RNA substrates. An isotype-matched control anti-IgG and anti-SAMHD1 antibodies were used for immunopurification. THP1 cells were infected with serial dilution of Vpx-loaded or control SIV VLPs ( D ). ( E ) qRT-PCR analysis of IFN-α in wild-type and SAMHD1 -deficient cells reconstituted with indicated SAMHD1 wild-type and mutant constructs. ( F ) Autoradiography of SAMHD1-RNA complex and western blotting of SAMHD1 protein immunoprecipitated from SAMHD1 CLIP. ( G ) Pie chart showing the distribution of statistically significant peaks (q
Figure Legend Snippet: Accumulated RNAs in SAMHD1 -deficient cells function as immune stimuli. ( A , B ) PMA-differentiated wild-type THP-1 cells were stimulated with poly dA:dT, poly I:C, an equal amount (5 μg/ml) of isolated total DNA and RNA from wild-type and SAMHD1 -deficient cells, or left unstimulated ( A ). Total RNA isolated from wild-type and SAMHD1 -deficient cells were further size-fractionated and an equal amount of RNA from each fraction was used to stimulate PMA-differentiated wild-type THP-1 cells ( B ), followed by qRT-PCR analysis of IFN-α , IFN-β , IFITM1 and IL6 mRNA levels. ( C , D ) In vitro RNase activity assay for SAMHD1 immunopurified from undifferentiated THP-1 cells using A20 single-stranded RNA substrates. An isotype-matched control anti-IgG and anti-SAMHD1 antibodies were used for immunopurification. THP1 cells were infected with serial dilution of Vpx-loaded or control SIV VLPs ( D ). ( E ) qRT-PCR analysis of IFN-α in wild-type and SAMHD1 -deficient cells reconstituted with indicated SAMHD1 wild-type and mutant constructs. ( F ) Autoradiography of SAMHD1-RNA complex and western blotting of SAMHD1 protein immunoprecipitated from SAMHD1 CLIP. ( G ) Pie chart showing the distribution of statistically significant peaks (q

Techniques Used: Isolation, Quantitative RT-PCR, In Vitro, Activity Assay, Immu-Puri, Infection, Serial Dilution, Mutagenesis, Construct, Autoradiography, Western Blot, Immunoprecipitation, Cross-linking Immunoprecipitation

34) Product Images from "SHAPE probing pictures Mg2+-dependent folding of small self-cleaving ribozymes"

Article Title: SHAPE probing pictures Mg2+-dependent folding of small self-cleaving ribozymes

Journal: Nucleic Acids Research

doi: 10.1093/nar/gky555

SHAPE probing of the env25 pistol ribozyme. ( A ) Secondary structure representations of the pistol RNA motif with 5′ and 3′ spacer sequences in gray. Red circles indicate highly conserved nucleosides. 3D structure (PDB accession number: 5K7C) using the same color code (right). ( B ) Typical gel for the probing of the pistol RNA structure with BzCN at 37°C. Lanes from left to right: T, C, G and A ladders, control in the absence of probing reagent, probing with BzCN, probing with BzCN and in the presence of 5, 10 and 20 mM MgCl 2 . Note that the fragment in the sequencing ladder that matches the size of the extension product defines the precise nucleotide that corresponds to +1 (therefore the color-coded stem-loop assignments at the right side of the gel is shifted +1 to nucleoside numbering on the left side). ( C–F ) Relative 2′-OH reactivity for selected bases obtained from quantification and normalization of the SHAPE probing results (mean of at least three independent experiments, error bars show standard deviation; two-sided paired t -test with ** P ≤ 0.01, * P ≤ 0.05, • P ≤ 0.1). For quantification of the SHAPE probing data for the complete env25 . ( G ) Projection of SHAPE reactivities of individual nucleotides on the 3D structure of the pistol ribozyme (PDB accession number: 5K7C) following the color code as indicated in the legend.
Figure Legend Snippet: SHAPE probing of the env25 pistol ribozyme. ( A ) Secondary structure representations of the pistol RNA motif with 5′ and 3′ spacer sequences in gray. Red circles indicate highly conserved nucleosides. 3D structure (PDB accession number: 5K7C) using the same color code (right). ( B ) Typical gel for the probing of the pistol RNA structure with BzCN at 37°C. Lanes from left to right: T, C, G and A ladders, control in the absence of probing reagent, probing with BzCN, probing with BzCN and in the presence of 5, 10 and 20 mM MgCl 2 . Note that the fragment in the sequencing ladder that matches the size of the extension product defines the precise nucleotide that corresponds to +1 (therefore the color-coded stem-loop assignments at the right side of the gel is shifted +1 to nucleoside numbering on the left side). ( C–F ) Relative 2′-OH reactivity for selected bases obtained from quantification and normalization of the SHAPE probing results (mean of at least three independent experiments, error bars show standard deviation; two-sided paired t -test with ** P ≤ 0.01, * P ≤ 0.05, • P ≤ 0.1). For quantification of the SHAPE probing data for the complete env25 . ( G ) Projection of SHAPE reactivities of individual nucleotides on the 3D structure of the pistol ribozyme (PDB accession number: 5K7C) following the color code as indicated in the legend.

Techniques Used: Sequencing, Standard Deviation

SHAPE probing of the env22 twister ribozyme. ( A ) Secondary structure representation of the twister RNA with 5′ and 3′ spacer sequences in gray (left). Red circles indicate highly conserved nucleosides. 3D structure (PDB accession number: 4RGE) using the same color code (right). ( B ) Typical gel for the probing of the twister RNA structure with BzCN at 37°C. Lanes from left to right: T, C, G and A ladders, control in the absence of probing reagent (DMSO), probing with BzCN, probing with BzCN and in the presence of either 5, 10 or 20 mM MgCl 2 . Note that the fragment in the sequencing ladder that matches the size of the extension product defines the precise nucleotide that corresponds to +1 (therefore the color-coded stem-loop assignments at the right side of the gel is shifted +1 to nucleoside numbering on the left side). ( C–F ) Relative 2′-OH reactivity for selected bases obtained from quantification and normalization of the SHAPE probing results (mean of at least three independent experiments, error bars show standard deviation; two-sided paired t -test with ** P ≤ 0.01, * P ≤ 0.05, • P ≤ 0.1). For quantification of the complete env22 . ( G ) Projection of SHAPE reactivities of individual nucleotides on the 3D structure of the twister ribozyme (PDB accession number: 4RGE) following the color code as indicated in the legend.
Figure Legend Snippet: SHAPE probing of the env22 twister ribozyme. ( A ) Secondary structure representation of the twister RNA with 5′ and 3′ spacer sequences in gray (left). Red circles indicate highly conserved nucleosides. 3D structure (PDB accession number: 4RGE) using the same color code (right). ( B ) Typical gel for the probing of the twister RNA structure with BzCN at 37°C. Lanes from left to right: T, C, G and A ladders, control in the absence of probing reagent (DMSO), probing with BzCN, probing with BzCN and in the presence of either 5, 10 or 20 mM MgCl 2 . Note that the fragment in the sequencing ladder that matches the size of the extension product defines the precise nucleotide that corresponds to +1 (therefore the color-coded stem-loop assignments at the right side of the gel is shifted +1 to nucleoside numbering on the left side). ( C–F ) Relative 2′-OH reactivity for selected bases obtained from quantification and normalization of the SHAPE probing results (mean of at least three independent experiments, error bars show standard deviation; two-sided paired t -test with ** P ≤ 0.01, * P ≤ 0.05, • P ≤ 0.1). For quantification of the complete env22 . ( G ) Projection of SHAPE reactivities of individual nucleotides on the 3D structure of the twister ribozyme (PDB accession number: 4RGE) following the color code as indicated in the legend.

Techniques Used: Sequencing, Standard Deviation

SHAPE probing of the TS ribozyme. ( A ) Secondary structure representations of the TS RNA motif with 5′ and 3′ spacer sequences in gray. Red circles indicate highly conserved nucleosides. 3D structure (PDB accession number: 5Y87) using the same color code (right). ( B ) Typical gel for the probing of the pistol RNA structure with BzCN at 37°C. Lanes from left to right: T, C, G and A ladders, control in the absence of probing reagent, probing with BzCN, probing with BzCN and in the presence of 5, 10 and 20 mM MgCl 2 . Note that the fragment in the sequencing ladder that matches the size of the extension product defines the precise nucleotide that corresponds to +1 (therefore the color-coded stem-loop assignments at the right side of the gel is shifted +1 to nucleoside numbering on the left side). ( C–E ) Relative 2′-OH reactivity for selected bases of PK T1 obtained from quantification and normalization of the SHAPE probing results (mean of at least three independent experiments, error bars show standard deviation; two-sided paired t -test with *** P ≤ 0.001, ** P ≤ 0.01, * P ≤ 0.05, • P . ( F ) Projection of SHAPE reactivities of individual nucleotides on the 3D structure of the TS ribozyme (PDB accession number: 5Y87) following the color code as indicated in the legend.
Figure Legend Snippet: SHAPE probing of the TS ribozyme. ( A ) Secondary structure representations of the TS RNA motif with 5′ and 3′ spacer sequences in gray. Red circles indicate highly conserved nucleosides. 3D structure (PDB accession number: 5Y87) using the same color code (right). ( B ) Typical gel for the probing of the pistol RNA structure with BzCN at 37°C. Lanes from left to right: T, C, G and A ladders, control in the absence of probing reagent, probing with BzCN, probing with BzCN and in the presence of 5, 10 and 20 mM MgCl 2 . Note that the fragment in the sequencing ladder that matches the size of the extension product defines the precise nucleotide that corresponds to +1 (therefore the color-coded stem-loop assignments at the right side of the gel is shifted +1 to nucleoside numbering on the left side). ( C–E ) Relative 2′-OH reactivity for selected bases of PK T1 obtained from quantification and normalization of the SHAPE probing results (mean of at least three independent experiments, error bars show standard deviation; two-sided paired t -test with *** P ≤ 0.001, ** P ≤ 0.01, * P ≤ 0.05, • P . ( F ) Projection of SHAPE reactivities of individual nucleotides on the 3D structure of the TS ribozyme (PDB accession number: 5Y87) following the color code as indicated in the legend.

Techniques Used: Sequencing, Standard Deviation

SHAPE probing of the hatchet ribozyme. ( A ) Secondary structure representations of the hatchet RNA motif with 5′ and 3′ spacer sequences in gray. ( B ) Typical gel for the probing of the pistol RNA structure with BzCN at 37°C. Lanes from left to right: T, C, G and A ladders, control in the absence of probing reagent, probing with BzCN, probing with BzCN and in the presence of 5, 10 and 20 mM MgCl 2 . Note that the fragment in the sequencing ladder that matches the size of the extension product defines the precise nucleotide that corresponds to +1 (therefore the color-coded stem-loop assignments at the right side of the gel is shifted +1 to nucleoside numbering on the left side). ( C–E ) Relative 2′-OH reactivity for selected bases obtained from quantification and normalization of the SHAPE probing results (mean of at least three independent experiments, error bars show standard deviation; two-sided paired t -test with ** P ≤ 0.01, * P ≤ 0.05, • P . ( F ) Projection of SHAPE reactivities of individual nucleotides on the secondary structure model of the hatchet ribozyme following the color code as indicated in the legend.
Figure Legend Snippet: SHAPE probing of the hatchet ribozyme. ( A ) Secondary structure representations of the hatchet RNA motif with 5′ and 3′ spacer sequences in gray. ( B ) Typical gel for the probing of the pistol RNA structure with BzCN at 37°C. Lanes from left to right: T, C, G and A ladders, control in the absence of probing reagent, probing with BzCN, probing with BzCN and in the presence of 5, 10 and 20 mM MgCl 2 . Note that the fragment in the sequencing ladder that matches the size of the extension product defines the precise nucleotide that corresponds to +1 (therefore the color-coded stem-loop assignments at the right side of the gel is shifted +1 to nucleoside numbering on the left side). ( C–E ) Relative 2′-OH reactivity for selected bases obtained from quantification and normalization of the SHAPE probing results (mean of at least three independent experiments, error bars show standard deviation; two-sided paired t -test with ** P ≤ 0.01, * P ≤ 0.05, • P . ( F ) Projection of SHAPE reactivities of individual nucleotides on the secondary structure model of the hatchet ribozyme following the color code as indicated in the legend.

Techniques Used: Sequencing, Standard Deviation

35) Product Images from "The RNA methyltransferase Dnmt2 methylates DNA in the structural context of a tRNA"

Article Title: The RNA methyltransferase Dnmt2 methylates DNA in the structural context of a tRNA

Journal: RNA Biology

doi: 10.1080/15476286.2016.1236170

Relative methylation efficiency of 2-component hybrid-chimeric tRNAs Asp compared to the all-ribo tRNA Asp (entry 4c/5b in Table 1 ) which is set to 100 on the black scale bar in the middle. Deviations from the native tRNA Asp sequence are presented in capital letters, DNA is highlighted in red.
Figure Legend Snippet: Relative methylation efficiency of 2-component hybrid-chimeric tRNAs Asp compared to the all-ribo tRNA Asp (entry 4c/5b in Table 1 ) which is set to 100 on the black scale bar in the middle. Deviations from the native tRNA Asp sequence are presented in capital letters, DNA is highlighted in red.

Techniques Used: Methylation, Sequencing

36) Product Images from "Improved efficiency of in situ protein analysis by proximity ligation using UnFold probes"

Article Title: Improved efficiency of in situ protein analysis by proximity ligation using UnFold probes

Journal: Scientific Reports

doi: 10.1038/s41598-018-23582-1

Schematic illustration of in situ PLA using conventional and UnFold probes. ( a ) Conventional in situ PLA. ( b ) In situ PLA using UnFold probes. (i) After pairs of primary antibodies have bound a pair of interacting proteins (red and green) followed by washes, secondary conventional or UnFold in situ PLA probes are added, followed after an incubation by renewed washes. (ii) In the conventional design under ( a ) two more oligonucleotides are then added that can form a DNA circle. Using the UnFold design in ( b ) the probe carrying a hairpin-loop oligonucleotide is cleaved at the U residues, liberating a free 5′ end capable of being ligated to the 3′ end of the same DNA strand. Meanwhile, the U residues in the hairpin DNA strand of the other UnFold probe are cleaved presenting a single-stranded template for the enzymatic joining of the ends of the strand on the first UnFold probe. (iii) A DNA ligase is added to form DNA circles in the two variants of in situ PLA. (iv) Finally, phi29 DNA polymerase is added to initiate RCA primed by oligonucleotides on one of the antibodies, and fluorescent oligonucleotides are used to visualize the RCA products.
Figure Legend Snippet: Schematic illustration of in situ PLA using conventional and UnFold probes. ( a ) Conventional in situ PLA. ( b ) In situ PLA using UnFold probes. (i) After pairs of primary antibodies have bound a pair of interacting proteins (red and green) followed by washes, secondary conventional or UnFold in situ PLA probes are added, followed after an incubation by renewed washes. (ii) In the conventional design under ( a ) two more oligonucleotides are then added that can form a DNA circle. Using the UnFold design in ( b ) the probe carrying a hairpin-loop oligonucleotide is cleaved at the U residues, liberating a free 5′ end capable of being ligated to the 3′ end of the same DNA strand. Meanwhile, the U residues in the hairpin DNA strand of the other UnFold probe are cleaved presenting a single-stranded template for the enzymatic joining of the ends of the strand on the first UnFold probe. (iii) A DNA ligase is added to form DNA circles in the two variants of in situ PLA. (iv) Finally, phi29 DNA polymerase is added to initiate RCA primed by oligonucleotides on one of the antibodies, and fluorescent oligonucleotides are used to visualize the RCA products.

Techniques Used: In Situ, Proximity Ligation Assay, Incubation

37) Product Images from "Small-RNA sequencing identifies dynamic microRNA deregulation during skeletal muscle lineage progression"

Article Title: Small-RNA sequencing identifies dynamic microRNA deregulation during skeletal muscle lineage progression

Journal: Scientific Reports

doi: 10.1038/s41598-018-21991-w

Analysis of the expression of putative targets of miR-127 and miR-379 in quiescent and activated satellite cells. ( A ) Expression level of putative mRNAs targets of miR-127 (left), miR-379 (middle) or both (right), predicted in Targetscan Db, in three datasets comparing quiescent vs. in vivo activated satellite cells. In two out of three datasets (Garcia-Prat et al . and Pietrosemoli et al .) transcripts targeted by either miRNA show significant downregulation in the transcriptome of quiescent (in blue) vs . activated satellite cells (in red) (Mann-Whitney test, p- value
Figure Legend Snippet: Analysis of the expression of putative targets of miR-127 and miR-379 in quiescent and activated satellite cells. ( A ) Expression level of putative mRNAs targets of miR-127 (left), miR-379 (middle) or both (right), predicted in Targetscan Db, in three datasets comparing quiescent vs. in vivo activated satellite cells. In two out of three datasets (Garcia-Prat et al . and Pietrosemoli et al .) transcripts targeted by either miRNA show significant downregulation in the transcriptome of quiescent (in blue) vs . activated satellite cells (in red) (Mann-Whitney test, p- value

Techniques Used: Expressing, In Vivo, MANN-WHITNEY

38) Product Images from "Decreasing miRNA sequencing bias using a single adapter and circularization approach"

Article Title: Decreasing miRNA sequencing bias using a single adapter and circularization approach

Journal: Genome Biology

doi: 10.1186/s13059-018-1488-z

Bias in miRNA detection using various small-RNA library preparation kits. For each kit, sequencing libraries were prepared from the miRXplore™ pool and sequenced; the sequence data were then used to calculate fold-deviations from the equimolar input and plotted as log 2 values. Densities of miRNAs within a two-fold deviation from the expected values (between vertical lines ]. Under-represented, over-represented, and accurately quantified percentages of miRNAs are shown in red font . Results for two-adapter schemes are a TruSeq® Small RNA, b NEBNext®, and c QIAseq. d NEXTFlex™, a scheme using two adapters with randomized sequences. e SMARTer, which uses template switching. f RealSeq®-AC, which uses a single-adapter and circularization (* p value vs other kits
Figure Legend Snippet: Bias in miRNA detection using various small-RNA library preparation kits. For each kit, sequencing libraries were prepared from the miRXplore™ pool and sequenced; the sequence data were then used to calculate fold-deviations from the equimolar input and plotted as log 2 values. Densities of miRNAs within a two-fold deviation from the expected values (between vertical lines ]. Under-represented, over-represented, and accurately quantified percentages of miRNAs are shown in red font . Results for two-adapter schemes are a TruSeq® Small RNA, b NEBNext®, and c QIAseq. d NEXTFlex™, a scheme using two adapters with randomized sequences. e SMARTer, which uses template switching. f RealSeq®-AC, which uses a single-adapter and circularization (* p value vs other kits

Techniques Used: Sequencing

Correlation of miRNA reads between libraries created with 100 ng, 10 ng, or 1 ng inputs of Human Reference RNA (Agilent). Raw reads mapping to miRNAs were used to calculate the Pearson correlation between libraries
Figure Legend Snippet: Correlation of miRNA reads between libraries created with 100 ng, 10 ng, or 1 ng inputs of Human Reference RNA (Agilent). Raw reads mapping to miRNAs were used to calculate the Pearson correlation between libraries

Techniques Used:

39) Product Images from "The three major types of CRISPR-Cas systems function independently in CRISPR RNA biogenesis in Streptococcus thermophilus"

Article Title: The three major types of CRISPR-Cas systems function independently in CRISPR RNA biogenesis in Streptococcus thermophilus

Journal: Molecular microbiology

doi: 10.1111/mmi.12644

Sth crRNA 5′ and 3′ chemical end groups. (A) 5′ end analysis was performed by incubating total RNA from Sth in the absence or presence of Terminator 5′-Phosphate-Dependent Exonuclease (TEX) followed by Northern blotting using probes for the RNAs indicated below each panel. 1.01 is the leader proximal crRNA from CRISPR 1, 2.01 is the leader proximal crRNA from CRISPR 2, etc. (B) For 3′ chemical end analysis of crRNAs from CRISPRs 1–3, gel extracted sRNAs from Sth were incubated in the absence or presence of E. coli poly(A) polymerase (PAP) followed by Northern blotting. The chemical end groups present on crRNAs from CRISPR4 were determined by Northern analysis of Sth total RNA following combinations of treatments with Thermosensitive Alkaline Phosphatase (TSAP), T4 polynucleotide kinase (PNK), and E. coli poly(A) polymerase (PAP). Mature crRNAs are indicated by an asterisk. A very minor ~37 nt form detected for 2.01 crRNA discussed in the text is indicated by an arrow.
Figure Legend Snippet: Sth crRNA 5′ and 3′ chemical end groups. (A) 5′ end analysis was performed by incubating total RNA from Sth in the absence or presence of Terminator 5′-Phosphate-Dependent Exonuclease (TEX) followed by Northern blotting using probes for the RNAs indicated below each panel. 1.01 is the leader proximal crRNA from CRISPR 1, 2.01 is the leader proximal crRNA from CRISPR 2, etc. (B) For 3′ chemical end analysis of crRNAs from CRISPRs 1–3, gel extracted sRNAs from Sth were incubated in the absence or presence of E. coli poly(A) polymerase (PAP) followed by Northern blotting. The chemical end groups present on crRNAs from CRISPR4 were determined by Northern analysis of Sth total RNA following combinations of treatments with Thermosensitive Alkaline Phosphatase (TSAP), T4 polynucleotide kinase (PNK), and E. coli poly(A) polymerase (PAP). Mature crRNAs are indicated by an asterisk. A very minor ~37 nt form detected for 2.01 crRNA discussed in the text is indicated by an arrow.

Techniques Used: Northern Blot, CRISPR, Incubation

40) Product Images from "Highly specific imaging of mRNA in single cells by target RNA-initiated rolling circle amplification specific imaging of mRNA in single cells by target RNA-initiated rolling circle amplification †Electronic supplementary information (ESI) available: Additional experimental materials, methods, DNA sequences and supplementary figures and tables. See DOI: 10.1039/c7sc00292kClick here for additional data file."

Article Title: Highly specific imaging of mRNA in single cells by target RNA-initiated rolling circle amplification specific imaging of mRNA in single cells by target RNA-initiated rolling circle amplification †Electronic supplementary information (ESI) available: Additional experimental materials, methods, DNA sequences and supplementary figures and tables. See DOI: 10.1039/c7sc00292kClick here for additional data file.

Journal: Chemical Science

doi: 10.1039/c7sc00292k

Detecting target RNA in vitro using target RNA-initiated RCA with different ligases. (a) Fluorescence emission spectra for the target RNA-initiated RCA reaction carried out using different ligases (Splint R, T4 RNA ligase 2 and T4 DNA ligase) and padlock probes (Target, targeting mRNA ACTB; Random, random padlock probe). (b) The fluorescence intensity of the target RNA-initiated RCA reaction profiled in (a).
Figure Legend Snippet: Detecting target RNA in vitro using target RNA-initiated RCA with different ligases. (a) Fluorescence emission spectra for the target RNA-initiated RCA reaction carried out using different ligases (Splint R, T4 RNA ligase 2 and T4 DNA ligase) and padlock probes (Target, targeting mRNA ACTB; Random, random padlock probe). (b) The fluorescence intensity of the target RNA-initiated RCA reaction profiled in (a).

Techniques Used: In Vitro, Fluorescence

Demonstration of the specificity for mRNA imaging in single cells. (a) The RCA reactions were carried using T4 DNA ligase, T4 RNA ligase 2 and Splint R. Four padlock probes were designed for target mRNA TK1: one perfectly matching with the target sequence of mRNA TK1 (Mis-0), two probes with one (Mis-1) or two (Mis-2) mismatching bases compared to target mRNA TK1 and one random probe (Ran). Inset: frequency histogram of RCA amplicons per cell detected. The right column is the average number of RCA amplicons detected in MCF-7 cells using the padlock probes Mis-0, Mis-1, Mis-2 and Ran; (b and c) detection of a single nucleotide difference in mRNA ACTB in human MCF-7 cells (b) and mouse 4T1 cells (c). Inset: the quantification of the average number of RCA amplicons detected (100 cells counted). The cell nuclei are shown in blue, the RCA amplicons appear as green or red spots, and the cell outlines are marked by a dotted line. Scale bars: 10 μm.
Figure Legend Snippet: Demonstration of the specificity for mRNA imaging in single cells. (a) The RCA reactions were carried using T4 DNA ligase, T4 RNA ligase 2 and Splint R. Four padlock probes were designed for target mRNA TK1: one perfectly matching with the target sequence of mRNA TK1 (Mis-0), two probes with one (Mis-1) or two (Mis-2) mismatching bases compared to target mRNA TK1 and one random probe (Ran). Inset: frequency histogram of RCA amplicons per cell detected. The right column is the average number of RCA amplicons detected in MCF-7 cells using the padlock probes Mis-0, Mis-1, Mis-2 and Ran; (b and c) detection of a single nucleotide difference in mRNA ACTB in human MCF-7 cells (b) and mouse 4T1 cells (c). Inset: the quantification of the average number of RCA amplicons detected (100 cells counted). The cell nuclei are shown in blue, the RCA amplicons appear as green or red spots, and the cell outlines are marked by a dotted line. Scale bars: 10 μm.

Techniques Used: Imaging, Sequencing

Effect of different ligases on the efficiency of mRNA imaging in single cells. (a) Imaging of mRNA ACTB using target RNA-initiated RCA in the MCF-7 cells with different ligases: T4 DNA ligase, T4 RNA ligase 2 and Splint R. In situ RCA was conducted using the padlock probe targeting ACTB and a random padlock probe as control. The cell nuclei are shown in blue, the RCA amplicons appear as green spots, and the cell outlines are marked by a dotted line. Scale bars: 10 μm. Inset: frequency histogram of RCA amplicons per cell detected. (b) Quantification of the average number of RCA amplicons per cell detected in (a).
Figure Legend Snippet: Effect of different ligases on the efficiency of mRNA imaging in single cells. (a) Imaging of mRNA ACTB using target RNA-initiated RCA in the MCF-7 cells with different ligases: T4 DNA ligase, T4 RNA ligase 2 and Splint R. In situ RCA was conducted using the padlock probe targeting ACTB and a random padlock probe as control. The cell nuclei are shown in blue, the RCA amplicons appear as green spots, and the cell outlines are marked by a dotted line. Scale bars: 10 μm. Inset: frequency histogram of RCA amplicons per cell detected. (b) Quantification of the average number of RCA amplicons per cell detected in (a).

Techniques Used: Imaging, In Situ

41) Product Images from "Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase"

Article Title: Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkx033

Single-stranded DNA ligation with T4 DNA ligase and CircLigase. A pool of 60 nt acceptor oligonucleotides (‘60N’) were ligated to 10 pmol of a 3΄ biotinylated donor oligonucleotide (CL78) using either T4 DNA ligase in the presence of a splinter oligonucleotide (TL38) or CircLigase. Ligation products were visualized on a 10% denaturing polyacrylamide gel stained with SybrGold. Band shifts from 60 nt to 80 nt indicate successful ligation. Schematic overviews of the reaction schemes are shown on top. The scheme developed by Kwok et al . ( 19 ) is shown for comparison. M: Single-stranded DNA size marker.
Figure Legend Snippet: Single-stranded DNA ligation with T4 DNA ligase and CircLigase. A pool of 60 nt acceptor oligonucleotides (‘60N’) were ligated to 10 pmol of a 3΄ biotinylated donor oligonucleotide (CL78) using either T4 DNA ligase in the presence of a splinter oligonucleotide (TL38) or CircLigase. Ligation products were visualized on a 10% denaturing polyacrylamide gel stained with SybrGold. Band shifts from 60 nt to 80 nt indicate successful ligation. Schematic overviews of the reaction schemes are shown on top. The scheme developed by Kwok et al . ( 19 ) is shown for comparison. M: Single-stranded DNA size marker.

Techniques Used: DNA Ligation, Ligation, Staining, Marker

Library preparation methods for highly degraded DNA. ( A ) In the single-stranded library preparation method described here (ssDNA2.0), DNA fragments (black) are 5΄ and 3΄ dephosphorylated and separated into single strands by heat denaturation. 3΄ biotinylated adapter molecules (red) are attached to the 3΄ ends of the DNA fragments via hybridization to a stretch of six random nucleotides (marked as ‘N’) belonging to a splinter oligonucleotide complementary to the adapter and nick closure with T4 DNA ligase. Following the immobilization of the ligation products on streptavidin-coated beads, the splinter oligonucleotide is removed by bead wash at an elevated temperature. Synthesis of the second strand is carried out using the Klenow fragment of Escherichia coli DNA polymerase I and a primer with phosphorothioate backbone modifications (red stars) to prevent exonucleolytic degradation. Unincorporated primers are removed through a bead wash at an elevated temperature, preventing the formation of adapter dimers in the subsequent blunt-end ligation reaction, which is again catalyzed by T4 DNA ligase. Adapter self-ligation is prevented through a 3΄ dideoxy modification in the adapter. The final library strand is released from the beads by heat denaturation. ( B ) In the single-stranded library preparation method originally described in Gansauge and Meyer, ( 4 ), the first adapter was attached through true single-stranded DNA ligation using CircLigase. The large fragment of Bst DNA polymerase was used to copy the template strand, leaving overhanging 3΄ nucleotides, which had to be removed in a blunt-end repair reaction using T4 DNA polymerase. ( C ) The ‘454’ method of double-stranded library preparation in the implementation of Meyer and Kircher, ( 23 ), is based on non-directional blunt-end ligation of a mixture of two adapters to blunt-end repaired DNA fragments using T4 DNA ligase. To prevent adapter self-ligation, no phosphate groups are present at the 5΄ ends of the adapters, resulting in the ligation of the adapter strands only and necessitating subsequent nick fill-in with a strand-displacing polymerase. Intermittent DNA purification steps are required in-between enzymatic reactions. ( D ) The ‘Illumina’ method of double-stranded library preparation, shown here as implemented in New England Biolabs’ NEBNext Ultra II kit, requires the addition of A-overhangs (marked as ‘A’) to blunt-end repaired DNA fragments using a 3΄-5΄ exonuclease deletion mutant of the Klenow fragment of E. coli DNA polymerase I. Both adapter sequences are combined into one bell-shaped structure, which carries a 3΄ T overhang to allow sticky end ligation with T4 DNA ligase. Following ligation, adapter strands are separated by excision of uracil. Excess adapters and adapter dimers are removed through size-selective purification.
Figure Legend Snippet: Library preparation methods for highly degraded DNA. ( A ) In the single-stranded library preparation method described here (ssDNA2.0), DNA fragments (black) are 5΄ and 3΄ dephosphorylated and separated into single strands by heat denaturation. 3΄ biotinylated adapter molecules (red) are attached to the 3΄ ends of the DNA fragments via hybridization to a stretch of six random nucleotides (marked as ‘N’) belonging to a splinter oligonucleotide complementary to the adapter and nick closure with T4 DNA ligase. Following the immobilization of the ligation products on streptavidin-coated beads, the splinter oligonucleotide is removed by bead wash at an elevated temperature. Synthesis of the second strand is carried out using the Klenow fragment of Escherichia coli DNA polymerase I and a primer with phosphorothioate backbone modifications (red stars) to prevent exonucleolytic degradation. Unincorporated primers are removed through a bead wash at an elevated temperature, preventing the formation of adapter dimers in the subsequent blunt-end ligation reaction, which is again catalyzed by T4 DNA ligase. Adapter self-ligation is prevented through a 3΄ dideoxy modification in the adapter. The final library strand is released from the beads by heat denaturation. ( B ) In the single-stranded library preparation method originally described in Gansauge and Meyer, ( 4 ), the first adapter was attached through true single-stranded DNA ligation using CircLigase. The large fragment of Bst DNA polymerase was used to copy the template strand, leaving overhanging 3΄ nucleotides, which had to be removed in a blunt-end repair reaction using T4 DNA polymerase. ( C ) The ‘454’ method of double-stranded library preparation in the implementation of Meyer and Kircher, ( 23 ), is based on non-directional blunt-end ligation of a mixture of two adapters to blunt-end repaired DNA fragments using T4 DNA ligase. To prevent adapter self-ligation, no phosphate groups are present at the 5΄ ends of the adapters, resulting in the ligation of the adapter strands only and necessitating subsequent nick fill-in with a strand-displacing polymerase. Intermittent DNA purification steps are required in-between enzymatic reactions. ( D ) The ‘Illumina’ method of double-stranded library preparation, shown here as implemented in New England Biolabs’ NEBNext Ultra II kit, requires the addition of A-overhangs (marked as ‘A’) to blunt-end repaired DNA fragments using a 3΄-5΄ exonuclease deletion mutant of the Klenow fragment of E. coli DNA polymerase I. Both adapter sequences are combined into one bell-shaped structure, which carries a 3΄ T overhang to allow sticky end ligation with T4 DNA ligase. Following ligation, adapter strands are separated by excision of uracil. Excess adapters and adapter dimers are removed through size-selective purification.

Techniques Used: Hybridization, Ligation, Modification, DNA Ligation, DNA Purification, Mutagenesis, Purification

Effects of single-stranded ligation schemes on library characteristics. ( A ) Informative sequence content of libraries prepared with CircLigase and T4 DNA ligase as a function of the input volume of ancient DNA extract used for library preparation. ( B ) Average GC content of the sequences obtained with the two ligation schemes. Note that the average GC content exceeds that of a typical mammalian genome because most sequences derive from microbial DNA, which is the dominant source of DNA in most ancient bones. ( C ) Fragment size distribution in the libraries as inferred from overlap-merged paired-end reads. Short artifacts in the library prepared from extremely little input DNA (corresponding to ∼1 mg bone) are mainly due to the incorporation of splinter fragments. ( D ) Frequencies of damage-induced C to T substitutions near the 5΄ and 3΄ ends of sequences.
Figure Legend Snippet: Effects of single-stranded ligation schemes on library characteristics. ( A ) Informative sequence content of libraries prepared with CircLigase and T4 DNA ligase as a function of the input volume of ancient DNA extract used for library preparation. ( B ) Average GC content of the sequences obtained with the two ligation schemes. Note that the average GC content exceeds that of a typical mammalian genome because most sequences derive from microbial DNA, which is the dominant source of DNA in most ancient bones. ( C ) Fragment size distribution in the libraries as inferred from overlap-merged paired-end reads. Short artifacts in the library prepared from extremely little input DNA (corresponding to ∼1 mg bone) are mainly due to the incorporation of splinter fragments. ( D ) Frequencies of damage-induced C to T substitutions near the 5΄ and 3΄ ends of sequences.

Techniques Used: Ligation, Sequencing, Ancient DNA Assay

42) Product Images from "Highly multiplexed simultaneous detection of RNAs and proteins in single cells"

Article Title: Highly multiplexed simultaneous detection of RNAs and proteins in single cells

Journal: Nature methods

doi: 10.1038/nmeth.3742

PLAYR enables the simultaneous quantification of specific transcripts and proteins in single cells a ) Main steps of the PLAYR protocol: 1) Fixation of cells captures their native state and permeabilization enables intracellular antibody staining and blocking of endogenous RNAses with inhibitors. 2) PLAYR probe pairs are added for proximal hybridization to target transcripts. 3) Backbone and insert oligonucleotides are added and form a circle if hybridized to PLAYR probes that are in close proximity (bound to a transcript). Insert sequences serve as cognate barcodes for targeted transcripts. 4) Backbone and insert oligonucleotides are ligated into a single-stranded DNA circle by T4 DNA ligase. 5) Rolling circle amplification of the DNA circle by phy29 polymerase. 6) Detection of rolling circle amplicons with suitably labeled oligonucleotides that bind to the insert regions. b ) Detection of transcripts for three housekeeping genes that span a wide abundance range in U937 cells by mass cytometry. c ) Quantification of CCL4 and IFNG mRNA by PLAYR and qPCR in NKL cells after stimulation with PMA-ionomycin. Measurements were performed at 4 time points in 3 replicates. d ) Simultaneous IFNG mRNA and protein quantification by mass cytometry in NKL cells at indicated time points after stimulation with PMA-ionomycin.
Figure Legend Snippet: PLAYR enables the simultaneous quantification of specific transcripts and proteins in single cells a ) Main steps of the PLAYR protocol: 1) Fixation of cells captures their native state and permeabilization enables intracellular antibody staining and blocking of endogenous RNAses with inhibitors. 2) PLAYR probe pairs are added for proximal hybridization to target transcripts. 3) Backbone and insert oligonucleotides are added and form a circle if hybridized to PLAYR probes that are in close proximity (bound to a transcript). Insert sequences serve as cognate barcodes for targeted transcripts. 4) Backbone and insert oligonucleotides are ligated into a single-stranded DNA circle by T4 DNA ligase. 5) Rolling circle amplification of the DNA circle by phy29 polymerase. 6) Detection of rolling circle amplicons with suitably labeled oligonucleotides that bind to the insert regions. b ) Detection of transcripts for three housekeeping genes that span a wide abundance range in U937 cells by mass cytometry. c ) Quantification of CCL4 and IFNG mRNA by PLAYR and qPCR in NKL cells after stimulation with PMA-ionomycin. Measurements were performed at 4 time points in 3 replicates. d ) Simultaneous IFNG mRNA and protein quantification by mass cytometry in NKL cells at indicated time points after stimulation with PMA-ionomycin.

Techniques Used: Staining, Blocking Assay, Hybridization, Amplification, Labeling, Mass Cytometry, Real-time Polymerase Chain Reaction

43) Product Images from "A new enzymatic route for production of long 5'-phosphorylated oligonucleotides using suicide cassettes and rolling circle DNA synthesis"

Article Title: A new enzymatic route for production of long 5'-phosphorylated oligonucleotides using suicide cassettes and rolling circle DNA synthesis

Journal: BMC Biotechnology

doi: 10.1186/1472-6750-7-49

Solid support rolling circle DNA synthesis from amplified SF-WT90 oligonucleotide cleaved with Mly I . First row : The chemically synthesized padlock probe, WT90-66b, was incubated with a covalently coupled primer (Amin-L16-Mly I (+) primer or Amin-L16-Mly I (-)) in the presence of T4 DNA ligase. Only correctly hybridized padlock probes of the right sequence can be circularized. Ligated probes were subsequently amplified by rolling circle DNA synthesis and detected by hybridization to the rolling circle products of either the ID 16 or the anti ID 16 detection oligonucleotide. Second row : The SF-WT90 oligonucleotide, was amplified one round by the method presented in figure 1 (from (+)-strand to (-)-strand) and the suicide cassette was removed by cleavage with Mly I. Subsequently, the padlock probe generated was incubated with a covalently coupled primer (Amin-L16-Mly I (+) or Amin-L16- Mly I (-)) in the presence of T4 DNA ligase. Only correctly hybridized padlock probes of the right sequence can be circularized. Ligated probes were subsequently amplified by rolling circle DNA synthesis and detected by hybridization to the rolling circle products of either the ID 16 or the anti ID 16 detection oligonucleotide. Third row : The SF-WT90oligonucleotide was amplified two rounds by the method presented in figure 1 (from (+)-strand to (-)-strand and back to (+)-strand) and the suicide cassette was removed by cleavage with Mly I. Subsequently, the padlock probe generated was incubated with a covalently coupled primer (Amin-L16-Mly I (+) primer or Amin-L16- Mly I (-)) in the presence of T4 DNA ligase. Only correctly hybridized padlock probes of the right sequence can be circularized. Ligated probes were subsequently amplified by rolling circle DNA synthesis and detected by hybridization to the rolling circle products of either the ID 16 or the anti ID 16 detection oligonucleotide. Schematic representations indicate the expected outcome of the hybridization events. (+) and (-) indicate the polarity of the probes. The (+)-primer hybridizes to the (+)-probe and the (-)-primer hybridizes to the (-)-probe. Equimolar amounts of probe were applied in each reaction (0.1 μM). Scale bar, 100 μm. At the bottom of the figure is a schematic representation of the individual steps in the solid support assay.
Figure Legend Snippet: Solid support rolling circle DNA synthesis from amplified SF-WT90 oligonucleotide cleaved with Mly I . First row : The chemically synthesized padlock probe, WT90-66b, was incubated with a covalently coupled primer (Amin-L16-Mly I (+) primer or Amin-L16-Mly I (-)) in the presence of T4 DNA ligase. Only correctly hybridized padlock probes of the right sequence can be circularized. Ligated probes were subsequently amplified by rolling circle DNA synthesis and detected by hybridization to the rolling circle products of either the ID 16 or the anti ID 16 detection oligonucleotide. Second row : The SF-WT90 oligonucleotide, was amplified one round by the method presented in figure 1 (from (+)-strand to (-)-strand) and the suicide cassette was removed by cleavage with Mly I. Subsequently, the padlock probe generated was incubated with a covalently coupled primer (Amin-L16-Mly I (+) or Amin-L16- Mly I (-)) in the presence of T4 DNA ligase. Only correctly hybridized padlock probes of the right sequence can be circularized. Ligated probes were subsequently amplified by rolling circle DNA synthesis and detected by hybridization to the rolling circle products of either the ID 16 or the anti ID 16 detection oligonucleotide. Third row : The SF-WT90oligonucleotide was amplified two rounds by the method presented in figure 1 (from (+)-strand to (-)-strand and back to (+)-strand) and the suicide cassette was removed by cleavage with Mly I. Subsequently, the padlock probe generated was incubated with a covalently coupled primer (Amin-L16-Mly I (+) primer or Amin-L16- Mly I (-)) in the presence of T4 DNA ligase. Only correctly hybridized padlock probes of the right sequence can be circularized. Ligated probes were subsequently amplified by rolling circle DNA synthesis and detected by hybridization to the rolling circle products of either the ID 16 or the anti ID 16 detection oligonucleotide. Schematic representations indicate the expected outcome of the hybridization events. (+) and (-) indicate the polarity of the probes. The (+)-primer hybridizes to the (+)-probe and the (-)-primer hybridizes to the (-)-probe. Equimolar amounts of probe were applied in each reaction (0.1 μM). Scale bar, 100 μm. At the bottom of the figure is a schematic representation of the individual steps in the solid support assay.

Techniques Used: DNA Synthesis, Amplification, Synthesized, Incubation, Sequencing, Hybridization, Generated

Comparison of the chemically synthesized oligonucleotide WT90-66b and the oligonucleotide contained within the suicide cassette in SF-WT90 following amplification in a solid support rolling circle DNA synthesis assay . The chemically synthesized padlock probe WT90-66b (left) and SF-WT90 (amplified two rounds (from (+)-strand to (-)-strand and back to (+)-strand) and cleaved with Mly I; the probe was purified by PAGE after each round) (right) were incubated with a covalently coupled primer (Amin-L16-Mly I (+)) in the presence of T4 DNA ligase. Only correctly hybridized padlock probes of the right sequence can be circularized. Ligated probes were subsequently amplified by rolling circle DNA synthesis and detected by hybridization to the rolling circle products of the ID 16 detection oligonucleotide. Equimolar amounts of probe were applied in each reaction (0.1 nM). Scale bar, 100 μm.
Figure Legend Snippet: Comparison of the chemically synthesized oligonucleotide WT90-66b and the oligonucleotide contained within the suicide cassette in SF-WT90 following amplification in a solid support rolling circle DNA synthesis assay . The chemically synthesized padlock probe WT90-66b (left) and SF-WT90 (amplified two rounds (from (+)-strand to (-)-strand and back to (+)-strand) and cleaved with Mly I; the probe was purified by PAGE after each round) (right) were incubated with a covalently coupled primer (Amin-L16-Mly I (+)) in the presence of T4 DNA ligase. Only correctly hybridized padlock probes of the right sequence can be circularized. Ligated probes were subsequently amplified by rolling circle DNA synthesis and detected by hybridization to the rolling circle products of the ID 16 detection oligonucleotide. Equimolar amounts of probe were applied in each reaction (0.1 nM). Scale bar, 100 μm.

Techniques Used: Synthesized, Amplification, DNA Synthesis, Purification, Polyacrylamide Gel Electrophoresis, Incubation, Sequencing, Hybridization

44) Product Images from "Practical Synthesis of Cap‐4 RNA"

Article Title: Practical Synthesis of Cap‐4 RNA

Journal: Chembiochem

doi: 10.1002/cbic.201900590

Enzymatic ligation of T. cruzi cap‐4 spliced leader RNA using T4 DNA ligase. A) RNA sequences and sequence of the 20‐nt DNA splint; B) HPLC analysis of a typical ligation reaction after 3 h reaction time; reaction conditions: 10 μ m RNA 10 , 12.5 μ m RNA 11 , 12.5 μ m splint; 0.5 m m ATP, 40 m m Tris ⋅ HCl (pH 7.8), 10 m m MgCl 2 , 10 m m DTT, 5 % ( w / v ) PEG 4000, 0.5 U μL −1 T4 DNA ligase; C) LC–ESI mass spectrum of the purified 39‐nt cap‐4 RNA ligation product.
Figure Legend Snippet: Enzymatic ligation of T. cruzi cap‐4 spliced leader RNA using T4 DNA ligase. A) RNA sequences and sequence of the 20‐nt DNA splint; B) HPLC analysis of a typical ligation reaction after 3 h reaction time; reaction conditions: 10 μ m RNA 10 , 12.5 μ m RNA 11 , 12.5 μ m splint; 0.5 m m ATP, 40 m m Tris ⋅ HCl (pH 7.8), 10 m m MgCl 2 , 10 m m DTT, 5 % ( w / v ) PEG 4000, 0.5 U μL −1 T4 DNA ligase; C) LC–ESI mass spectrum of the purified 39‐nt cap‐4 RNA ligation product.

Techniques Used: Ligation, Sequencing, High Performance Liquid Chromatography, Purification

45) Product Images from "Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain"

Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

Journal: PLoS ONE

doi: 10.1371/journal.pone.0039251

15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.
Figure Legend Snippet: 15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.

Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.
Figure Legend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.

Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Positive Control, Negative Control

12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.
Figure Legend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.

Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.
Figure Legend Snippet: The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.

Techniques Used: Polyacrylamide Gel Electrophoresis, Electrophoresis, Negative Control, Positive Control

46) Product Images from "Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain"

Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

Journal: PLoS ONE

doi: 10.1371/journal.pone.0039251

15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.
Figure Legend Snippet: 15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.

Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.
Figure Legend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.

Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Positive Control, Negative Control

12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.
Figure Legend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.

Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.
Figure Legend Snippet: The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.

Techniques Used: Polyacrylamide Gel Electrophoresis, Electrophoresis, Negative Control, Positive Control

47) Product Images from "A systematic, ligation-based approach to study RNA modifications"

Article Title: A systematic, ligation-based approach to study RNA modifications

Journal: RNA

doi: 10.1261/rna.208906

Outline of the ligation method to study RNA modifications. ( A ) The RNA (black line) containing an unmodified or modified nucleotide (open or filled black circles) is hybridized with two oligonucleotides. These oligonucleotides are ligated by the T4 DNA ligase using this RNA as a template (triangle). The D- and N-oligos have different nucleotide compositions (green or red circles) at the ligation junction or different ligation sites. ( B ) For the D-oligo (green line), ligation proceeds very efficiently when the RNA is unmodified, but very poorly when the RNA is modified (or the other way around). For the N-oligo (red line), ligation has a constant yield regardless of the status of RNA modification. The amount of D-oligo ligation product corresponds to the amount of unmodified over modified RNA template (or modified over unmodified). The amount of N-oligo product corresponds to the sum of the unmodified and modified RNA.
Figure Legend Snippet: Outline of the ligation method to study RNA modifications. ( A ) The RNA (black line) containing an unmodified or modified nucleotide (open or filled black circles) is hybridized with two oligonucleotides. These oligonucleotides are ligated by the T4 DNA ligase using this RNA as a template (triangle). The D- and N-oligos have different nucleotide compositions (green or red circles) at the ligation junction or different ligation sites. ( B ) For the D-oligo (green line), ligation proceeds very efficiently when the RNA is unmodified, but very poorly when the RNA is modified (or the other way around). For the N-oligo (red line), ligation has a constant yield regardless of the status of RNA modification. The amount of D-oligo ligation product corresponds to the amount of unmodified over modified RNA template (or modified over unmodified). The amount of N-oligo product corresponds to the sum of the unmodified and modified RNA.

Techniques Used: Ligation, Modification

48) Product Images from "Late steps of ribosome assembly in E. coli are sensitive to a severe heat stress but are assisted by the HSP70 chaperone machine †"

Article Title: Late steps of ribosome assembly in E. coli are sensitive to a severe heat stress but are assisted by the HSP70 chaperone machine †

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkq1049

( A–F ) Sedimentation profiles of ribosomal subunits prepared from strain MC4100 labelled with [ 3 H]-uridine for 1 h at 42°C (A), or 44°C (B), or 45°C (C) or 46°C (D), or from strain MC4100 pulse-labelled with [ 3 H]-uridine for 1 min at 30°C (E), or from strain BB1553 ( ΔdnaK ) labelled with [ 3 H]-uridine for 1 h at 37°C (F). In (E), pulse-labelling with [5- 3 H]-uridine (Amersham, TRK178) isotopically undiluted (28 Ci/mmol) for 1 min was abruptly terminated by the addition of NaN 3  to give a final concentration of 10 mM and by pouring onto an equal volume of crushed ice. Sedimentation is from right to left. A 260 /ml, open circles. [ 3 H] c.p.m. × 10 3 , filled circles. ( G ) Bacterial growth from strain SR6618 [MC4100 Φ( groESL::lacZ )] was followed by measuring the A 600 /ml of the culture at 30°C. At A 600 /ml = 0.25, half of the culture was shifted to 45°C, and bacterial samples were withdrawn from both cultures at every 20 min for β-galactosidase assays. ( H ) β-Galactosidase specific activities were measured following standard procedures (  19 ), and expressed per A 600 /ml of the culture at 30°C or at 45°C, i.e. in Miller units, as follows = 1000 × A 420 /ml /  t  ×  v  × A 600 /ml, where A 420 /ml measures the concentration of the orthonitrophenol produced by hydrolysis of ONPG (ortho-nitrophenyl-β-galactoside),  v  the volume of culture used in the assay in ml, and  t  the time of hydrolysis in minutes. The difference between the β-galactosidase specific activities at 30°C and 45°C reflects the activity of the transcription factor σ 32 , and thus indirectly the decline of available DnaK, which if present would bind tightly to σ 32  and inactivate it.
Figure Legend Snippet: ( A–F ) Sedimentation profiles of ribosomal subunits prepared from strain MC4100 labelled with [ 3 H]-uridine for 1 h at 42°C (A), or 44°C (B), or 45°C (C) or 46°C (D), or from strain MC4100 pulse-labelled with [ 3 H]-uridine for 1 min at 30°C (E), or from strain BB1553 ( ΔdnaK ) labelled with [ 3 H]-uridine for 1 h at 37°C (F). In (E), pulse-labelling with [5- 3 H]-uridine (Amersham, TRK178) isotopically undiluted (28 Ci/mmol) for 1 min was abruptly terminated by the addition of NaN 3 to give a final concentration of 10 mM and by pouring onto an equal volume of crushed ice. Sedimentation is from right to left. A 260 /ml, open circles. [ 3 H] c.p.m. × 10 3 , filled circles. ( G ) Bacterial growth from strain SR6618 [MC4100 Φ( groESL::lacZ )] was followed by measuring the A 600 /ml of the culture at 30°C. At A 600 /ml = 0.25, half of the culture was shifted to 45°C, and bacterial samples were withdrawn from both cultures at every 20 min for β-galactosidase assays. ( H ) β-Galactosidase specific activities were measured following standard procedures ( 19 ), and expressed per A 600 /ml of the culture at 30°C or at 45°C, i.e. in Miller units, as follows = 1000 × A 420 /ml / t  ×  v  × A 600 /ml, where A 420 /ml measures the concentration of the orthonitrophenol produced by hydrolysis of ONPG (ortho-nitrophenyl-β-galactoside), v the volume of culture used in the assay in ml, and t the time of hydrolysis in minutes. The difference between the β-galactosidase specific activities at 30°C and 45°C reflects the activity of the transcription factor σ 32 , and thus indirectly the decline of available DnaK, which if present would bind tightly to σ 32 and inactivate it.

Techniques Used: Sedimentation, Concentration Assay, Produced, Activity Assay

49) Product Images from "Transcriptome-wide mapping of m6A and m6Am at single-nucleotide resolution using miCLIP"

Article Title: Transcriptome-wide mapping of m6A and m6Am at single-nucleotide resolution using miCLIP

Journal: Current protocols in molecular biology

doi: 10.1002/cpmb.88

Schematic of the miCLIP protocol. Capped (grey circle) and polyadenylated cellular RNA containing both m 6 Am (red triangle) and m 6 A (red circle) is fragmented and incubated with an anti-m 6 A antibody. Following UV-crosslinking, the antibody-RNA complexes are recovered using protein A/G-affinity beads and a 3’-adapter is ligated to the RNA. Antibody-RNA complexes are then purified by transferring to a nitrocellulose membrane and eluted using proteinase K, leaving only a small peptide fragment crosslinked at the m 6 A/m 6 Am site. RNA fragments are reverse transcribed, which results in mutations or truncations at the crosslink site in the resulting cDNA. Finally, the cDNA is circularized, re-linearized and amplified by PCR to generate final libraries for sequencing.
Figure Legend Snippet: Schematic of the miCLIP protocol. Capped (grey circle) and polyadenylated cellular RNA containing both m 6 Am (red triangle) and m 6 A (red circle) is fragmented and incubated with an anti-m 6 A antibody. Following UV-crosslinking, the antibody-RNA complexes are recovered using protein A/G-affinity beads and a 3’-adapter is ligated to the RNA. Antibody-RNA complexes are then purified by transferring to a nitrocellulose membrane and eluted using proteinase K, leaving only a small peptide fragment crosslinked at the m 6 A/m 6 Am site. RNA fragments are reverse transcribed, which results in mutations or truncations at the crosslink site in the resulting cDNA. Finally, the cDNA is circularized, re-linearized and amplified by PCR to generate final libraries for sequencing.

Techniques Used: Incubation, Purification, Transferring, Amplification, Polymerase Chain Reaction, Sequencing

50) Product Images from "Specificity of RppH-dependent RNA degradation in Bacillus subtilis"

Article Title: Specificity of RppH-dependent RNA degradation in Bacillus subtilis

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.1222670110

Effect of the sequence of the first three RNA nucleotides on RppH-dependent mRNA degradation in B. subtilis . The half-lives of mini yhxA-glpP mRNA and derivatives thereof with a substitution at the first, second, or third position were compared in isogenic
Figure Legend Snippet: Effect of the sequence of the first three RNA nucleotides on RppH-dependent mRNA degradation in B. subtilis . The half-lives of mini yhxA-glpP mRNA and derivatives thereof with a substitution at the first, second, or third position were compared in isogenic

Techniques Used: Sequencing

51) Product Images from "Developmental expression of non-coding RNAs in Chlamydia trachomatis during normal and persistent growth"

Article Title: Developmental expression of non-coding RNAs in Chlamydia trachomatis during normal and persistent growth

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkq1065

Analysis of the co-expression of the chlamydial ncRNA CTIG270 and the chlamydial ftsI gene in E. coli . ( A ) A schematic showing the location of CTIG270 and flanking genes. ( B) Results of co-expression assays. Samples were prepared using different co-induction protocols and samples were tested for the presence of the FtsI protein and mRNA and CTIG270 . The western blot was developed with an α-Flag-tag antibody. The same samples were run on SDS-Page gels as loading controls and stained with Coomassie Blue. Northern blots for ftsI and CT IG270 were done from RNA preparations from the same samples. The co-induction analysis is shown at the top of the figure. The first three lanes show the results when stimulation with arabinose for 5 h is followed by the addition of IPTG for different times (boxed region) as indicated. In the second set of three lanes, IPTG induction for 5 h was followed by induction with arabinose (boxed region) for the times indicated. In the third set of three lanes induction of both the ncRNA and ftsI were stimulated with IPTG and arabinose (boxed region) for the times indicated. The results indicated that expression of CTIG270 results in the degradation of ftsI mRNA. ( C) Co-expression controls in which the lanes shown are analogous to lane 9 in Figure 5 A in that both plasmids are co-induced for the same length of time. A truncated form of CTIG270 ( CTIG270 Δ ), which does not overlap the 3′-UTR of ftsI , is expressed in lane 1 but has no influence on the expression of FtsI. Expression of full-length CTIG270 however results in the degradation both ftsI mRNA and CTIG270 ( Figure 5 C, lane 2 and as shown in Figure 5 A). Expression of an unrelated ncRNA (IhtA) that acts on hctA mRNA ( 15 ) also has very little effect on the expression of FtsI (lane 3). Expression of FtsI was not affected by the presence of the empty vector pRANGER BTB (lane 4). ( D) Quantitative RT-PCR analysis of the expression profiles of ftsI and CTIG270 throughout the developmental cycle. Measurements were made in triplicate for each time point.
Figure Legend Snippet: Analysis of the co-expression of the chlamydial ncRNA CTIG270 and the chlamydial ftsI gene in E. coli . ( A ) A schematic showing the location of CTIG270 and flanking genes. ( B) Results of co-expression assays. Samples were prepared using different co-induction protocols and samples were tested for the presence of the FtsI protein and mRNA and CTIG270 . The western blot was developed with an α-Flag-tag antibody. The same samples were run on SDS-Page gels as loading controls and stained with Coomassie Blue. Northern blots for ftsI and CT IG270 were done from RNA preparations from the same samples. The co-induction analysis is shown at the top of the figure. The first three lanes show the results when stimulation with arabinose for 5 h is followed by the addition of IPTG for different times (boxed region) as indicated. In the second set of three lanes, IPTG induction for 5 h was followed by induction with arabinose (boxed region) for the times indicated. In the third set of three lanes induction of both the ncRNA and ftsI were stimulated with IPTG and arabinose (boxed region) for the times indicated. The results indicated that expression of CTIG270 results in the degradation of ftsI mRNA. ( C) Co-expression controls in which the lanes shown are analogous to lane 9 in Figure 5 A in that both plasmids are co-induced for the same length of time. A truncated form of CTIG270 ( CTIG270 Δ ), which does not overlap the 3′-UTR of ftsI , is expressed in lane 1 but has no influence on the expression of FtsI. Expression of full-length CTIG270 however results in the degradation both ftsI mRNA and CTIG270 ( Figure 5 C, lane 2 and as shown in Figure 5 A). Expression of an unrelated ncRNA (IhtA) that acts on hctA mRNA ( 15 ) also has very little effect on the expression of FtsI (lane 3). Expression of FtsI was not affected by the presence of the empty vector pRANGER BTB (lane 4). ( D) Quantitative RT-PCR analysis of the expression profiles of ftsI and CTIG270 throughout the developmental cycle. Measurements were made in triplicate for each time point.

Techniques Used: Expressing, Western Blot, FLAG-tag, SDS Page, Staining, Northern Blot, Plasmid Preparation, Quantitative RT-PCR

52) Product Images from "The 3?-Terminal 55 Nucleotides of Bovine Coronavirus Defective Interfering RNA Harbor Cis-Acting Elements Required for Both Negative- and Positive-Strand RNA Synthesis"

Article Title: The 3?-Terminal 55 Nucleotides of Bovine Coronavirus Defective Interfering RNA Harbor Cis-Acting Elements Required for Both Negative- and Positive-Strand RNA Synthesis

Journal: PLoS ONE

doi: 10.1371/journal.pone.0098422

Analysis of the requirement of 3′-terminal 55 nts for the synthesis of (−)-strand BCoV DI RNA. (A) Diagram of the BCoV DI RNA BM25A with the intact 3′-terminal 55 nts and the mutant construct Δ55 with the deletion of 3′-terminal 55 nts (denotes with dashes). (B) Detection of (–)-strand BCoV DI RNA with head-to-tail ligation and RT-PCR. RT-PCR products with a size of ∼150 bp were observed from BCoV-infected BM25A-transfected cells (lanes 2–8, arrowhead) but not from BCoV-infected Δ55-transfected cells (lanes 10-16). Lanes 18–21 represent the controls for RT-PCR. C1: total cellular RNA from mock-infected cells. C2: total cellular RNA from BCoV-infected cells. C3: total cellular RNA from DI RNA-transfected mock-infected cells. C4: a mixture of BCoV-infected cellular RNA extracted at 10 hpi and 200 ng of BM25A transcript. (C) Sequence of the cDNA-cloned RT-PCR product with a size of ∼150 bp from lane 5 in Fig. 3B . [shown in the (+)-strand]. (D) Detection of the potential recombination between the helper virus genome and DI RNA. The primers MHV3′ UTR2(+), which anneals to the MHV 3′ UTR and was used for RT, and M3(–), which anneals to BCoV M protein gene, were used for PCR to detect potential recombination between helper virus BCoV genome and BM25A (lane 2) or Δ55 (lane 3). A recombinant DNA of 1,639 nt shown in lane 4 was created by overlap RT-PCR and was used as a size marker for the product generated with the primers MHV 3′ UTR2(+) and M3(–). (E) Left panel: the relative levels of (–)-strand DI RNA synthesis as measured by qRT-PCR. Control A: total cellular RNA from mock-infected cells. Control B: total cellular RNA from BCoV-infected cells. Control C: total cellular RNA from DI RNA-transfected mock-infected cells. Control D: a mixture of BCoV-infected cellular RNA extracted at 10 hpi and 200 ng of BM25A transcript. Right panel: the amounts of DI RNA, helper virus N sgmRNA, and 18S rRNA from DI RNA-transfected BCoV-infected cells at 8 hpt of VP0 as measured by Northern blot assay. The values (E) represent the mean ±SD of three individual experiments. SD: standard deviation. ***p
Figure Legend Snippet: Analysis of the requirement of 3′-terminal 55 nts for the synthesis of (−)-strand BCoV DI RNA. (A) Diagram of the BCoV DI RNA BM25A with the intact 3′-terminal 55 nts and the mutant construct Δ55 with the deletion of 3′-terminal 55 nts (denotes with dashes). (B) Detection of (–)-strand BCoV DI RNA with head-to-tail ligation and RT-PCR. RT-PCR products with a size of ∼150 bp were observed from BCoV-infected BM25A-transfected cells (lanes 2–8, arrowhead) but not from BCoV-infected Δ55-transfected cells (lanes 10-16). Lanes 18–21 represent the controls for RT-PCR. C1: total cellular RNA from mock-infected cells. C2: total cellular RNA from BCoV-infected cells. C3: total cellular RNA from DI RNA-transfected mock-infected cells. C4: a mixture of BCoV-infected cellular RNA extracted at 10 hpi and 200 ng of BM25A transcript. (C) Sequence of the cDNA-cloned RT-PCR product with a size of ∼150 bp from lane 5 in Fig. 3B . [shown in the (+)-strand]. (D) Detection of the potential recombination between the helper virus genome and DI RNA. The primers MHV3′ UTR2(+), which anneals to the MHV 3′ UTR and was used for RT, and M3(–), which anneals to BCoV M protein gene, were used for PCR to detect potential recombination between helper virus BCoV genome and BM25A (lane 2) or Δ55 (lane 3). A recombinant DNA of 1,639 nt shown in lane 4 was created by overlap RT-PCR and was used as a size marker for the product generated with the primers MHV 3′ UTR2(+) and M3(–). (E) Left panel: the relative levels of (–)-strand DI RNA synthesis as measured by qRT-PCR. Control A: total cellular RNA from mock-infected cells. Control B: total cellular RNA from BCoV-infected cells. Control C: total cellular RNA from DI RNA-transfected mock-infected cells. Control D: a mixture of BCoV-infected cellular RNA extracted at 10 hpi and 200 ng of BM25A transcript. Right panel: the amounts of DI RNA, helper virus N sgmRNA, and 18S rRNA from DI RNA-transfected BCoV-infected cells at 8 hpt of VP0 as measured by Northern blot assay. The values (E) represent the mean ±SD of three individual experiments. SD: standard deviation. ***p

Techniques Used: Mutagenesis, Construct, Ligation, Reverse Transcription Polymerase Chain Reaction, Infection, Transfection, Sequencing, Clone Assay, Polymerase Chain Reaction, Recombinant, Marker, Generated, Quantitative RT-PCR, Northern Blot, Standard Deviation

53) Product Images from "Periplasmic Expression of TNF Related Apoptosis Inducing Ligand (TRAIL) in E.coli"

Article Title: Periplasmic Expression of TNF Related Apoptosis Inducing Ligand (TRAIL) in E.coli

Journal: Iranian Journal of Pharmaceutical Research : IJPR

doi:

Cloning of OmpA-TRAIL fragment in pET-22b expression plasmid. OmpA-TRAIL fragment and pET-22b plasmid were digested separately with restriction Enzymes Nde I and Xho I. Then, digested fragment and plasmid were ligated using T4 DNA ligase.
Figure Legend Snippet: Cloning of OmpA-TRAIL fragment in pET-22b expression plasmid. OmpA-TRAIL fragment and pET-22b plasmid were digested separately with restriction Enzymes Nde I and Xho I. Then, digested fragment and plasmid were ligated using T4 DNA ligase.

Techniques Used: Clone Assay, Positron Emission Tomography, Expressing, Plasmid Preparation

54) Product Images from "CLIP-seq to identify KSHV ORF57-binding RNA in host B cells"

Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells

Journal: Current protocols in microbiology

doi: 10.1002/cpmc.3

Agarose gel electrophoresis of the constructed ORF57 CLIP-seq libraries. CLIP-seq libraries were prepared from three independent RNA samples immunoprecipitated by ORF57 antibody. After PCR amplification, the final libraries were resolved on an E-Gel Ex 2% agarose gel. The lower bands are amplification products of self-circularized primers. The 200–350 bp region (highlighted in white boxes) was excised from the gel for high-throughput sequencing. M = 10 bp marker.
Figure Legend Snippet: Agarose gel electrophoresis of the constructed ORF57 CLIP-seq libraries. CLIP-seq libraries were prepared from three independent RNA samples immunoprecipitated by ORF57 antibody. After PCR amplification, the final libraries were resolved on an E-Gel Ex 2% agarose gel. The lower bands are amplification products of self-circularized primers. The 200–350 bp region (highlighted in white boxes) was excised from the gel for high-throughput sequencing. M = 10 bp marker.

Techniques Used: Agarose Gel Electrophoresis, Construct, Cross-linking Immunoprecipitation, Immunoprecipitation, Polymerase Chain Reaction, Amplification, Next-Generation Sequencing, Marker

55) Product Images from "SPlinted Ligation Adapter Tagging (SPLAT), a novel library preparation method for whole genome bisulphite sequencing"

Article Title: SPlinted Ligation Adapter Tagging (SPLAT), a novel library preparation method for whole genome bisulphite sequencing

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkw1110

Principles of library preparation methods for whole genome bisulphite sequencing. In the conventional workflow (MethylC-seq) methylated adapters are ligated to double stranded sheared DNA fragments. The constructs are then bisulphite converted prior to amplification with a uracil reading PCR polymerase. The Accel-NGS Methyl-Seq uses the proprietary Adaptase™ technology to attach a low complexity sequence tail to the 3΄-termini of pre-sheared and bisulphite-converted DNA, and an adapter sequence. After an extension step a second adapter is ligated and the libraries are PCR amplified. The TruSeq DNA Methylation method (formerly EpiGnome) uses random hexamer tagged oligonucleotides to simultaneously copy the bisulphite-converted strand and add a 5΄-terminal adaptor sequence. In a subsequent step, a 3΄-terminal adapter is tagged, also by using a random sequence oligonucleotide. In the SPLAT protocol adapters with a protruding random hexamer are annealed to the 3΄-termini of the single stranded DNA. The random hexamer acts as a ‘splint’ and the adapter sequence is ligated to the 3΄-termini of single stranded DNA using standard T4 DNA ligation. A modification of the last 3΄- residue of the random hexamer is required to prevent self-ligation of the adapter. In a second step, adapters with a 5΄-terminal random hexamer overhang is annealed to ligate the 5΄-termini of the single stranded DNA, also using T4 DNA ligase. Finally the SPLAT libraries are PCR amplified using a uracil reading polymerase.
Figure Legend Snippet: Principles of library preparation methods for whole genome bisulphite sequencing. In the conventional workflow (MethylC-seq) methylated adapters are ligated to double stranded sheared DNA fragments. The constructs are then bisulphite converted prior to amplification with a uracil reading PCR polymerase. The Accel-NGS Methyl-Seq uses the proprietary Adaptase™ technology to attach a low complexity sequence tail to the 3΄-termini of pre-sheared and bisulphite-converted DNA, and an adapter sequence. After an extension step a second adapter is ligated and the libraries are PCR amplified. The TruSeq DNA Methylation method (formerly EpiGnome) uses random hexamer tagged oligonucleotides to simultaneously copy the bisulphite-converted strand and add a 5΄-terminal adaptor sequence. In a subsequent step, a 3΄-terminal adapter is tagged, also by using a random sequence oligonucleotide. In the SPLAT protocol adapters with a protruding random hexamer are annealed to the 3΄-termini of the single stranded DNA. The random hexamer acts as a ‘splint’ and the adapter sequence is ligated to the 3΄-termini of single stranded DNA using standard T4 DNA ligation. A modification of the last 3΄- residue of the random hexamer is required to prevent self-ligation of the adapter. In a second step, adapters with a 5΄-terminal random hexamer overhang is annealed to ligate the 5΄-termini of the single stranded DNA, also using T4 DNA ligase. Finally the SPLAT libraries are PCR amplified using a uracil reading polymerase.

Techniques Used: Bisulfite Sequencing, Methylation, Construct, Amplification, Polymerase Chain Reaction, Next-Generation Sequencing, Sequencing, DNA Methylation Assay, Random Hexamer Labeling, DNA Ligation, Modification, Ligation

56) Product Images from "Duality of polynucleotide substrates for Phi29 DNA polymerase: 3′→5′ RNase activity of the enzyme"

Article Title: Duality of polynucleotide substrates for Phi29 DNA polymerase: 3′→5′ RNase activity of the enzyme

Journal: RNA

doi: 10.1261/rna.622108

The polarity of Phi29 DNA polymerase exoribonuclease activity. RNA hydrolysis studies were carried out under the conditions described in “Materials and Methods,” using 5′-end labeled ( A ) or 3′-end labeled ( B ) RNA1 oligonucleotides
Figure Legend Snippet: The polarity of Phi29 DNA polymerase exoribonuclease activity. RNA hydrolysis studies were carried out under the conditions described in “Materials and Methods,” using 5′-end labeled ( A ) or 3′-end labeled ( B ) RNA1 oligonucleotides

Techniques Used: Activity Assay, Labeling

3′→5′ Exonucleolytic activity of Phi29 DNA polymerase on RNA and DNA substrates. The experiments were performed under the conditions described in “Materials and Methods,” using 5′-end-labeled 16-mer DNA
Figure Legend Snippet: 3′→5′ Exonucleolytic activity of Phi29 DNA polymerase on RNA and DNA substrates. The experiments were performed under the conditions described in “Materials and Methods,” using 5′-end-labeled 16-mer DNA

Techniques Used: Activity Assay, Labeling

Phi29 DNA polymerase 3′→5′ exoribonuclease activity on the RNA–DNA hybrids. The RNA–DNA hybrid hydrolysis studies were carried out under the conditions described in “Materials and Methods,” using
Figure Legend Snippet: Phi29 DNA polymerase 3′→5′ exoribonuclease activity on the RNA–DNA hybrids. The RNA–DNA hybrid hydrolysis studies were carried out under the conditions described in “Materials and Methods,” using

Techniques Used: Activity Assay

Sequence comparison and active sites superposition of Phi29 DNA polymerase and RNaseT orthologs. ( A ), Escherichia
Figure Legend Snippet: Sequence comparison and active sites superposition of Phi29 DNA polymerase and RNaseT orthologs. ( A ), Escherichia

Techniques Used: Sequencing

The target RNA conversion into a primer for RCA. The experiments ( A ) were performed under the conditions described in “Materials and Methods.” The 5′-end-labeled RNA1–DNA hybrids were incubated with Phi29 DNA polymerase
Figure Legend Snippet: The target RNA conversion into a primer for RCA. The experiments ( A ) were performed under the conditions described in “Materials and Methods.” The 5′-end-labeled RNA1–DNA hybrids were incubated with Phi29 DNA polymerase

Techniques Used: Labeling, Incubation

( A ) Sequencing of Phi29 DNA polymerase 3′→5′ exoribonuclecleolytic degradation products. The experiments were performed under the conditions described in “Materials and Methods.” The RNA degradation products of
Figure Legend Snippet: ( A ) Sequencing of Phi29 DNA polymerase 3′→5′ exoribonuclecleolytic degradation products. The experiments were performed under the conditions described in “Materials and Methods.” The RNA degradation products of

Techniques Used: Sequencing

57) Product Images from "The pentatricopeptide repeat MTSF1 protein stabilizes the nad4 mRNA in Arabidopsis mitochondria"

Article Title: The pentatricopeptide repeat MTSF1 protein stabilizes the nad4 mRNA in Arabidopsis mitochondria

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkt337

3′ truncated nad4 mRNAs accumulate in mtsf1 plants. ( A ) Agarose gel showing circular RT-PCR amplification products for the nad4 gene in the wild-type (Col-0) and mstf1-1 mutant. M: DNA size marker, H 2 O: negative control. ( B ) Partial RNA sequence showing the last 60 nucleotides of nad4 mRNA. The region corresponding to the coding sequence is shown in capital letters. The rest corresponds to the 3′ UTR. The UGA stop codon is shown in bold. The arrows indicate the positions of the nad4 mRNA 3′ ends found in the wild-type (Col-0) and mtsf1-1 plants. Numbers on arrows represent how often a particular end was found after sub-cloning and sequencing the major band shown in panel A.
Figure Legend Snippet: 3′ truncated nad4 mRNAs accumulate in mtsf1 plants. ( A ) Agarose gel showing circular RT-PCR amplification products for the nad4 gene in the wild-type (Col-0) and mstf1-1 mutant. M: DNA size marker, H 2 O: negative control. ( B ) Partial RNA sequence showing the last 60 nucleotides of nad4 mRNA. The region corresponding to the coding sequence is shown in capital letters. The rest corresponds to the 3′ UTR. The UGA stop codon is shown in bold. The arrows indicate the positions of the nad4 mRNA 3′ ends found in the wild-type (Col-0) and mtsf1-1 plants. Numbers on arrows represent how often a particular end was found after sub-cloning and sequencing the major band shown in panel A.

Techniques Used: Agarose Gel Electrophoresis, Reverse Transcription Polymerase Chain Reaction, Amplification, Mutagenesis, Marker, Negative Control, Sequencing, Subcloning

58) Product Images from "The RNA methyltransferase Dnmt2 methylates DNA in the structural context of a tRNA"

Article Title: The RNA methyltransferase Dnmt2 methylates DNA in the structural context of a tRNA

Journal: RNA Biology

doi: 10.1080/15476286.2016.1236170

Methylation of an RNA-guided DNA oligonucleotide by Dnmt2. (A) Structure of the hybridized construct. DNA shown in red. (B) Average values and standard deviations of 3 tritium incorporation assays are shown.
Figure Legend Snippet: Methylation of an RNA-guided DNA oligonucleotide by Dnmt2. (A) Structure of the hybridized construct. DNA shown in red. (B) Average values and standard deviations of 3 tritium incorporation assays are shown.

Techniques Used: Methylation, Construct

(A) Two-dimensional thin-layer chromatography of nucleosides on a 10 cm x 10 cm cellulose TLC plate. The starting point is marked by an X. (B) Methylation of an RNA-guided DNA oligonucleotide by Dnmt2. The oligonucleotides were hydrolyzed to nucleosides after the tritium incorporation assay, separated by 2D thin-layer chromatography and analyzed with the Cherenkov counter. Tritium could only be detected in m 5 dC. Average values and standard deviations of 3 experiments are shown. Control corresponds to background signal of the TLC plate. Note that an identical Fig. S4 with enhanced contrast can be found in the supplement.
Figure Legend Snippet: (A) Two-dimensional thin-layer chromatography of nucleosides on a 10 cm x 10 cm cellulose TLC plate. The starting point is marked by an X. (B) Methylation of an RNA-guided DNA oligonucleotide by Dnmt2. The oligonucleotides were hydrolyzed to nucleosides after the tritium incorporation assay, separated by 2D thin-layer chromatography and analyzed with the Cherenkov counter. Tritium could only be detected in m 5 dC. Average values and standard deviations of 3 experiments are shown. Control corresponds to background signal of the TLC plate. Note that an identical Fig. S4 with enhanced contrast can be found in the supplement.

Techniques Used: Thin Layer Chromatography, Methylation

59) Product Images from "Programmable sequence-specific click-labeling of RNA using archaeal box C/D RNP methyltransferases"

Article Title: Programmable sequence-specific click-labeling of RNA using archaeal box C/D RNP methyltransferases

Journal: Nucleic Acids Research

doi: 10.1093/nar/gks381

Substrate selectivity of C/D RNP-directed labeling of RNA. The assay was performed as in Figure 3 B except that both the tRNA-Leu and rabbit β-globin pre-mRNA substrates were included in the reaction. RNA guides targeting A102, U168 and G308 in the pre-mRNA, and U17a and Ae3 in tRNA-Leu were used as indicated. M, DNA marker; R1, box C/D guide RNA; R2, tRNA-Leu; R3, rabbit β-globin pre-mRNA; ‘–’, control reaction with no guide RNA.
Figure Legend Snippet: Substrate selectivity of C/D RNP-directed labeling of RNA. The assay was performed as in Figure 3 B except that both the tRNA-Leu and rabbit β-globin pre-mRNA substrates were included in the reaction. RNA guides targeting A102, U168 and G308 in the pre-mRNA, and U17a and Ae3 in tRNA-Leu were used as indicated. M, DNA marker; R1, box C/D guide RNA; R2, tRNA-Leu; R3, rabbit β-globin pre-mRNA; ‘–’, control reaction with no guide RNA.

Techniques Used: Labeling, Marker

C/D RNP-dependent labeling of predetermined sites in a model tRNA substrate: ( A ) Schematic representation of P. abyssi tRNA-Leu(CAA) ( 41 ). Position of target nucleotide for the wt sR47 RNA (C34) is shown as an empty circle, and positions of newly programmed target nucleotides (U17a, A31, Ae3 and C56) are shown as filled circles. ( B ) Fluorescent sequence-specific labeling of tRNA via guide RNA-directed enzymatic propynylation and copper-assisted coupling of an Eterneon(480/635) azide. The reactions were resolved on a denaturing polyacrylamide gel, scanned with a 473 nm laser for Eterneon fluorescence (upper panel), and then stained with ethidium bromide to reveal bulk RNA (lower panel). M, DNA marker; R1, guide sR47 RNA; R2, unmodified tRNA; K1, control reaction without cofactor; K2, control reaction in the absence of C/D RNA. Bands corresponding to tRNA are shown by arrows. ( C ) Reverse transcription (RT) mapping of RNP modification sites. tRNA-Leu was modified in the presence of a C/D RNP and SeAdoYn cofactor followed by click coupling of an Eterneon fluorophore, as in B . RT primer extension analysis shows polymerase halting (arrows) one position ahead of the target (U17a or A31) nucleotides in samples labeled using corresponding guide RNAs.
Figure Legend Snippet: C/D RNP-dependent labeling of predetermined sites in a model tRNA substrate: ( A ) Schematic representation of P. abyssi tRNA-Leu(CAA) ( 41 ). Position of target nucleotide for the wt sR47 RNA (C34) is shown as an empty circle, and positions of newly programmed target nucleotides (U17a, A31, Ae3 and C56) are shown as filled circles. ( B ) Fluorescent sequence-specific labeling of tRNA via guide RNA-directed enzymatic propynylation and copper-assisted coupling of an Eterneon(480/635) azide. The reactions were resolved on a denaturing polyacrylamide gel, scanned with a 473 nm laser for Eterneon fluorescence (upper panel), and then stained with ethidium bromide to reveal bulk RNA (lower panel). M, DNA marker; R1, guide sR47 RNA; R2, unmodified tRNA; K1, control reaction without cofactor; K2, control reaction in the absence of C/D RNA. Bands corresponding to tRNA are shown by arrows. ( C ) Reverse transcription (RT) mapping of RNP modification sites. tRNA-Leu was modified in the presence of a C/D RNP and SeAdoYn cofactor followed by click coupling of an Eterneon fluorophore, as in B . RT primer extension analysis shows polymerase halting (arrows) one position ahead of the target (U17a or A31) nucleotides in samples labeled using corresponding guide RNAs.

Techniques Used: Labeling, Sequencing, Fluorescence, Staining, Marker, Modification

60) Product Images from "Human saliva, plasma and breast milk exosomes contain RNA: uptake by macrophages"

Article Title: Human saliva, plasma and breast milk exosomes contain RNA: uptake by macrophages

Journal: Journal of Translational Medicine

doi: 10.1186/1479-5876-9-9

Detection of mRNA in plasma exosomes using a Bioanalyzer. The exosomal RNA was transcribed to cDNA using an oligo (dT) primer. The results show that a portion of the RNA in plasma exosomes is mRNA. Arrows show the peaks for the lower and upper markers. The peaks in between these markers indicate the presence of cDNA synthesised from plasma exosomal RNA.
Figure Legend Snippet: Detection of mRNA in plasma exosomes using a Bioanalyzer. The exosomal RNA was transcribed to cDNA using an oligo (dT) primer. The results show that a portion of the RNA in plasma exosomes is mRNA. Arrows show the peaks for the lower and upper markers. The peaks in between these markers indicate the presence of cDNA synthesised from plasma exosomal RNA.

Techniques Used:

61) Product Images from "Direct detection of RNA in vitro and in situ by target-primed RCA: The impact of E. coli RNase III on the detection efficiency of RNA sequences distanced far from the 3?-end"

Article Title: Direct detection of RNA in vitro and in situ by target-primed RCA: The impact of E. coli RNase III on the detection efficiency of RNA sequences distanced far from the 3?-end

Journal: RNA

doi: 10.1261/rna.2068510

Detection of GAPDH transcripts in vitro, the impact of E. coli RNase III. The reactions were carried out with GAPDH-padlock probe duplexes ( A , duplexes 1–3) under the conditions described in Materials and Methods. ( B ) The oligonucleotides PP5 (panel 1 ) and PP10* (panel 2 ) were used as specific tools for the hGAPDH transcript detection in the human total RNA isolated from HeLa cells. The oligonucleotides PP6 (panel 1 ) and PP9* (panel 2 ) were used as controls for reaction specificity. The oligonucleotides PP9* and PP10* (panels 3.1 , 3.2 ) were used as probes for mGAPDH transcript detection and controls for reaction specificity, respectively, when testing mouse total RNAs isolated from the tongue (panel 3.1 ) and liver (panel 3.2 ) tissues. The RCA reactions were carried out in the absence or presence of E. coli RNase III (panels 1–3 ). The reaction products were monomerized by cleaving them with Mva1269I (panel 1 ) or LguI (panels 2 , 3.1 , 3.2 ) REases and analyzed by electrophoresis through a denaturing 8% polyacrylamide gel. The contents of samples are shown above the gel lines. The reaction products are labeled as “ a ,” “ b ,” and “ c ” for the 70-nt-long labeled monomers of RCA products obtained using transcript-padlock probe duplexes 1, 2, and 3, respectively ( A ).
Figure Legend Snippet: Detection of GAPDH transcripts in vitro, the impact of E. coli RNase III. The reactions were carried out with GAPDH-padlock probe duplexes ( A , duplexes 1–3) under the conditions described in Materials and Methods. ( B ) The oligonucleotides PP5 (panel 1 ) and PP10* (panel 2 ) were used as specific tools for the hGAPDH transcript detection in the human total RNA isolated from HeLa cells. The oligonucleotides PP6 (panel 1 ) and PP9* (panel 2 ) were used as controls for reaction specificity. The oligonucleotides PP9* and PP10* (panels 3.1 , 3.2 ) were used as probes for mGAPDH transcript detection and controls for reaction specificity, respectively, when testing mouse total RNAs isolated from the tongue (panel 3.1 ) and liver (panel 3.2 ) tissues. The RCA reactions were carried out in the absence or presence of E. coli RNase III (panels 1–3 ). The reaction products were monomerized by cleaving them with Mva1269I (panel 1 ) or LguI (panels 2 , 3.1 , 3.2 ) REases and analyzed by electrophoresis through a denaturing 8% polyacrylamide gel. The contents of samples are shown above the gel lines. The reaction products are labeled as “ a ,” “ b ,” and “ c ” for the 70-nt-long labeled monomers of RCA products obtained using transcript-padlock probe duplexes 1, 2, and 3, respectively ( A ).

Techniques Used: In Vitro, Isolation, Electrophoresis, Labeling

62) Product Images from "Effect of shRNA-mediated knockdown of vascular endothelial growth factor on the proliferation of choroid-retinal endothelial cells under hypoxic conditions"

Article Title: Effect of shRNA-mediated knockdown of vascular endothelial growth factor on the proliferation of choroid-retinal endothelial cells under hypoxic conditions

Journal: Experimental and Therapeutic Medicine

doi: 10.3892/etm.2015.2596

Diagram of the pSilencer 2.1-U6 neo plasmid vector.
Figure Legend Snippet: Diagram of the pSilencer 2.1-U6 neo plasmid vector.

Techniques Used: Plasmid Preparation

Diagram showing the sequence of the recombinant plasmid. Vascular endothelial growth factor short hairpin RNA was designed and synthesized, and the corresponding pSilencer 2.1-U6 neo-shRNA (p-shRNA) expression vector was constructed and identified using
Figure Legend Snippet: Diagram showing the sequence of the recombinant plasmid. Vascular endothelial growth factor short hairpin RNA was designed and synthesized, and the corresponding pSilencer 2.1-U6 neo-shRNA (p-shRNA) expression vector was constructed and identified using

Techniques Used: Sequencing, Recombinant, Plasmid Preparation, shRNA, Synthesized, Expressing, Construct

63) Product Images from "Improved efficiency of in situ protein analysis by proximity ligation using UnFold probes"

Article Title: Improved efficiency of in situ protein analysis by proximity ligation using UnFold probes

Journal: Scientific Reports

doi: 10.1038/s41598-018-23582-1

Schematic illustration of in situ PLA using conventional and UnFold probes. ( a ) Conventional in situ PLA. ( b ) In situ PLA using UnFold probes. (i) After pairs of primary antibodies have bound a pair of interacting proteins (red and green) followed by washes, secondary conventional or UnFold in situ PLA probes are added, followed after an incubation by renewed washes. (ii) In the conventional design under ( a ) two more oligonucleotides are then added that can form a DNA circle. Using the UnFold design in ( b ) the probe carrying a hairpin-loop oligonucleotide is cleaved at the U residues, liberating a free 5′ end capable of being ligated to the 3′ end of the same DNA strand. Meanwhile, the U residues in the hairpin DNA strand of the other UnFold probe are cleaved presenting a single-stranded template for the enzymatic joining of the ends of the strand on the first UnFold probe. (iii) A DNA ligase is added to form DNA circles in the two variants of in situ PLA. (iv) Finally, phi29 DNA polymerase is added to initiate RCA primed by oligonucleotides on one of the antibodies, and fluorescent oligonucleotides are used to visualize the RCA products.
Figure Legend Snippet: Schematic illustration of in situ PLA using conventional and UnFold probes. ( a ) Conventional in situ PLA. ( b ) In situ PLA using UnFold probes. (i) After pairs of primary antibodies have bound a pair of interacting proteins (red and green) followed by washes, secondary conventional or UnFold in situ PLA probes are added, followed after an incubation by renewed washes. (ii) In the conventional design under ( a ) two more oligonucleotides are then added that can form a DNA circle. Using the UnFold design in ( b ) the probe carrying a hairpin-loop oligonucleotide is cleaved at the U residues, liberating a free 5′ end capable of being ligated to the 3′ end of the same DNA strand. Meanwhile, the U residues in the hairpin DNA strand of the other UnFold probe are cleaved presenting a single-stranded template for the enzymatic joining of the ends of the strand on the first UnFold probe. (iii) A DNA ligase is added to form DNA circles in the two variants of in situ PLA. (iv) Finally, phi29 DNA polymerase is added to initiate RCA primed by oligonucleotides on one of the antibodies, and fluorescent oligonucleotides are used to visualize the RCA products.

Techniques Used: In Situ, Proximity Ligation Assay, Incubation

64) Product Images from "The role of deadenylation in the degradation of unstable mRNAs in trypanosomes"

Article Title: The role of deadenylation in the degradation of unstable mRNAs in trypanosomes

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkp571

Degradation of trypanosome EP1 mRNA is effected by deadenylation-dependent and -independent pathways. ( A ) mRNA synthesis was inhibited with Sinefungin and Actinomycin D in cells with inducible CAF1 RNAi, either without tetracycline or 18 h after tetracycline addition. Total RNA was prepared and the abundances of specific transcripts analysed by northern blotting. A typical blot is shown. Quantitation is on the right. Results are arithmetic mean and standard deviation for four independent experiments. The fitted lines were determined by assuming the presence of two exponential decay components and minimising deviation from the experimental observations (see Methods section). The parameters used to fit the curves are indicated as half-life in min, and the proportion of the RNA with that half-life. ( B ) As for A, but using cells with RNAi targeting PAN2 . Results are for three experiments, and P -values from a Student's t -test for the 30 min and 60 min time points are shown. ( C ) Degradation kinetics of EP mRNA in cells with normal or depleted XRNA . Data points for two independent experiments are shown, with a different symbol for each experiment. For the wild-type (no integrated RNAi construct), one experiment was included as a control. The curves are fitted to the arithmetic mean values.
Figure Legend Snippet: Degradation of trypanosome EP1 mRNA is effected by deadenylation-dependent and -independent pathways. ( A ) mRNA synthesis was inhibited with Sinefungin and Actinomycin D in cells with inducible CAF1 RNAi, either without tetracycline or 18 h after tetracycline addition. Total RNA was prepared and the abundances of specific transcripts analysed by northern blotting. A typical blot is shown. Quantitation is on the right. Results are arithmetic mean and standard deviation for four independent experiments. The fitted lines were determined by assuming the presence of two exponential decay components and minimising deviation from the experimental observations (see Methods section). The parameters used to fit the curves are indicated as half-life in min, and the proportion of the RNA with that half-life. ( B ) As for A, but using cells with RNAi targeting PAN2 . Results are for three experiments, and P -values from a Student's t -test for the 30 min and 60 min time points are shown. ( C ) Degradation kinetics of EP mRNA in cells with normal or depleted XRNA . Data points for two independent experiments are shown, with a different symbol for each experiment. For the wild-type (no integrated RNAi construct), one experiment was included as a control. The curves are fitted to the arithmetic mean values.

Techniques Used: Northern Blot, Quantitation Assay, Standard Deviation, Construct

PAN2 depletion inhibits deadenylation. ( A ) Trypanosome RNAs were 3′ labelled with [ 32 P]-pCp then digested with RNase T1 and RNase A to leave the poly(A) tails. The resulting RNA was separated on a denaturing polyacrylamide gel and the [ 32 P] was detected using a phosphorimager. The downward arrows indicate depletion of PAN2 by RNAi. The ‘+’ sign indicates that PAN2 is present (RNAi line in the absence of tetracycline). ( B ) Quantitation of (A). The poly(A) tails were divided into three size classes, as indicated on the right, and the signal from each class measured. The proportion of each class, relative to the total signal on the relevant lane, was then measured. This quantitation minimizes the effect of PAN2 depletion since it does not show the differences in total signal intensity between lanes. Results are the arithmetic mean of three independent measurements with standard deviations. Individual sets of three measurements that were significantly different in a Student's t -test ( P
Figure Legend Snippet: PAN2 depletion inhibits deadenylation. ( A ) Trypanosome RNAs were 3′ labelled with [ 32 P]-pCp then digested with RNase T1 and RNase A to leave the poly(A) tails. The resulting RNA was separated on a denaturing polyacrylamide gel and the [ 32 P] was detected using a phosphorimager. The downward arrows indicate depletion of PAN2 by RNAi. The ‘+’ sign indicates that PAN2 is present (RNAi line in the absence of tetracycline). ( B ) Quantitation of (A). The poly(A) tails were divided into three size classes, as indicated on the right, and the signal from each class measured. The proportion of each class, relative to the total signal on the relevant lane, was then measured. This quantitation minimizes the effect of PAN2 depletion since it does not show the differences in total signal intensity between lanes. Results are the arithmetic mean of three independent measurements with standard deviations. Individual sets of three measurements that were significantly different in a Student's t -test ( P

Techniques Used: Quantitation Assay

Degradation of the CAT-GC-EP reporter mRNA in trypanosomes. ( A ) Possible pathways of degradation. The CAT-GC-EP mRNA has, from 5′ to 3′, a cap (small circle), a short 5′UTR (white fill), a CAT open reading frame (black), a G 30 C 30 sequence, then the EP1 3′-UTR (white, with destabilising 26-mer in grey) and poly(A) tail (AAAA). ( 1 ) deadenylation as the first step in degradation (product ‘A’); ( 2 ) degradation of the deadenylated RNA from the 3′-end, pausing at the G 30 C 30 sequence to produce the CAT-GC intermediate (product ‘B’); ( 3 ) decapping of the deadenylated mRNA; product ‘C’, indistinguishable from ‘A’ by northern blotting; ( 4 ) degradation of product ‘C’ from the 5′-end, pausing at the G 30 C 30 sequence to give the deadenylated 3′ GC-EP RNA (product ‘E’); ( 5 ) decapping as the first step in degradation, to give product ‘F’, indistinguishable from the initial RNA by northern blotting; ( 6 ) degradation of product ‘F’ from the 5′-end, pausing at G 30 C 30 to give a polyadenylated 3′ GC-EP RNA (product ‘D’); ( 7 ) deadenylation of RNA ‘D’ to give RNA ‘E’. ( B ) The effect of inducible CAF1 RNAi on CAT-GC-EP mRNA degradation. CAF1+: cells without tetracycline; CAF1 with downward arrow: cells with tetracycline (19–21.5 h). Total RNA (T) was prepared and part of it was separated into poly(A)+ (A+) and poly(A)– (A–) fractions. The identities of the bands are shown on the left and sizes on the right. The upper panels were hybridized with an EP 3′-UTR riboprobe. This reproducibly cross-hybridizes with the smallest rRNA fragment. Although this signal has been cropped from the picture, it smears a little into the upper portions of the total and poly(A)– lanes. The lower panels are hybridizations with a CAT probe. The ratio of the CAT-GC fragment to the full-length mRNA fragment was measured in three experiments: for cells without tetracycline the average ratio was 21% (range 15–26%) and for CAF1 -depleted cells 14% (range 12–16%). The degradation fragments were detected readily only if we probed for them first: the upper and lower panels therefore originate from different experiments.
Figure Legend Snippet: Degradation of the CAT-GC-EP reporter mRNA in trypanosomes. ( A ) Possible pathways of degradation. The CAT-GC-EP mRNA has, from 5′ to 3′, a cap (small circle), a short 5′UTR (white fill), a CAT open reading frame (black), a G 30 C 30 sequence, then the EP1 3′-UTR (white, with destabilising 26-mer in grey) and poly(A) tail (AAAA). ( 1 ) deadenylation as the first step in degradation (product ‘A’); ( 2 ) degradation of the deadenylated RNA from the 3′-end, pausing at the G 30 C 30 sequence to produce the CAT-GC intermediate (product ‘B’); ( 3 ) decapping of the deadenylated mRNA; product ‘C’, indistinguishable from ‘A’ by northern blotting; ( 4 ) degradation of product ‘C’ from the 5′-end, pausing at the G 30 C 30 sequence to give the deadenylated 3′ GC-EP RNA (product ‘E’); ( 5 ) decapping as the first step in degradation, to give product ‘F’, indistinguishable from the initial RNA by northern blotting; ( 6 ) degradation of product ‘F’ from the 5′-end, pausing at G 30 C 30 to give a polyadenylated 3′ GC-EP RNA (product ‘D’); ( 7 ) deadenylation of RNA ‘D’ to give RNA ‘E’. ( B ) The effect of inducible CAF1 RNAi on CAT-GC-EP mRNA degradation. CAF1+: cells without tetracycline; CAF1 with downward arrow: cells with tetracycline (19–21.5 h). Total RNA (T) was prepared and part of it was separated into poly(A)+ (A+) and poly(A)– (A–) fractions. The identities of the bands are shown on the left and sizes on the right. The upper panels were hybridized with an EP 3′-UTR riboprobe. This reproducibly cross-hybridizes with the smallest rRNA fragment. Although this signal has been cropped from the picture, it smears a little into the upper portions of the total and poly(A)– lanes. The lower panels are hybridizations with a CAT probe. The ratio of the CAT-GC fragment to the full-length mRNA fragment was measured in three experiments: for cells without tetracycline the average ratio was 21% (range 15–26%) and for CAF1 -depleted cells 14% (range 12–16%). The degradation fragments were detected readily only if we probed for them first: the upper and lower panels therefore originate from different experiments.

Techniques Used: Sequencing, Northern Blot

65) Product Images from "The 3?-Terminal 55 Nucleotides of Bovine Coronavirus Defective Interfering RNA Harbor Cis-Acting Elements Required for Both Negative- and Positive-Strand RNA Synthesis"

Article Title: The 3?-Terminal 55 Nucleotides of Bovine Coronavirus Defective Interfering RNA Harbor Cis-Acting Elements Required for Both Negative- and Positive-Strand RNA Synthesis

Journal: PLoS ONE

doi: 10.1371/journal.pone.0098422

Identification of cis -acting RNA elements within the 3′-terminal 55 nts that are required for (−)- and (+)-strand RNA synthesis. (A) Constructs of deletion mutants within the 3′-terminal 55 nucleotides of BCoV DI RNA. Dashes denote deleted sequences. (B) The relative levels of (–)-strand DI RNA synthesis. Total cellular RNA was extracted from DI RNA-transfected BCoV-infected cells at 8 hpt. The synthesis of (–)-strand DI RNA from the deletion mutant was quantitated by qRT-PCR and was compared with that from wt BM25. Control A: total cellular RNA from mock-infected cells. Control B: total cellular RNA from BCoV-infected cells. Control C: total cellular RNA from DI RNA-transfected mock-infected cells. Control D: a mixture of BCoV-infected cellular RNA extracted at 10 hpi and 200 ng of BM25A transcript. (C) Upper panel: the synthesis of (+)-strand DI RNA as detected by Northern blot assay. Total cellular RNA was extracted at 48 hpi of VP1 and was subjected to Northern blot assay with N sgmRNA and 18S rRNA as internal controls. Middle panel: the relative levels of the (+)-strand DI RNA synthesis. Lower panel: the sequence of the BCoV DI RNA at 48 hpi of VP1 as determined by RT-PCR and sequencing analysis. The values (B) and (C) represent the mean ±SD of three individual experiments. SD: standard deviation, wt: wild type, mx: mixed, NA: not available. *p
Figure Legend Snippet: Identification of cis -acting RNA elements within the 3′-terminal 55 nts that are required for (−)- and (+)-strand RNA synthesis. (A) Constructs of deletion mutants within the 3′-terminal 55 nucleotides of BCoV DI RNA. Dashes denote deleted sequences. (B) The relative levels of (–)-strand DI RNA synthesis. Total cellular RNA was extracted from DI RNA-transfected BCoV-infected cells at 8 hpt. The synthesis of (–)-strand DI RNA from the deletion mutant was quantitated by qRT-PCR and was compared with that from wt BM25. Control A: total cellular RNA from mock-infected cells. Control B: total cellular RNA from BCoV-infected cells. Control C: total cellular RNA from DI RNA-transfected mock-infected cells. Control D: a mixture of BCoV-infected cellular RNA extracted at 10 hpi and 200 ng of BM25A transcript. (C) Upper panel: the synthesis of (+)-strand DI RNA as detected by Northern blot assay. Total cellular RNA was extracted at 48 hpi of VP1 and was subjected to Northern blot assay with N sgmRNA and 18S rRNA as internal controls. Middle panel: the relative levels of the (+)-strand DI RNA synthesis. Lower panel: the sequence of the BCoV DI RNA at 48 hpi of VP1 as determined by RT-PCR and sequencing analysis. The values (B) and (C) represent the mean ±SD of three individual experiments. SD: standard deviation, wt: wild type, mx: mixed, NA: not available. *p

Techniques Used: Construct, Transfection, Infection, Mutagenesis, Quantitative RT-PCR, Northern Blot, Sequencing, Reverse Transcription Polymerase Chain Reaction, Standard Deviation

Determination of cis -acting RNA elements between the nts −4 and −40 required for (−)- and (+)-strand RNA synthesis. (A) Deletion mutants of BCoV DI RNA. Dashes denote deleted sequences. (B) The relative levels of (−)-strand DI RNA synthesis. The synthesis of (−)-strand DI RNA from the deletion mutant was quantitated by qRT-PCR and was compared with that from wt BM25. Control A: total cellular RNA from mock-infected cells. Control B: total cellular RNA from BCoV-infected cells. Control C: total cellular RNA from DI RNA-transfected mock-infected cells. Control D: a mixture of BCoV-infected cellular RNA extracted at 10 hpi and 200 ng of BM25A transcript. (C) Upper panel: the synthesis of (+)-strand DI RNA as detected by Northern blot assay. Total cellular RNA was extracted at 48 hpi of VP1 and was subjected to Northern blot assay with N sgmRNA and 18S rRNA as internal controls. Middle panel: the relative levels of the (+)-strand DI RNA synthesis. Lower panel: the sequence of the BCoV DI RNA at 48 hpi of VP1 as determined by RT-PCR and sequencing analysis. The values (B) and (C) represent the mean ±SD of three individual experiments. SD: standard deviation, wt: wild type. **p
Figure Legend Snippet: Determination of cis -acting RNA elements between the nts −4 and −40 required for (−)- and (+)-strand RNA synthesis. (A) Deletion mutants of BCoV DI RNA. Dashes denote deleted sequences. (B) The relative levels of (−)-strand DI RNA synthesis. The synthesis of (−)-strand DI RNA from the deletion mutant was quantitated by qRT-PCR and was compared with that from wt BM25. Control A: total cellular RNA from mock-infected cells. Control B: total cellular RNA from BCoV-infected cells. Control C: total cellular RNA from DI RNA-transfected mock-infected cells. Control D: a mixture of BCoV-infected cellular RNA extracted at 10 hpi and 200 ng of BM25A transcript. (C) Upper panel: the synthesis of (+)-strand DI RNA as detected by Northern blot assay. Total cellular RNA was extracted at 48 hpi of VP1 and was subjected to Northern blot assay with N sgmRNA and 18S rRNA as internal controls. Middle panel: the relative levels of the (+)-strand DI RNA synthesis. Lower panel: the sequence of the BCoV DI RNA at 48 hpi of VP1 as determined by RT-PCR and sequencing analysis. The values (B) and (C) represent the mean ±SD of three individual experiments. SD: standard deviation, wt: wild type. **p

Techniques Used: Mutagenesis, Quantitative RT-PCR, Infection, Transfection, Northern Blot, Sequencing, Reverse Transcription Polymerase Chain Reaction, Standard Deviation

Effect of nucleotide species at the -1 position of 3′ terminal sequence in BCoV DI RNA on (−)- and (+)-strand RNA synthesis. (A) DI RNA constructs with nucleotide substitution (underlined) at the −1 position of 3′ terminal sequence. (B) The relative levels of (−)-strand DI RNA synthesis. BCoV-infected HRT-18 cells were transfected with the indicated DI RNA construct at 2 hpi, and the total cellular RNA was extracted at 8 hpt. The synthesis of the (−)-strand DI RNA from the substitution mutant was quantitated by qRT-PCR and compared with that from wt BM25A. Control A: total cellular RNA from mock-infected cells. Control B: total cellular RNA from BCoV-infected cells. Control C: total cellular RNA from DI RNA-transfected mock-infected cells. Control D: a mixture of BCoV-infected cellular RNA extracted at 10 hpi and 200 ng of BM25A transcript. (C) Upper panel: the synthesis of (+)-strand DI RNA as detected by Northern blot assay with N sgmRNA and 18S rRNA as internal controls. Middle panel: the relative levels of (+)-strand DI RNA synthesis. Lower panel: the sequence of the BCoV DI RNA at 48 hpi of VP1 as determined by RT-PCR and sequencing analysis. The values (B) and (C) represent the mean ±SD of three individual experiments. SD: standard deviation, wt: wild type, mut: mutant. *p
Figure Legend Snippet: Effect of nucleotide species at the -1 position of 3′ terminal sequence in BCoV DI RNA on (−)- and (+)-strand RNA synthesis. (A) DI RNA constructs with nucleotide substitution (underlined) at the −1 position of 3′ terminal sequence. (B) The relative levels of (−)-strand DI RNA synthesis. BCoV-infected HRT-18 cells were transfected with the indicated DI RNA construct at 2 hpi, and the total cellular RNA was extracted at 8 hpt. The synthesis of the (−)-strand DI RNA from the substitution mutant was quantitated by qRT-PCR and compared with that from wt BM25A. Control A: total cellular RNA from mock-infected cells. Control B: total cellular RNA from BCoV-infected cells. Control C: total cellular RNA from DI RNA-transfected mock-infected cells. Control D: a mixture of BCoV-infected cellular RNA extracted at 10 hpi and 200 ng of BM25A transcript. (C) Upper panel: the synthesis of (+)-strand DI RNA as detected by Northern blot assay with N sgmRNA and 18S rRNA as internal controls. Middle panel: the relative levels of (+)-strand DI RNA synthesis. Lower panel: the sequence of the BCoV DI RNA at 48 hpi of VP1 as determined by RT-PCR and sequencing analysis. The values (B) and (C) represent the mean ±SD of three individual experiments. SD: standard deviation, wt: wild type, mut: mutant. *p

Techniques Used: Sequencing, Construct, Infection, Transfection, Mutagenesis, Quantitative RT-PCR, Northern Blot, Reverse Transcription Polymerase Chain Reaction, Standard Deviation

66) Product Images from "SHAPE probing pictures Mg2+-dependent folding of small self-cleaving ribozymes"

Article Title: SHAPE probing pictures Mg2+-dependent folding of small self-cleaving ribozymes

Journal: Nucleic Acids Research

doi: 10.1093/nar/gky555

SHAPE probing of the env25 pistol ribozyme. ( A ) Secondary structure representations of the pistol RNA motif with 5′ and 3′ spacer sequences in gray. Red circles indicate highly conserved nucleosides. 3D structure (PDB accession number: 5K7C) using the same color code (right). ( B ) Typical gel for the probing of the pistol RNA structure with BzCN at 37°C. Lanes from left to right: T, C, G and A ladders, control in the absence of probing reagent, probing with BzCN, probing with BzCN and in the presence of 5, 10 and 20 mM MgCl 2 . Note that the fragment in the sequencing ladder that matches the size of the extension product defines the precise nucleotide that corresponds to +1 (therefore the color-coded stem-loop assignments at the right side of the gel is shifted +1 to nucleoside numbering on the left side). ( C–F ) Relative 2′-OH reactivity for selected bases obtained from quantification and normalization of the SHAPE probing results (mean of at least three independent experiments, error bars show standard deviation; two-sided paired t -test with ** P ≤ 0.01, * P ≤ 0.05, • P ≤ 0.1). For quantification of the SHAPE probing data for the complete env25 pistol RNA sequence see Supplementary Figure S5 . ( G ) Projection of SHAPE reactivities of individual nucleotides on the 3D structure of the pistol ribozyme (PDB accession number: 5K7C) following the color code as indicated in the legend.
Figure Legend Snippet: SHAPE probing of the env25 pistol ribozyme. ( A ) Secondary structure representations of the pistol RNA motif with 5′ and 3′ spacer sequences in gray. Red circles indicate highly conserved nucleosides. 3D structure (PDB accession number: 5K7C) using the same color code (right). ( B ) Typical gel for the probing of the pistol RNA structure with BzCN at 37°C. Lanes from left to right: T, C, G and A ladders, control in the absence of probing reagent, probing with BzCN, probing with BzCN and in the presence of 5, 10 and 20 mM MgCl 2 . Note that the fragment in the sequencing ladder that matches the size of the extension product defines the precise nucleotide that corresponds to +1 (therefore the color-coded stem-loop assignments at the right side of the gel is shifted +1 to nucleoside numbering on the left side). ( C–F ) Relative 2′-OH reactivity for selected bases obtained from quantification and normalization of the SHAPE probing results (mean of at least three independent experiments, error bars show standard deviation; two-sided paired t -test with ** P ≤ 0.01, * P ≤ 0.05, • P ≤ 0.1). For quantification of the SHAPE probing data for the complete env25 pistol RNA sequence see Supplementary Figure S5 . ( G ) Projection of SHAPE reactivities of individual nucleotides on the 3D structure of the pistol ribozyme (PDB accession number: 5K7C) following the color code as indicated in the legend.

Techniques Used: Sequencing, Standard Deviation

SHAPE probing of the env22 twister ribozyme. ( A ) Secondary structure representation of the twister RNA with 5′ and 3′ spacer sequences in gray (left). Red circles indicate highly conserved nucleosides. 3D structure (PDB accession number: 4RGE) using the same color code (right). ( B ) Typical gel for the probing of the twister RNA structure with BzCN at 37°C. Lanes from left to right: T, C, G and A ladders, control in the absence of probing reagent (DMSO), probing with BzCN, probing with BzCN and in the presence of either 5, 10 or 20 mM MgCl 2 . Note that the fragment in the sequencing ladder that matches the size of the extension product defines the precise nucleotide that corresponds to +1 (therefore the color-coded stem-loop assignments at the right side of the gel is shifted +1 to nucleoside numbering on the left side). ( C–F ) Relative 2′-OH reactivity for selected bases obtained from quantification and normalization of the SHAPE probing results (mean of at least three independent experiments, error bars show standard deviation; two-sided paired t -test with ** P ≤ 0.01, * P ≤ 0.05, • P ≤ 0.1). For quantification of the complete env22 twister RNA sequence see Supplementary Figure S3 . ( G ) Projection of SHAPE reactivities of individual nucleotides on the 3D structure of the twister ribozyme (PDB accession number: 4RGE) following the color code as indicated in the legend.
Figure Legend Snippet: SHAPE probing of the env22 twister ribozyme. ( A ) Secondary structure representation of the twister RNA with 5′ and 3′ spacer sequences in gray (left). Red circles indicate highly conserved nucleosides. 3D structure (PDB accession number: 4RGE) using the same color code (right). ( B ) Typical gel for the probing of the twister RNA structure with BzCN at 37°C. Lanes from left to right: T, C, G and A ladders, control in the absence of probing reagent (DMSO), probing with BzCN, probing with BzCN and in the presence of either 5, 10 or 20 mM MgCl 2 . Note that the fragment in the sequencing ladder that matches the size of the extension product defines the precise nucleotide that corresponds to +1 (therefore the color-coded stem-loop assignments at the right side of the gel is shifted +1 to nucleoside numbering on the left side). ( C–F ) Relative 2′-OH reactivity for selected bases obtained from quantification and normalization of the SHAPE probing results (mean of at least three independent experiments, error bars show standard deviation; two-sided paired t -test with ** P ≤ 0.01, * P ≤ 0.05, • P ≤ 0.1). For quantification of the complete env22 twister RNA sequence see Supplementary Figure S3 . ( G ) Projection of SHAPE reactivities of individual nucleotides on the 3D structure of the twister ribozyme (PDB accession number: 4RGE) following the color code as indicated in the legend.

Techniques Used: Sequencing, Standard Deviation

SHAPE probing of the TS ribozyme. ( A ) Secondary structure representations of the TS RNA motif with 5′ and 3′ spacer sequences in gray. Red circles indicate highly conserved nucleosides. 3D structure (PDB accession number: 5Y87) using the same color code (right). ( B ) Typical gel for the probing of the pistol RNA structure with BzCN at 37°C. Lanes from left to right: T, C, G and A ladders, control in the absence of probing reagent, probing with BzCN, probing with BzCN and in the presence of 5, 10 and 20 mM MgCl 2 . Note that the fragment in the sequencing ladder that matches the size of the extension product defines the precise nucleotide that corresponds to +1 (therefore the color-coded stem-loop assignments at the right side of the gel is shifted +1 to nucleoside numbering on the left side). ( C–E ) Relative 2′-OH reactivity for selected bases of PK T1 obtained from quantification and normalization of the SHAPE probing results (mean of at least three independent experiments, error bars show standard deviation; two-sided paired t -test with *** P ≤ 0.001, ** P ≤ 0.01, * P ≤ 0.05, • P ≤ 0.1). For quantification of the SHAPE probing data for the complete TS RNA sequence see Supplementary Figure S7 . ( F ) Projection of SHAPE reactivities of individual nucleotides on the 3D structure of the TS ribozyme (PDB accession number: 5Y87) following the color code as indicated in the legend.
Figure Legend Snippet: SHAPE probing of the TS ribozyme. ( A ) Secondary structure representations of the TS RNA motif with 5′ and 3′ spacer sequences in gray. Red circles indicate highly conserved nucleosides. 3D structure (PDB accession number: 5Y87) using the same color code (right). ( B ) Typical gel for the probing of the pistol RNA structure with BzCN at 37°C. Lanes from left to right: T, C, G and A ladders, control in the absence of probing reagent, probing with BzCN, probing with BzCN and in the presence of 5, 10 and 20 mM MgCl 2 . Note that the fragment in the sequencing ladder that matches the size of the extension product defines the precise nucleotide that corresponds to +1 (therefore the color-coded stem-loop assignments at the right side of the gel is shifted +1 to nucleoside numbering on the left side). ( C–E ) Relative 2′-OH reactivity for selected bases of PK T1 obtained from quantification and normalization of the SHAPE probing results (mean of at least three independent experiments, error bars show standard deviation; two-sided paired t -test with *** P ≤ 0.001, ** P ≤ 0.01, * P ≤ 0.05, • P ≤ 0.1). For quantification of the SHAPE probing data for the complete TS RNA sequence see Supplementary Figure S7 . ( F ) Projection of SHAPE reactivities of individual nucleotides on the 3D structure of the TS ribozyme (PDB accession number: 5Y87) following the color code as indicated in the legend.

Techniques Used: Sequencing, Standard Deviation

SHAPE probing of the hatchet ribozyme. ( A ) Secondary structure representations of the hatchet RNA motif with 5′ and 3′ spacer sequences in gray. ( B ) Typical gel for the probing of the pistol RNA structure with BzCN at 37°C. Lanes from left to right: T, C, G and A ladders, control in the absence of probing reagent, probing with BzCN, probing with BzCN and in the presence of 5, 10 and 20 mM MgCl 2 . Note that the fragment in the sequencing ladder that matches the size of the extension product defines the precise nucleotide that corresponds to +1 (therefore the color-coded stem-loop assignments at the right side of the gel is shifted +1 to nucleoside numbering on the left side). ( C–E ) Relative 2′-OH reactivity for selected bases obtained from quantification and normalization of the SHAPE probing results (mean of at least three independent experiments, error bars show standard deviation; two-sided paired t -test with ** P ≤ 0.01, * P ≤ 0.05, • P ≤ 0.1). For quantification of the SHAPE probing data for the complete hatchet RNA sequence see Supplementary Figure S9 . ( F ) Projection of SHAPE reactivities of individual nucleotides on the secondary structure model of the hatchet ribozyme following the color code as indicated in the legend.
Figure Legend Snippet: SHAPE probing of the hatchet ribozyme. ( A ) Secondary structure representations of the hatchet RNA motif with 5′ and 3′ spacer sequences in gray. ( B ) Typical gel for the probing of the pistol RNA structure with BzCN at 37°C. Lanes from left to right: T, C, G and A ladders, control in the absence of probing reagent, probing with BzCN, probing with BzCN and in the presence of 5, 10 and 20 mM MgCl 2 . Note that the fragment in the sequencing ladder that matches the size of the extension product defines the precise nucleotide that corresponds to +1 (therefore the color-coded stem-loop assignments at the right side of the gel is shifted +1 to nucleoside numbering on the left side). ( C–E ) Relative 2′-OH reactivity for selected bases obtained from quantification and normalization of the SHAPE probing results (mean of at least three independent experiments, error bars show standard deviation; two-sided paired t -test with ** P ≤ 0.01, * P ≤ 0.05, • P ≤ 0.1). For quantification of the SHAPE probing data for the complete hatchet RNA sequence see Supplementary Figure S9 . ( F ) Projection of SHAPE reactivities of individual nucleotides on the secondary structure model of the hatchet ribozyme following the color code as indicated in the legend.

Techniques Used: Sequencing, Standard Deviation

67) Product Images from "A Flexible RNA Backbone within the Polypyrimidine Tract Is Required for U2AF65 Binding and Pre-mRNA Splicing InVivo ▿"

Article Title: A Flexible RNA Backbone within the Polypyrimidine Tract Is Required for U2AF65 Binding and Pre-mRNA Splicing InVivo ▿

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.00531-10

Mapping of the important uridines within adenovirus pre-mRNA. (A) pre-mRNA splicing in Xenopus oocytes. Lanes 1 and 2 are uninjected pre-mRNAs, regularly transcribed (U) and with pseudouridine substitution (Ψ), respectively. Lanes 3 and 4 are
Figure Legend Snippet: Mapping of the important uridines within adenovirus pre-mRNA. (A) pre-mRNA splicing in Xenopus oocytes. Lanes 1 and 2 are uninjected pre-mRNAs, regularly transcribed (U) and with pseudouridine substitution (Ψ), respectively. Lanes 3 and 4 are

Techniques Used:

68) Product Images from "NSUN6 is a human RNA methyltransferase that catalyzes formation of m5C72 in specific tRNAs"

Article Title: NSUN6 is a human RNA methyltransferase that catalyzes formation of m5C72 in specific tRNAs

Journal: RNA

doi: 10.1261/rna.051524.115

NSUN6 crosslinks to tRNAs in vivo. ( A ) Schematic view of human NSUN6. The black line represents the NSUN6 protein; the predicted PUA RNA binding domain and the methyltransferase (MTase) domain are drawn as black boxes. The magnified view shows the amino
Figure Legend Snippet: NSUN6 crosslinks to tRNAs in vivo. ( A ) Schematic view of human NSUN6. The black line represents the NSUN6 protein; the predicted PUA RNA binding domain and the methyltransferase (MTase) domain are drawn as black boxes. The magnified view shows the amino

Techniques Used: In Vivo, RNA Binding Assay

69) Product Images from "The RNA methyltransferase Dnmt2 methylates DNA in the structural context of a tRNA"

Article Title: The RNA methyltransferase Dnmt2 methylates DNA in the structural context of a tRNA

Journal: RNA Biology

doi: 10.1080/15476286.2016.1236170

LC-MS analysis confirms that Dnmt2 methylates a tRNA containing a deoxycytidine at position 38. (A) Fragmentation patterns and mass transitions used for scanning of rm 5 C and dm 5 C in LC-MS. (B) LC-MS analysis of all-ribo tRNA Asp and hybrid tRNA Asp dC38 before and after in vitro methylation by human Dnmt2.
Figure Legend Snippet: LC-MS analysis confirms that Dnmt2 methylates a tRNA containing a deoxycytidine at position 38. (A) Fragmentation patterns and mass transitions used for scanning of rm 5 C and dm 5 C in LC-MS. (B) LC-MS analysis of all-ribo tRNA Asp and hybrid tRNA Asp dC38 before and after in vitro methylation by human Dnmt2.

Techniques Used: Liquid Chromatography with Mass Spectroscopy, In Vitro, Methylation

70) Product Images from "Histidine Kinase-Mediated Production and Autoassembly of Porphyromonas gingivalis Fimbriae ▿ Fimbriae ▿ †"

Article Title: Histidine Kinase-Mediated Production and Autoassembly of Porphyromonas gingivalis Fimbriae ▿ Fimbriae ▿ †

Journal: Journal of Bacteriology

doi: 10.1128/JB.01474-09

Reduced expression of fimSR and fim gene cluster in W83. (A) The structure of fimX-pgmA and fimA loci and the design of amplicons to be generated by RT-PCR. (B) Semiquantitative RT-PCR of fimA . After 22 PCR cycles with 300 ng of cDNA or 400 ng of RNA
Figure Legend Snippet: Reduced expression of fimSR and fim gene cluster in W83. (A) The structure of fimX-pgmA and fimA loci and the design of amplicons to be generated by RT-PCR. (B) Semiquantitative RT-PCR of fimA . After 22 PCR cycles with 300 ng of cDNA or 400 ng of RNA

Techniques Used: Expressing, Generated, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction

71) Product Images from "Secondary Structure across the Bacterial Transcriptome Reveals Versatile Roles in mRNA Regulation and Function"

Article Title: Secondary Structure across the Bacterial Transcriptome Reveals Versatile Roles in mRNA Regulation and Function

Journal: PLoS Genetics

doi: 10.1371/journal.pgen.1005613

PARS analysis. (A) Overview of modified PARS approach. RNase V1 cleaves double-stranded RNA and combination of RNases A/T1 the single stranded RNA with optimal activities at physiological pH (7.0). RNAse A/T1 usage requires an additional phosphorylation step prior to library generation. (B) The PARS score of the  rpoS  leader sequence (inset) was overlaid with the experimentally determined structure [  64 ]. Double-stranded nucleotides with positive PARS score are colored red, single-stranded nucleotides with negative PARS score–blue, nucleotides with missing PARS score or equal to zero–green. The color intensity of the  rpoS  nucleotides reflects the PARS scores (rainbow legend). (C) Metagene analysis of protein-coding transcripts. Average PARS score for each nucleotide (top) and GC content (bottom) across the 5’UTRs, CDS and 3’UTRs of all protein-coding transcripts, aligned at the start or stop codon, respectively. For the shaded areas the average PARS scores or GC content is calculated; thus note the deviations from the total GC content of 51% in  E .  coli . Unstructured region upstream of the start codon and structured sequence preceding the stop codon are marked by arrows with filled and open arrow heads, respectively.
Figure Legend Snippet: PARS analysis. (A) Overview of modified PARS approach. RNase V1 cleaves double-stranded RNA and combination of RNases A/T1 the single stranded RNA with optimal activities at physiological pH (7.0). RNAse A/T1 usage requires an additional phosphorylation step prior to library generation. (B) The PARS score of the rpoS leader sequence (inset) was overlaid with the experimentally determined structure [ 64 ]. Double-stranded nucleotides with positive PARS score are colored red, single-stranded nucleotides with negative PARS score–blue, nucleotides with missing PARS score or equal to zero–green. The color intensity of the rpoS nucleotides reflects the PARS scores (rainbow legend). (C) Metagene analysis of protein-coding transcripts. Average PARS score for each nucleotide (top) and GC content (bottom) across the 5’UTRs, CDS and 3’UTRs of all protein-coding transcripts, aligned at the start or stop codon, respectively. For the shaded areas the average PARS scores or GC content is calculated; thus note the deviations from the total GC content of 51% in E . coli . Unstructured region upstream of the start codon and structured sequence preceding the stop codon are marked by arrows with filled and open arrow heads, respectively.

Techniques Used: Modification, Sequencing

72) Product Images from "A central role for PI3K-AKT signaling pathway in linking SAMHD1-deficiency to the type I interferon signature"

Article Title: A central role for PI3K-AKT signaling pathway in linking SAMHD1-deficiency to the type I interferon signature

Journal: Scientific Reports

doi: 10.1038/s41598-017-18308-8

Accumulated RNAs in SAMHD1 -deficient cells function as immune stimuli. ( A , B ) PMA-differentiated wild-type THP-1 cells were stimulated with poly dA:dT, poly I:C, an equal amount (5 μg/ml) of isolated total DNA and RNA from wild-type and SAMHD1 -deficient cells, or left unstimulated ( A ). Total RNA isolated from wild-type and SAMHD1 -deficient cells were further size-fractionated and an equal amount of RNA from each fraction was used to stimulate PMA-differentiated wild-type THP-1 cells ( B ), followed by qRT-PCR analysis of IFN-α , IFN-β , IFITM1 and IL6 mRNA levels. ( C , D ) In vitro RNase activity assay for SAMHD1 immunopurified from undifferentiated THP-1 cells using A20 single-stranded RNA substrates. An isotype-matched control anti-IgG and anti-SAMHD1 antibodies were used for immunopurification. THP1 cells were infected with serial dilution of Vpx-loaded or control SIV VLPs ( D ). ( E ) qRT-PCR analysis of IFN-α in wild-type and SAMHD1 -deficient cells reconstituted with indicated SAMHD1 wild-type and mutant constructs. ( F ) Autoradiography of SAMHD1-RNA complex and western blotting of SAMHD1 protein immunoprecipitated from SAMHD1 CLIP. ( G ) Pie chart showing the distribution of statistically significant peaks (q
Figure Legend Snippet: Accumulated RNAs in SAMHD1 -deficient cells function as immune stimuli. ( A , B ) PMA-differentiated wild-type THP-1 cells were stimulated with poly dA:dT, poly I:C, an equal amount (5 μg/ml) of isolated total DNA and RNA from wild-type and SAMHD1 -deficient cells, or left unstimulated ( A ). Total RNA isolated from wild-type and SAMHD1 -deficient cells were further size-fractionated and an equal amount of RNA from each fraction was used to stimulate PMA-differentiated wild-type THP-1 cells ( B ), followed by qRT-PCR analysis of IFN-α , IFN-β , IFITM1 and IL6 mRNA levels. ( C , D ) In vitro RNase activity assay for SAMHD1 immunopurified from undifferentiated THP-1 cells using A20 single-stranded RNA substrates. An isotype-matched control anti-IgG and anti-SAMHD1 antibodies were used for immunopurification. THP1 cells were infected with serial dilution of Vpx-loaded or control SIV VLPs ( D ). ( E ) qRT-PCR analysis of IFN-α in wild-type and SAMHD1 -deficient cells reconstituted with indicated SAMHD1 wild-type and mutant constructs. ( F ) Autoradiography of SAMHD1-RNA complex and western blotting of SAMHD1 protein immunoprecipitated from SAMHD1 CLIP. ( G ) Pie chart showing the distribution of statistically significant peaks (q

Techniques Used: Isolation, Quantitative RT-PCR, In Vitro, Activity Assay, Immu-Puri, Infection, Serial Dilution, Mutagenesis, Construct, Autoradiography, Western Blot, Immunoprecipitation, Cross-linking Immunoprecipitation

73) Product Images from "A fast, efficient and sequence-independent method for flexible multiple segmental isotope labeling of RNA using ribozyme and RNase H cleavage"

Article Title: A fast, efficient and sequence-independent method for flexible multiple segmental isotope labeling of RNA using ribozyme and RNase H cleavage

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkq756

Principle, reaction efficiencies and NMR evidence for isotope labeling of each stem-loop of the RsmZ RNA separately. ( a ) Sequence-specific RNase H cleavages to obtain all four isotopically labeled stem-loop fragments. The yields of the cleavage reactions before HPLC purification are indicated, the values in brackets are expressing the yield after purification. The different stem-loops are colored (SL1: magenta, SL2: green, SL3: orange, SL4: cyan). ( b ) Splinted T4 DNA ligase mediated ligations of isotope labeled (in color) and unlabeled (in black) fragments. The unlabeled fragments were obtained in a similar way as the labeled fragments. ( c ) NMR evidence for the successful segmental isotope labeling of each stem-loop separately. 1 H- 15 N-HSQC NMR spectrum of the uniformly 15 N-labeled RsmZ RNA (left) and overlay of the 1 H- 15 N-HSQC NMR spectra of the four segmentally labeled RsmZ RNAs with each stem-loop labeled separately (right). The spectra were recorded on a Bruker 600 MHz spectrometer at 10°C.
Figure Legend Snippet: Principle, reaction efficiencies and NMR evidence for isotope labeling of each stem-loop of the RsmZ RNA separately. ( a ) Sequence-specific RNase H cleavages to obtain all four isotopically labeled stem-loop fragments. The yields of the cleavage reactions before HPLC purification are indicated, the values in brackets are expressing the yield after purification. The different stem-loops are colored (SL1: magenta, SL2: green, SL3: orange, SL4: cyan). ( b ) Splinted T4 DNA ligase mediated ligations of isotope labeled (in color) and unlabeled (in black) fragments. The unlabeled fragments were obtained in a similar way as the labeled fragments. ( c ) NMR evidence for the successful segmental isotope labeling of each stem-loop separately. 1 H- 15 N-HSQC NMR spectrum of the uniformly 15 N-labeled RsmZ RNA (left) and overlay of the 1 H- 15 N-HSQC NMR spectra of the four segmentally labeled RsmZ RNAs with each stem-loop labeled separately (right). The spectra were recorded on a Bruker 600 MHz spectrometer at 10°C.

Techniques Used: Nuclear Magnetic Resonance, Labeling, Sequencing, High Performance Liquid Chromatography, Purification, Expressing

74) Product Images from "Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain"

Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

Journal: PLoS ONE

doi: 10.1371/journal.pone.0039251

15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.
Figure Legend Snippet: 15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.

Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.
Figure Legend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.

Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Positive Control, Negative Control

12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.
Figure Legend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.

Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.
Figure Legend Snippet: The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.

Techniques Used: Polyacrylamide Gel Electrophoresis, Electrophoresis, Negative Control, Positive Control

75) Product Images from "A dumbbell probe-mediated rolling circle amplification strategy for highly sensitive microRNA detection"

Article Title: A dumbbell probe-mediated rolling circle amplification strategy for highly sensitive microRNA detection

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkq556

The D-RCA strategy for miRNA detection. A dumbbell probe contains three domains, an MBD, an SGBD and a loop domain. The binding of miRNA to MBD initiates RCA in the presence of T4 DNA ligase and phi29 polymerase, which generates a long DNA sequence that contains many SGBD for an amplified fluorescent readout.
Figure Legend Snippet: The D-RCA strategy for miRNA detection. A dumbbell probe contains three domains, an MBD, an SGBD and a loop domain. The binding of miRNA to MBD initiates RCA in the presence of T4 DNA ligase and phi29 polymerase, which generates a long DNA sequence that contains many SGBD for an amplified fluorescent readout.

Techniques Used: Binding Assay, Sequencing, Amplification

The expression levels of hsa-miR-21 in total RNA samples with the dumbbell probe of ( a ) 50 nM and ( b ) 25 nM. Negative controls (−L) were performed with identical conditions in total RNA samples (+) without adding T4 DNA ligase. Statistical analysis was performed by paired t -test. Error bars (SD) were estimated from three independent measurements.
Figure Legend Snippet: The expression levels of hsa-miR-21 in total RNA samples with the dumbbell probe of ( a ) 50 nM and ( b ) 25 nM. Negative controls (−L) were performed with identical conditions in total RNA samples (+) without adding T4 DNA ligase. Statistical analysis was performed by paired t -test. Error bars (SD) were estimated from three independent measurements.

Techniques Used: Expressing

Related Articles

Clone Assay:

Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
Article Snippet: Paragraph title: Cloning of the Hnf1 α, Hnf4 α, p45-Nf-E2 and Sp1 cDNAs ... Total RNA isolated (1μg) from mouse liver was reversely transcribed with the Superscript III reverse transcriptase kit primed with Oligo(dT) (Invitrogen). cDNAs were then PCR-amplified with the specific primers (see ), using the PCR Platinum Supermix (Invitrogen).

Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
Article Snippet: In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon. .. The products were cloned into plasmid pUC19b and 10 clones were sequenced for each reaction.

Amplification:

Article Title: Expansion of the human ?-opioid receptor gene architecture: novel functional variants
Article Snippet: .. The cDNAs were synthesized using 2–5 µg of total RNA with either cDNA Archive reverse transcription kit (ABI) or Superscript III reverse transcription kit (Invitrogen, Carlsbad, CA, USA), using random primer. cDNA samples were amplified using the GeneAmp XL (rTth DNA polymerase) PCR kit (ABI). .. The sequences of the human and mouse primers and amplification conditions are listed in the Supplementary Material, Table S4 .

Article Title: A Reverse Genetics System for Zika Virus Based on a Simple Molecular Cloning Strategy
Article Snippet: .. Viral RNA was isolated from cell lysates using the NucleoSpin RNA II kit (Machery-Nagel, Düren, Germany) and reverse transcribed using SuperScript III RT (Thermo Fisher Scientific Waltham, MA, USA). cDNA was amplified by PCR and amplicons were sequenced by Sanger sequencing (GATC Biotech, Constance, Germany) using primers spanning the complete ZIKV genome. .. Sequences of the 5′ and 3′UTRs were obtained by the rapid amplification of cDNA ends (RACE) using the 5′/3′ RACE second generation kit (Roche, Basel, Switzerland) with a polyA-tail added to the cDNA prior to the 3′ RACE reaction by using the poly(A) polymerase (New England Biolabs, Ipswich, MA, USA).

Article Title: Revolver is a New Class of Transposon-like Gene Composing the Triticeae Genome
Article Snippet: The primers for amplification of Revolver cDNA were designed from both ends of a positive cDNA clone. .. The single-strand cDNAs were synthesized from CapFishingTM adapter-added total RNA by SuperScript III reverse transcriptase (Invitrogen) using an oligo(dT) primer extended with 23 bp of 3′ Revolver sequence (5′-TTTTTTTTTTTTTTGGCACAACTCATGTAAAAGAGGG-3′).

Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
Article Snippet: In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon. .. DNA sequences were amplified by PCR with primers 5′-cggcctttattcacattct-3′ and 5′-gtgtagaaactgccggaa-3′.

Article Title: Identification of RNA silencing components in soybean and sorghum
Article Snippet: After treatment with DNase I, 5 μg RNA was reverse transcribed (RT) by the Superscript III reverse transcriptase (Invitrogen) using an oligo-T18 primer to generate cDNAs at 50°C for 1 hour. .. The resulting cDNAs was used as templates to perform PCR amplification with primers listed in Additional file : Table S3.

Article Title: Lysophosphatidic acid via LPA-receptor 5/protein kinase D-dependent pathways induces a motile and pro-inflammatory microglial phenotype
Article Snippet: RNA was reverse-transcribed using the SuperScript® III reverse transcription kit (Invitrogen, Waltham, MA, USA). qPCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR System using the QuantiTect SYBR® Green PCR kit (Qiagen, Hilden, Germany). .. Amplification of murine hypoxanthine-guanine phosphoribosyltransferase (HPRT) was performed on all samples as internal control for variations in messenger RNA (mRNA) concentration.

Synthesized:

Article Title: Expansion of the human ?-opioid receptor gene architecture: novel functional variants
Article Snippet: .. The cDNAs were synthesized using 2–5 µg of total RNA with either cDNA Archive reverse transcription kit (ABI) or Superscript III reverse transcription kit (Invitrogen, Carlsbad, CA, USA), using random primer. cDNA samples were amplified using the GeneAmp XL (rTth DNA polymerase) PCR kit (ABI). .. The sequences of the human and mouse primers and amplification conditions are listed in the Supplementary Material, Table S4 .

Article Title: Revolver is a New Class of Transposon-like Gene Composing the Triticeae Genome
Article Snippet: .. The single-strand cDNAs were synthesized from CapFishingTM adapter-added total RNA by SuperScript III reverse transcriptase (Invitrogen) using an oligo(dT) primer extended with 23 bp of 3′ Revolver sequence (5′-TTTTTTTTTTTTTTGGCACAACTCATGTAAAAGAGGG-3′). ..

TA Cloning:

Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
Article Snippet: Total RNA isolated (1μg) from mouse liver was reversely transcribed with the Superscript III reverse transcriptase kit primed with Oligo(dT) (Invitrogen). cDNAs were then PCR-amplified with the specific primers (see ), using the PCR Platinum Supermix (Invitrogen). .. Each PCR product was cloned into an expression vector, pTarget (Promega), using TA-cloning.

Construct:

Article Title: Transcriptome characterization via 454 pyrosequencing of the annelid Pristina leidyi, an emerging model for studying the evolution of regeneration
Article Snippet: .. RNA was extracted using TRIReagent (Applied Biosystems), and cDNA was constructed using random oligos and Superscript III reverse transcriptase (Invitrogen). .. Primers were constructed against the large subunit of rubisco (rbcL ) [GenBank:AY147205.1] and c-phycocyanin (cpc ) [GenBank:AF164139.1] genes of A. platensis (Additional file ).

Real-time Polymerase Chain Reaction:

Article Title: CXCR3 modulates glial accumulation and activation in cuprizone-induced demyelination of the central nervous system
Article Snippet: Paragraph title: Cytokine and chemokine mRNA determination by quantitative real-time polymerase chain reaction ... Up to 3 μg of total RNA was reverse-transcribed into cDNA by using SuperScript III Reverse Transcriptase (Invitrogen).

Article Title: RNA sequencing analysis reveals quiescent microglia isolation methods from postnatal mouse brains and limitations of BV2 cells
Article Snippet: .. Quantitative real-time PCR RNA was reverse-transcribed into cDNA using Superscript III Reverse Transcriptase (Invitrogen) with random hexamer primers. .. Transcript abundance was determined by quantitative PCR using SYBR Green PCR Mix (Applied Biosystems) with the following primer pairs: Tspo : GCCTACTTTGTACGTGGCGAG (F), CCTCCCAGCTCTTTCCAGAC (R); Ptgs2 : TTCAACACACTCTATCACTGGC (F), AGAAGCGTTTGCGGTACTCAT (R); Cd86 : TGTTTCCGTGGAGACGCAAG (F), TTGAGCCTTTGTAAATGGGCA (R); Tnfa : CCCTCACACTCAGATCATCTTCT (F), GCTACGACGTGGGCTACAG (R); Il6 : TAGTCCTTCCTACCCCAATTTCC (F), TTGGTCCTTAGCCACTCCTTC (R); Il1b : GCAACTGTTCCTGAACTCAACT (F), ATCTTTTGGGGTCCGTCAACT (R); Tgfb1 : CTCCCGTGGCTTCTAGTGC (F), GCCTTAGTTTGGACAGGATCTG (R); Tgfbr1 : TCTGCATTGCACTTATGCTGA (F), AAAGGGCGATCTAGTGATGGA (R); Tgfbr2 : CCGCTGCATATCGTCCTGTG (F), AGTGGATGGATGGTCCTATTACA (R); Serpine1 : TTCAGCCCTTGCTTGCCTC (F), ACACTTTTACTCCGAAGTCGGT (R); C5a : GAACAAACCTACGTCATTTCAGC (F), GTCAACAGTGCCGCGTTTT (R); C5ar1 : TACCATTAGTGCCGACCGTTT (F), CCGGTACACGAAGGATGGAAT (R); C5ar2 : CTGCTGTCTACCGTAGGCTG (F), AGAGGAATCGAACAGTGGTGA (R); Gapdh : AGGTCGGTGTGAACGGATTTG (F), TGTAGACCATGTAGTTGAGGTCA (R).

Article Title: The core genome m5C methyltransferase JHP1050 (M.Hpy99III) plays an important role in orchestrating gene expression in Helicobacter pylori
Article Snippet: .. Quantitative PCR (qPCR) One μg of RNA was used for cDNA synthesis using the SuperScript™ III Reverse Transcriptase (Thermo Fisher Scientific, Darmstadt, Germany) as described before ( ). qPCR was performed with gene specific primers ( ) and SYBR Green Master Mix (Qiagen, Hilden, Germany). .. Reactions were run in a BioRad CFX96 system.

Article Title: Lysophosphatidic acid via LPA-receptor 5/protein kinase D-dependent pathways induces a motile and pro-inflammatory microglial phenotype
Article Snippet: .. RNA was reverse-transcribed using the SuperScript® III reverse transcription kit (Invitrogen, Waltham, MA, USA). qPCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR System using the QuantiTect SYBR® Green PCR kit (Qiagen, Hilden, Germany). .. Amplification of murine hypoxanthine-guanine phosphoribosyltransferase (HPRT) was performed on all samples as internal control for variations in messenger RNA (mRNA) concentration.

Random Hexamer Labeling:

Article Title: RNA sequencing analysis reveals quiescent microglia isolation methods from postnatal mouse brains and limitations of BV2 cells
Article Snippet: .. Quantitative real-time PCR RNA was reverse-transcribed into cDNA using Superscript III Reverse Transcriptase (Invitrogen) with random hexamer primers. .. Transcript abundance was determined by quantitative PCR using SYBR Green PCR Mix (Applied Biosystems) with the following primer pairs: Tspo : GCCTACTTTGTACGTGGCGAG (F), CCTCCCAGCTCTTTCCAGAC (R); Ptgs2 : TTCAACACACTCTATCACTGGC (F), AGAAGCGTTTGCGGTACTCAT (R); Cd86 : TGTTTCCGTGGAGACGCAAG (F), TTGAGCCTTTGTAAATGGGCA (R); Tnfa : CCCTCACACTCAGATCATCTTCT (F), GCTACGACGTGGGCTACAG (R); Il6 : TAGTCCTTCCTACCCCAATTTCC (F), TTGGTCCTTAGCCACTCCTTC (R); Il1b : GCAACTGTTCCTGAACTCAACT (F), ATCTTTTGGGGTCCGTCAACT (R); Tgfb1 : CTCCCGTGGCTTCTAGTGC (F), GCCTTAGTTTGGACAGGATCTG (R); Tgfbr1 : TCTGCATTGCACTTATGCTGA (F), AAAGGGCGATCTAGTGATGGA (R); Tgfbr2 : CCGCTGCATATCGTCCTGTG (F), AGTGGATGGATGGTCCTATTACA (R); Serpine1 : TTCAGCCCTTGCTTGCCTC (F), ACACTTTTACTCCGAAGTCGGT (R); C5a : GAACAAACCTACGTCATTTCAGC (F), GTCAACAGTGCCGCGTTTT (R); C5ar1 : TACCATTAGTGCCGACCGTTT (F), CCGGTACACGAAGGATGGAAT (R); C5ar2 : CTGCTGTCTACCGTAGGCTG (F), AGAGGAATCGAACAGTGGTGA (R); Gapdh : AGGTCGGTGTGAACGGATTTG (F), TGTAGACCATGTAGTTGAGGTCA (R).

Expressing:

Article Title: CXCR3 modulates glial accumulation and activation in cuprizone-induced demyelination of the central nervous system
Article Snippet: Up to 3 μg of total RNA was reverse-transcribed into cDNA by using SuperScript III Reverse Transcriptase (Invitrogen). .. Real-time quantitative PCR assays were performed on a StepOnePlus Real-Time PCR System (Applied Biosystems) using TaqMan™ Gene Expression Assays (Applied Biosystems) for Gapdh, Plp1 , Mbp , Cnp , Cxcl9 , Cxcl10 , Tnf , Il6 , Ifng , Ccl2 , Ccl3 , Ccl5 .

Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
Article Snippet: Total RNA isolated (1μg) from mouse liver was reversely transcribed with the Superscript III reverse transcriptase kit primed with Oligo(dT) (Invitrogen). cDNAs were then PCR-amplified with the specific primers (see ), using the PCR Platinum Supermix (Invitrogen). .. Each PCR product was cloned into an expression vector, pTarget (Promega), using TA-cloning.

Article Title: Allelic methylation levels of the noncoding VTRNA2-1 located on chromosome 5q31.1 predict outcome in AML
Article Snippet: RNA was RT using SuperScript III Reverse Transcriptase (Invitrogen) and random hexamers (Promega). .. RT-quantitative PCR for miR886-3p and -5p was performed using TaqMan MicroRNA assays (Applied Biosystems), vtRNA2-1 expression was analyzed using TaqMan probes (Applied Biosystems).

Article Title: Lysophosphatidic acid via LPA-receptor 5/protein kinase D-dependent pathways induces a motile and pro-inflammatory microglial phenotype
Article Snippet: RNA was reverse-transcribed using the SuperScript® III reverse transcription kit (Invitrogen, Waltham, MA, USA). qPCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR System using the QuantiTect SYBR® Green PCR kit (Qiagen, Hilden, Germany). .. Expression profiles and associated statistical parameters were analyzed using the relative expression software tool (REST; http://www.gene-quantification.de/rest-index.html ) using a pairwise re-allocation test.

Derivative Assay:

Article Title: Transcriptome characterization via 454 pyrosequencing of the annelid Pristina leidyi, an emerging model for studying the evolution of regeneration
Article Snippet: Possible contamination by the dried Spirulina food source was assayed via PCR, using cDNA samples derived from live Arthrospira platensis (Spirulina) as a reference. .. RNA was extracted using TRIReagent (Applied Biosystems), and cDNA was constructed using random oligos and Superscript III reverse transcriptase (Invitrogen).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Revolver is a New Class of Transposon-like Gene Composing the Triticeae Genome
Article Snippet: Paragraph title: Reverse transcriptase–polymerase chain reaction (RT–PCR) ... The single-strand cDNAs were synthesized from CapFishingTM adapter-added total RNA by SuperScript III reverse transcriptase (Invitrogen) using an oligo(dT) primer extended with 23 bp of 3′ Revolver sequence (5′-TTTTTTTTTTTTTTGGCACAACTCATGTAAAAGAGGG-3′).

Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
Article Snippet: Paragraph title: RT-PCR, sequence analysis, RT-qPCR, and plasmid yield ... In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon.

Article Title: Identification of RNA silencing components in soybean and sorghum
Article Snippet: Paragraph title: RT-PCR analysis ... After treatment with DNase I, 5 μg RNA was reverse transcribed (RT) by the Superscript III reverse transcriptase (Invitrogen) using an oligo-T18 primer to generate cDNAs at 50°C for 1 hour.

Sequencing:

Article Title: Expansion of the human ?-opioid receptor gene architecture: novel functional variants
Article Snippet: The cDNAs were synthesized using 2–5 µg of total RNA with either cDNA Archive reverse transcription kit (ABI) or Superscript III reverse transcription kit (Invitrogen, Carlsbad, CA, USA), using random primer. cDNA samples were amplified using the GeneAmp XL (rTth DNA polymerase) PCR kit (ABI). .. The DNA sequence was determined by UNC-CH Genome Analysis Facility and compared with the predicted sequence of the 13th exon of the human OPRM1 and human genomic DNA (UCSC database).

Article Title: Transcriptome characterization via 454 pyrosequencing of the annelid Pristina leidyi, an emerging model for studying the evolution of regeneration
Article Snippet: Worm culture, sampling, and RNA extraction To generate material for this sequencing effort, we established twelve replicate lab cultures of a single clonal line of Pristina leidyi (PRIle(cbs)cloneA). .. RNA was extracted using TRIReagent (Applied Biosystems), and cDNA was constructed using random oligos and Superscript III reverse transcriptase (Invitrogen).

Article Title: A Reverse Genetics System for Zika Virus Based on a Simple Molecular Cloning Strategy
Article Snippet: .. Viral RNA was isolated from cell lysates using the NucleoSpin RNA II kit (Machery-Nagel, Düren, Germany) and reverse transcribed using SuperScript III RT (Thermo Fisher Scientific Waltham, MA, USA). cDNA was amplified by PCR and amplicons were sequenced by Sanger sequencing (GATC Biotech, Constance, Germany) using primers spanning the complete ZIKV genome. .. Sequences of the 5′ and 3′UTRs were obtained by the rapid amplification of cDNA ends (RACE) using the 5′/3′ RACE second generation kit (Roche, Basel, Switzerland) with a polyA-tail added to the cDNA prior to the 3′ RACE reaction by using the poly(A) polymerase (New England Biolabs, Ipswich, MA, USA).

Article Title: Revolver is a New Class of Transposon-like Gene Composing the Triticeae Genome
Article Snippet: .. The single-strand cDNAs were synthesized from CapFishingTM adapter-added total RNA by SuperScript III reverse transcriptase (Invitrogen) using an oligo(dT) primer extended with 23 bp of 3′ Revolver sequence (5′-TTTTTTTTTTTTTTGGCACAACTCATGTAAAAGAGGG-3′). ..

Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
Article Snippet: Total RNA isolated (1μg) from mouse liver was reversely transcribed with the Superscript III reverse transcriptase kit primed with Oligo(dT) (Invitrogen). cDNAs were then PCR-amplified with the specific primers (see ), using the PCR Platinum Supermix (Invitrogen). .. After cloning, the sequence of all cDNAs was verified by direct sequencing.

Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
Article Snippet: Paragraph title: RT-PCR, sequence analysis, RT-qPCR, and plasmid yield ... In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon.

In Vivo:

Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
Article Snippet: For the analysis of in vivo splicing reactions, total RNA was isolated from logarithmically growing E. coli cultures using the Nucleospin RNA II kit (Machery-Nagel). .. In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon.

Passaging:

Article Title: A Reverse Genetics System for Zika Virus Based on a Simple Molecular Cloning Strategy
Article Snippet: In addition, we amplified the MR766 and the H/PF/2013 strains (obtained from the European Virus Archive; Marseille, France) by passaging once in C6/36 mosquito cells and once in VeroE6 cells. .. Viral RNA was isolated from cell lysates using the NucleoSpin RNA II kit (Machery-Nagel, Düren, Germany) and reverse transcribed using SuperScript III RT (Thermo Fisher Scientific Waltham, MA, USA). cDNA was amplified by PCR and amplicons were sequenced by Sanger sequencing (GATC Biotech, Constance, Germany) using primers spanning the complete ZIKV genome.

Isolation:

Article Title: CXCR3 modulates glial accumulation and activation in cuprizone-induced demyelination of the central nervous system
Article Snippet: Cytokine and chemokine mRNA determination by quantitative real-time polymerase chain reaction Total RNA was isolated and purified from aliquots of homogenized brain samples using Trizol reagent (Sigma-Aldrich). .. Up to 3 μg of total RNA was reverse-transcribed into cDNA by using SuperScript III Reverse Transcriptase (Invitrogen).

Article Title: A Reverse Genetics System for Zika Virus Based on a Simple Molecular Cloning Strategy
Article Snippet: .. Viral RNA was isolated from cell lysates using the NucleoSpin RNA II kit (Machery-Nagel, Düren, Germany) and reverse transcribed using SuperScript III RT (Thermo Fisher Scientific Waltham, MA, USA). cDNA was amplified by PCR and amplicons were sequenced by Sanger sequencing (GATC Biotech, Constance, Germany) using primers spanning the complete ZIKV genome. .. Sequences of the 5′ and 3′UTRs were obtained by the rapid amplification of cDNA ends (RACE) using the 5′/3′ RACE second generation kit (Roche, Basel, Switzerland) with a polyA-tail added to the cDNA prior to the 3′ RACE reaction by using the poly(A) polymerase (New England Biolabs, Ipswich, MA, USA).

Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
Article Snippet: .. Total RNA isolated (1μg) from mouse liver was reversely transcribed with the Superscript III reverse transcriptase kit primed with Oligo(dT) (Invitrogen). cDNAs were then PCR-amplified with the specific primers (see ), using the PCR Platinum Supermix (Invitrogen). .. Each PCR product was cloned into an expression vector, pTarget (Promega), using TA-cloning.

Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
Article Snippet: For the analysis of in vivo splicing reactions, total RNA was isolated from logarithmically growing E. coli cultures using the Nucleospin RNA II kit (Machery-Nagel). .. In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon.

Purification:

Article Title: CXCR3 modulates glial accumulation and activation in cuprizone-induced demyelination of the central nervous system
Article Snippet: Cytokine and chemokine mRNA determination by quantitative real-time polymerase chain reaction Total RNA was isolated and purified from aliquots of homogenized brain samples using Trizol reagent (Sigma-Aldrich). .. Up to 3 μg of total RNA was reverse-transcribed into cDNA by using SuperScript III Reverse Transcriptase (Invitrogen).

Article Title: Revolver is a New Class of Transposon-like Gene Composing the Triticeae Genome
Article Snippet: The RT–PCR products were purified, ligated to the pGEM-T vector (Promega), and sequenced. .. The single-strand cDNAs were synthesized from CapFishingTM adapter-added total RNA by SuperScript III reverse transcriptase (Invitrogen) using an oligo(dT) primer extended with 23 bp of 3′ Revolver sequence (5′-TTTTTTTTTTTTTTGGCACAACTCATGTAAAAGAGGG-3′).

Polymerase Chain Reaction:

Article Title: Expansion of the human ?-opioid receptor gene architecture: novel functional variants
Article Snippet: .. The cDNAs were synthesized using 2–5 µg of total RNA with either cDNA Archive reverse transcription kit (ABI) or Superscript III reverse transcription kit (Invitrogen, Carlsbad, CA, USA), using random primer. cDNA samples were amplified using the GeneAmp XL (rTth DNA polymerase) PCR kit (ABI). .. The sequences of the human and mouse primers and amplification conditions are listed in the Supplementary Material, Table S4 .

Article Title: Transcriptome characterization via 454 pyrosequencing of the annelid Pristina leidyi, an emerging model for studying the evolution of regeneration
Article Snippet: Possible contamination by the dried Spirulina food source was assayed via PCR, using cDNA samples derived from live Arthrospira platensis (Spirulina) as a reference. .. RNA was extracted using TRIReagent (Applied Biosystems), and cDNA was constructed using random oligos and Superscript III reverse transcriptase (Invitrogen).

Article Title: RNA sequencing analysis reveals quiescent microglia isolation methods from postnatal mouse brains and limitations of BV2 cells
Article Snippet: Quantitative real-time PCR RNA was reverse-transcribed into cDNA using Superscript III Reverse Transcriptase (Invitrogen) with random hexamer primers. .. Transcript abundance was determined by quantitative PCR using SYBR Green PCR Mix (Applied Biosystems) with the following primer pairs: Tspo : GCCTACTTTGTACGTGGCGAG (F), CCTCCCAGCTCTTTCCAGAC (R); Ptgs2 : TTCAACACACTCTATCACTGGC (F), AGAAGCGTTTGCGGTACTCAT (R); Cd86 : TGTTTCCGTGGAGACGCAAG (F), TTGAGCCTTTGTAAATGGGCA (R); Tnfa : CCCTCACACTCAGATCATCTTCT (F), GCTACGACGTGGGCTACAG (R); Il6 : TAGTCCTTCCTACCCCAATTTCC (F), TTGGTCCTTAGCCACTCCTTC (R); Il1b : GCAACTGTTCCTGAACTCAACT (F), ATCTTTTGGGGTCCGTCAACT (R); Tgfb1 : CTCCCGTGGCTTCTAGTGC (F), GCCTTAGTTTGGACAGGATCTG (R); Tgfbr1 : TCTGCATTGCACTTATGCTGA (F), AAAGGGCGATCTAGTGATGGA (R); Tgfbr2 : CCGCTGCATATCGTCCTGTG (F), AGTGGATGGATGGTCCTATTACA (R); Serpine1 : TTCAGCCCTTGCTTGCCTC (F), ACACTTTTACTCCGAAGTCGGT (R); C5a : GAACAAACCTACGTCATTTCAGC (F), GTCAACAGTGCCGCGTTTT (R); C5ar1 : TACCATTAGTGCCGACCGTTT (F), CCGGTACACGAAGGATGGAAT (R); C5ar2 : CTGCTGTCTACCGTAGGCTG (F), AGAGGAATCGAACAGTGGTGA (R); Gapdh : AGGTCGGTGTGAACGGATTTG (F), TGTAGACCATGTAGTTGAGGTCA (R).

Article Title: A Reverse Genetics System for Zika Virus Based on a Simple Molecular Cloning Strategy
Article Snippet: .. Viral RNA was isolated from cell lysates using the NucleoSpin RNA II kit (Machery-Nagel, Düren, Germany) and reverse transcribed using SuperScript III RT (Thermo Fisher Scientific Waltham, MA, USA). cDNA was amplified by PCR and amplicons were sequenced by Sanger sequencing (GATC Biotech, Constance, Germany) using primers spanning the complete ZIKV genome. .. Sequences of the 5′ and 3′UTRs were obtained by the rapid amplification of cDNA ends (RACE) using the 5′/3′ RACE second generation kit (Roche, Basel, Switzerland) with a polyA-tail added to the cDNA prior to the 3′ RACE reaction by using the poly(A) polymerase (New England Biolabs, Ipswich, MA, USA).

Article Title: Revolver is a New Class of Transposon-like Gene Composing the Triticeae Genome
Article Snippet: The PCR reaction program consisted of 30 cycles of 30 s at 95°C, 30 s at 63°C, 1 min at 72°C. .. The single-strand cDNAs were synthesized from CapFishingTM adapter-added total RNA by SuperScript III reverse transcriptase (Invitrogen) using an oligo(dT) primer extended with 23 bp of 3′ Revolver sequence (5′-TTTTTTTTTTTTTTGGCACAACTCATGTAAAAGAGGG-3′).

Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
Article Snippet: .. Total RNA isolated (1μg) from mouse liver was reversely transcribed with the Superscript III reverse transcriptase kit primed with Oligo(dT) (Invitrogen). cDNAs were then PCR-amplified with the specific primers (see ), using the PCR Platinum Supermix (Invitrogen). .. Each PCR product was cloned into an expression vector, pTarget (Promega), using TA-cloning.

Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
Article Snippet: In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon. .. DNA sequences were amplified by PCR with primers 5′-cggcctttattcacattct-3′ and 5′-gtgtagaaactgccggaa-3′.

Article Title: Allelic methylation levels of the noncoding VTRNA2-1 located on chromosome 5q31.1 predict outcome in AML
Article Snippet: RNA was RT using SuperScript III Reverse Transcriptase (Invitrogen) and random hexamers (Promega). .. RT-quantitative PCR for miR886-3p and -5p was performed using TaqMan MicroRNA assays (Applied Biosystems), vtRNA2-1 expression was analyzed using TaqMan probes (Applied Biosystems).

Article Title: Identification of RNA silencing components in soybean and sorghum
Article Snippet: After treatment with DNase I, 5 μg RNA was reverse transcribed (RT) by the Superscript III reverse transcriptase (Invitrogen) using an oligo-T18 primer to generate cDNAs at 50°C for 1 hour. .. The resulting cDNAs was used as templates to perform PCR amplification with primers listed in Additional file : Table S3.

Article Title: Lysophosphatidic acid via LPA-receptor 5/protein kinase D-dependent pathways induces a motile and pro-inflammatory microglial phenotype
Article Snippet: .. RNA was reverse-transcribed using the SuperScript® III reverse transcription kit (Invitrogen, Waltham, MA, USA). qPCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR System using the QuantiTect SYBR® Green PCR kit (Qiagen, Hilden, Germany). .. Amplification of murine hypoxanthine-guanine phosphoribosyltransferase (HPRT) was performed on all samples as internal control for variations in messenger RNA (mRNA) concentration.

Quantitative RT-PCR:

Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
Article Snippet: Paragraph title: RT-PCR, sequence analysis, RT-qPCR, and plasmid yield ... In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon.

Article Title: Allelic methylation levels of the noncoding VTRNA2-1 located on chromosome 5q31.1 predict outcome in AML
Article Snippet: Paragraph title: RT-qPCR ... RNA was RT using SuperScript III Reverse Transcriptase (Invitrogen) and random hexamers (Promega).

Chloramphenicol Acetyltransferase Assay:

Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
Article Snippet: .. In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon. .. DNA sequences were amplified by PCR with primers 5′-cggcctttattcacattct-3′ and 5′-gtgtagaaactgccggaa-3′.

Rapid Amplification of cDNA Ends:

Article Title: A Reverse Genetics System for Zika Virus Based on a Simple Molecular Cloning Strategy
Article Snippet: Viral RNA was isolated from cell lysates using the NucleoSpin RNA II kit (Machery-Nagel, Düren, Germany) and reverse transcribed using SuperScript III RT (Thermo Fisher Scientific Waltham, MA, USA). cDNA was amplified by PCR and amplicons were sequenced by Sanger sequencing (GATC Biotech, Constance, Germany) using primers spanning the complete ZIKV genome. .. Sequences of the 5′ and 3′UTRs were obtained by the rapid amplification of cDNA ends (RACE) using the 5′/3′ RACE second generation kit (Roche, Basel, Switzerland) with a polyA-tail added to the cDNA prior to the 3′ RACE reaction by using the poly(A) polymerase (New England Biolabs, Ipswich, MA, USA).

Plasmid Preparation:

Article Title: Revolver is a New Class of Transposon-like Gene Composing the Triticeae Genome
Article Snippet: The RT–PCR products were purified, ligated to the pGEM-T vector (Promega), and sequenced. .. The single-strand cDNAs were synthesized from CapFishingTM adapter-added total RNA by SuperScript III reverse transcriptase (Invitrogen) using an oligo(dT) primer extended with 23 bp of 3′ Revolver sequence (5′-TTTTTTTTTTTTTTGGCACAACTCATGTAAAAGAGGG-3′).

Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
Article Snippet: Total RNA isolated (1μg) from mouse liver was reversely transcribed with the Superscript III reverse transcriptase kit primed with Oligo(dT) (Invitrogen). cDNAs were then PCR-amplified with the specific primers (see ), using the PCR Platinum Supermix (Invitrogen). .. Each PCR product was cloned into an expression vector, pTarget (Promega), using TA-cloning.

Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
Article Snippet: Paragraph title: RT-PCR, sequence analysis, RT-qPCR, and plasmid yield ... In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon.

Software:

Article Title: Lysophosphatidic acid via LPA-receptor 5/protein kinase D-dependent pathways induces a motile and pro-inflammatory microglial phenotype
Article Snippet: RNA was reverse-transcribed using the SuperScript® III reverse transcription kit (Invitrogen, Waltham, MA, USA). qPCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR System using the QuantiTect SYBR® Green PCR kit (Qiagen, Hilden, Germany). .. Expression profiles and associated statistical parameters were analyzed using the relative expression software tool (REST; http://www.gene-quantification.de/rest-index.html ) using a pairwise re-allocation test.

SYBR Green Assay:

Article Title: RNA sequencing analysis reveals quiescent microglia isolation methods from postnatal mouse brains and limitations of BV2 cells
Article Snippet: Quantitative real-time PCR RNA was reverse-transcribed into cDNA using Superscript III Reverse Transcriptase (Invitrogen) with random hexamer primers. .. Transcript abundance was determined by quantitative PCR using SYBR Green PCR Mix (Applied Biosystems) with the following primer pairs: Tspo : GCCTACTTTGTACGTGGCGAG (F), CCTCCCAGCTCTTTCCAGAC (R); Ptgs2 : TTCAACACACTCTATCACTGGC (F), AGAAGCGTTTGCGGTACTCAT (R); Cd86 : TGTTTCCGTGGAGACGCAAG (F), TTGAGCCTTTGTAAATGGGCA (R); Tnfa : CCCTCACACTCAGATCATCTTCT (F), GCTACGACGTGGGCTACAG (R); Il6 : TAGTCCTTCCTACCCCAATTTCC (F), TTGGTCCTTAGCCACTCCTTC (R); Il1b : GCAACTGTTCCTGAACTCAACT (F), ATCTTTTGGGGTCCGTCAACT (R); Tgfb1 : CTCCCGTGGCTTCTAGTGC (F), GCCTTAGTTTGGACAGGATCTG (R); Tgfbr1 : TCTGCATTGCACTTATGCTGA (F), AAAGGGCGATCTAGTGATGGA (R); Tgfbr2 : CCGCTGCATATCGTCCTGTG (F), AGTGGATGGATGGTCCTATTACA (R); Serpine1 : TTCAGCCCTTGCTTGCCTC (F), ACACTTTTACTCCGAAGTCGGT (R); C5a : GAACAAACCTACGTCATTTCAGC (F), GTCAACAGTGCCGCGTTTT (R); C5ar1 : TACCATTAGTGCCGACCGTTT (F), CCGGTACACGAAGGATGGAAT (R); C5ar2 : CTGCTGTCTACCGTAGGCTG (F), AGAGGAATCGAACAGTGGTGA (R); Gapdh : AGGTCGGTGTGAACGGATTTG (F), TGTAGACCATGTAGTTGAGGTCA (R).

Article Title: The core genome m5C methyltransferase JHP1050 (M.Hpy99III) plays an important role in orchestrating gene expression in Helicobacter pylori
Article Snippet: .. Quantitative PCR (qPCR) One μg of RNA was used for cDNA synthesis using the SuperScript™ III Reverse Transcriptase (Thermo Fisher Scientific, Darmstadt, Germany) as described before ( ). qPCR was performed with gene specific primers ( ) and SYBR Green Master Mix (Qiagen, Hilden, Germany). .. Reactions were run in a BioRad CFX96 system.

Article Title: Lysophosphatidic acid via LPA-receptor 5/protein kinase D-dependent pathways induces a motile and pro-inflammatory microglial phenotype
Article Snippet: .. RNA was reverse-transcribed using the SuperScript® III reverse transcription kit (Invitrogen, Waltham, MA, USA). qPCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR System using the QuantiTect SYBR® Green PCR kit (Qiagen, Hilden, Germany). .. Amplification of murine hypoxanthine-guanine phosphoribosyltransferase (HPRT) was performed on all samples as internal control for variations in messenger RNA (mRNA) concentration.

RNA Extraction:

Article Title: Transcriptome characterization via 454 pyrosequencing of the annelid Pristina leidyi, an emerging model for studying the evolution of regeneration
Article Snippet: Paragraph title: Worm culture, sampling, and RNA extraction ... RNA was extracted using TRIReagent (Applied Biosystems), and cDNA was constructed using random oligos and Superscript III reverse transcriptase (Invitrogen).

In Vitro:

Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
Article Snippet: .. In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon. .. DNA sequences were amplified by PCR with primers 5′-cggcctttattcacattct-3′ and 5′-gtgtagaaactgccggaa-3′.

Incubation:

Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
Article Snippet: .. In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon. .. DNA sequences were amplified by PCR with primers 5′-cggcctttattcacattct-3′ and 5′-gtgtagaaactgccggaa-3′.

Article Title: Lysophosphatidic acid via LPA-receptor 5/protein kinase D-dependent pathways induces a motile and pro-inflammatory microglial phenotype
Article Snippet: As negative controls, cells were incubated in serum-free medium in the presence of 0.1% BSA or DMSO. .. RNA was reverse-transcribed using the SuperScript® III reverse transcription kit (Invitrogen, Waltham, MA, USA). qPCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR System using the QuantiTect SYBR® Green PCR kit (Qiagen, Hilden, Germany).

Sampling:

Article Title: Transcriptome characterization via 454 pyrosequencing of the annelid Pristina leidyi, an emerging model for studying the evolution of regeneration
Article Snippet: Paragraph title: Worm culture, sampling, and RNA extraction ... RNA was extracted using TRIReagent (Applied Biosystems), and cDNA was constructed using random oligos and Superscript III reverse transcriptase (Invitrogen).

Produced:

Article Title: The core genome m5C methyltransferase JHP1050 (M.Hpy99III) plays an important role in orchestrating gene expression in Helicobacter pylori
Article Snippet: Quantitative PCR (qPCR) One μg of RNA was used for cDNA synthesis using the SuperScript™ III Reverse Transcriptase (Thermo Fisher Scientific, Darmstadt, Germany) as described before ( ). qPCR was performed with gene specific primers ( ) and SYBR Green Master Mix (Qiagen, Hilden, Germany). .. Standard curves were produced and samples were run as technical triplicates.

Concentration Assay:

Article Title: Lysophosphatidic acid via LPA-receptor 5/protein kinase D-dependent pathways induces a motile and pro-inflammatory microglial phenotype
Article Snippet: RNA was reverse-transcribed using the SuperScript® III reverse transcription kit (Invitrogen, Waltham, MA, USA). qPCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR System using the QuantiTect SYBR® Green PCR kit (Qiagen, Hilden, Germany). .. Amplification of murine hypoxanthine-guanine phosphoribosyltransferase (HPRT) was performed on all samples as internal control for variations in messenger RNA (mRNA) concentration.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher t4 dna ligase
    T4 Dna Ligase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 382 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase/product/Thermo Fisher
    Average 99 stars, based on 382 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    90
    Thermo Fisher ligation buffer
    Ligation Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 80 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ligation buffer/product/Thermo Fisher
    Average 90 stars, based on 80 article reviews
    Price from $9.99 to $1999.99
    ligation buffer - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    Image Search Results