supersriptiii rnase h reverse transcriptase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Thermo Fisher supersriptiii rnase h reverse transcriptase
    Supersriptiii Rnase H Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/supersriptiii rnase h reverse transcriptase/product/Thermo Fisher
    Average 86 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    supersriptiii rnase h reverse transcriptase - by Bioz Stars, 2020-04
    86/100 stars

    Related Products / Commonly Used Together

    total rna
    cdnas
    γg total rna

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: S-ADENOSYLMETHIONINE DECREASES THE PEAK BLOOD ALCOHOL LEVELS 3 HOURS AFTER AN ACUTE BOLUS OF ETHANOL BY INDUCING ALCOHOL METABOLIZING ENZYMES IN THE LIVER
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H-Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. Quantitative PCR was achieved using the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Foster City, CA).

    Article Title: The Regulation of Non-Coding RNA Expression in the Liver of Mice Fed DDC
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. The primers used for H19, AIR, GTL2, AFP and Gankyrin were: Sense and anti-sense: Quantitative PCR was achieved by using the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Foster City, CA).

    Article Title: SAME PREVENTS THE INDUCTION OF THE IMMUNOPROTEASOME AND PRESERVES THE 26S PROTEASOME IN THE DDC-INDUCED MDB MOUSE MODEL
    Article Snippet: Synthesis of cDNAs was performed with 5 µg total RNA, and 50 ng random hexamer primers, using SuperSriptIII RNase H Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. Sense and anti-sense: Quantitative PCR was done using the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Foster City, CA).

    Article Title: SAMe Prevents the Up Regulation of Toll-Like Receptor Signaling in Mallory-Denk Body Forming Hepatocytes
    Article Snippet: Synthesis of cDNAs was performed with 5 µg total RNA, and 50 ng random hexamer primers, using SuperSriptIII RNase H Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. Sense and anti-sense: Quantitative PCR was done using the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Foster City, CA).

    Article Title: Chronic Ethanol Feeding Alters Hepatocyte Memory Which is not Altered by Acute Feeding
    Article Snippet: Synthesis of cDNAs was performed with 5 γg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen). .. The primers were: Sense and anti-sense: Quantitative PCR was achieved using the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems).

    Article Title: MALLORY BODY FORMATION IS ASSOCIATED WITH EPIGENETIC PHENOTYPIC CHANGE IN HEPATOCYTES IN VIVO
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, 50ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. Quantitative PCR was achieved us ing the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Foster City, CA).

    Article Title: FAT10 IS AN EPIGENETIC MARKER FOR LIVER PRENEOPLASIA IN A DRUG-PRIMED MOUSE MODEL OF TUMORIGENESIS
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. The primers for mouse liver UBD, KLF6 and AFP were: Sense and anti-sense: Quantitative PCR was achieved using the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Foster City, CA).

    Polymerase Chain Reaction:

    Article Title: PROTECTIVE EFFECT OF QUERCETIN, EGCG, CATECHIN AND BETAINE AGAINST OXIDATIVE STRESS INDUCED BY ETHANOL IN VITRO
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: S-ADENOSYLMETHIONINE DECREASES THE PEAK BLOOD ALCOHOL LEVELS 3 HOURS AFTER AN ACUTE BOLUS OF ETHANOL BY INDUCING ALCOHOL METABOLIZING ENZYMES IN THE LIVER
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H-Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the assistance of the Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: The Regulation of Non-Coding RNA Expression in the Liver of Mice Fed DDC
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the assistance of the Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: THE ROLE OF CYTOKINES IN UBD PROMOTER REGULATION AND MALLORY-DENK BODY-LIKE AGGRESOMES
    Article Snippet: Synthesis of cDNAs was performed with 5 µg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: Chronic Ethanol Feeding Alters Hepatocyte Memory Which is not Altered by Acute Feeding
    Article Snippet: Synthesis of cDNAs was performed with 5 γg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen). .. PCR primers were designed with the assistance of the Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: MALLORY BODY FORMATION IS ASSOCIATED WITH EPIGENETIC PHENOTYPIC CHANGE IN HEPATOCYTES IN VIVO
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, 50ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the assistance of the Primer Express software (Applied Biosystems, Foster City, CA) [[the primers for mouse liver Gadd45g were: Sens: 5' TGAATGTGGACCCTGACAATGT 3' and the anti-sens: AATGGATCTGCAGCGCTATGT.

    Article Title: FAT10 IS AN EPIGENETIC MARKER FOR LIVER PRENEOPLASIA IN A DRUG-PRIMED MOUSE MODEL OF TUMORIGENESIS
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the assistance of the Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: S-ADENOSYLMETHIONINE PREVENTS THE UP REGULATION OF TOLL-LIKE RECEPTOR (TLR) SIGNALING CAUSED BY CHRONIC ETHANOL FEEDING IN RATS
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the Primer Express software (Applied Biosystems, Foster City, CA).

    Quantitative RT-PCR:

    Article Title: PROTECTIVE EFFECT OF QUERCETIN, EGCG, CATECHIN AND BETAINE AGAINST OXIDATIVE STRESS INDUCED BY ETHANOL IN VITRO
    Article Snippet: Paragraph title: Quantitative Real-time RT-PCR Assay ... Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA).

    Article Title: S-ADENOSYLMETHIONINE DECREASES THE PEAK BLOOD ALCOHOL LEVELS 3 HOURS AFTER AN ACUTE BOLUS OF ETHANOL BY INDUCING ALCOHOL METABOLIZING ENZYMES IN THE LIVER
    Article Snippet: Paragraph title: Quantitative real-time RT-PCR assay ... Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H-Reverse Transcriptase (Invitrogen, Carlsbad, CA).

    Article Title: The Regulation of Non-Coding RNA Expression in the Liver of Mice Fed DDC
    Article Snippet: Paragraph title: Quantitative real-time RT-PCR assay ... Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA).

    Article Title: SAME PREVENTS THE INDUCTION OF THE IMMUNOPROTEASOME AND PRESERVES THE 26S PROTEASOME IN THE DDC-INDUCED MDB MOUSE MODEL
    Article Snippet: Paragraph title: Quantitative Real-time RT-PCR ... Synthesis of cDNAs was performed with 5 µg total RNA, and 50 ng random hexamer primers, using SuperSriptIII RNase H Reverse Transcriptase (Invitrogen, Carlsbad, CA).

    Article Title: SAMe Prevents the Up Regulation of Toll-Like Receptor Signaling in Mallory-Denk Body Forming Hepatocytes
    Article Snippet: Paragraph title: Quantitative Real-time RT-PCR ... Synthesis of cDNAs was performed with 5 µg total RNA, and 50 ng random hexamer primers, using SuperSriptIII RNase H Reverse Transcriptase (Invitrogen, Carlsbad, CA).

    Article Title: THE ROLE OF CYTOKINES IN UBD PROMOTER REGULATION AND MALLORY-DENK BODY-LIKE AGGRESOMES
    Article Snippet: Paragraph title: Quantitative Real-time RT-PCR Assay ... Synthesis of cDNAs was performed with 5 µg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA).

    Article Title: Chronic Ethanol Feeding Alters Hepatocyte Memory Which is not Altered by Acute Feeding
    Article Snippet: Paragraph title: Quantitative Real-Time RT-PCR Assay ... Synthesis of cDNAs was performed with 5 γg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen).

    Article Title: MALLORY BODY FORMATION IS ASSOCIATED WITH EPIGENETIC PHENOTYPIC CHANGE IN HEPATOCYTES IN VIVO
    Article Snippet: Paragraph title: Quantitative real-time RT-PCR assay ... Synthesis of cDNAs was performed with 5 μg total RNA, 50ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA).

    Article Title: FAT10 IS AN EPIGENETIC MARKER FOR LIVER PRENEOPLASIA IN A DRUG-PRIMED MOUSE MODEL OF TUMORIGENESIS
    Article Snippet: Paragraph title: Quantitative real-time RT-PCR assay ... Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA).

    Article Title: S-ADENOSYLMETHIONINE PREVENTS THE UP REGULATION OF TOLL-LIKE RECEPTOR (TLR) SIGNALING CAUSED BY CHRONIC ETHANOL FEEDING IN RATS
    Article Snippet: Paragraph title: Quantitative Real-time RT-PCR Assay ... Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA).

    Purification:

    Article Title: PROTECTIVE EFFECT OF QUERCETIN, EGCG, CATECHIN AND BETAINE AGAINST OXIDATIVE STRESS INDUCED BY ETHANOL IN VITRO
    Article Snippet: Total liver RNAs were extracted with Trizol Plus RNA Purification kit (Invitrogen, Carlsbad, CA). .. Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA).

    Article Title: S-ADENOSYLMETHIONINE DECREASES THE PEAK BLOOD ALCOHOL LEVELS 3 HOURS AFTER AN ACUTE BOLUS OF ETHANOL BY INDUCING ALCOHOL METABOLIZING ENZYMES IN THE LIVER
    Article Snippet: Total liver RNAs were extracted with Trizol Plus RNA Purification Kit (Invitrogen, Carlsbad, CA). .. Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H-Reverse Transcriptase (Invitrogen, Carlsbad, CA).

    Article Title: The Regulation of Non-Coding RNA Expression in the Liver of Mice Fed DDC
    Article Snippet: Total liver RNAs were extracted with Trizol Plus RNA Purification Kit (Invitrogen, Carlsbad, CA). .. Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA).

    Article Title: SAME PREVENTS THE INDUCTION OF THE IMMUNOPROTEASOME AND PRESERVES THE 26S PROTEASOME IN THE DDC-INDUCED MDB MOUSE MODEL
    Article Snippet: Total liver RNAs were extracted with Trizol Plus RNA Purification Kit (Invitrogen, Carlsbad, CA). .. Synthesis of cDNAs was performed with 5 µg total RNA, and 50 ng random hexamer primers, using SuperSriptIII RNase H Reverse Transcriptase (Invitrogen, Carlsbad, CA).

    Article Title: THE ROLE OF CYTOKINES IN UBD PROMOTER REGULATION AND MALLORY-DENK BODY-LIKE AGGRESOMES
    Article Snippet: Total liver RNAs were extracted with Trizol Plus RNA Purification kit (Invitrogen, Carlsbad, CA). .. Synthesis of cDNAs was performed with 5 µg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA).

    Article Title: Chronic Ethanol Feeding Alters Hepatocyte Memory Which is not Altered by Acute Feeding
    Article Snippet: Total liver RNAs were extracted with Trizol Plus RNA Purification Kit (Invitrogen). .. Synthesis of cDNAs was performed with 5 γg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen).

    Article Title: MALLORY BODY FORMATION IS ASSOCIATED WITH EPIGENETIC PHENOTYPIC CHANGE IN HEPATOCYTES IN VIVO
    Article Snippet: Total liver RNAs were extracted with Trizol Plus RNA Purification Kit (Invitrogen, Carlsbad, CA). .. Synthesis of cDNAs was performed with 5 μg total RNA, 50ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA).

    Article Title: FAT10 IS AN EPIGENETIC MARKER FOR LIVER PRENEOPLASIA IN A DRUG-PRIMED MOUSE MODEL OF TUMORIGENESIS
    Article Snippet: Total liver RNAs were extracted with Trizol Plus RNA Purification Kit (Invitrogen, Carlsbad, CA). .. Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA).

    Article Title: S-ADENOSYLMETHIONINE PREVENTS THE UP REGULATION OF TOLL-LIKE RECEPTOR (TLR) SIGNALING CAUSED BY CHRONIC ETHANOL FEEDING IN RATS
    Article Snippet: Total liver RNAs were extracted with Trizol Plus RNA Purification kit (Invitrogen, Carlsbad, CA). .. Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA).

    SYBR Green Assay:

    Article Title: S-ADENOSYLMETHIONINE DECREASES THE PEAK BLOOD ALCOHOL LEVELS 3 HOURS AFTER AN ACUTE BOLUS OF ETHANOL BY INDUCING ALCOHOL METABOLIZING ENZYMES IN THE LIVER
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H-Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. Quantitative PCR was achieved using the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Foster City, CA).

    Article Title: The Regulation of Non-Coding RNA Expression in the Liver of Mice Fed DDC
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. The primers used for H19, AIR, GTL2, AFP and Gankyrin were: Sense and anti-sense: Quantitative PCR was achieved by using the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Foster City, CA).

    Article Title: SAME PREVENTS THE INDUCTION OF THE IMMUNOPROTEASOME AND PRESERVES THE 26S PROTEASOME IN THE DDC-INDUCED MDB MOUSE MODEL
    Article Snippet: Synthesis of cDNAs was performed with 5 µg total RNA, and 50 ng random hexamer primers, using SuperSriptIII RNase H Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. Sense and anti-sense: Quantitative PCR was done using the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Foster City, CA).

    Article Title: SAMe Prevents the Up Regulation of Toll-Like Receptor Signaling in Mallory-Denk Body Forming Hepatocytes
    Article Snippet: Synthesis of cDNAs was performed with 5 µg total RNA, and 50 ng random hexamer primers, using SuperSriptIII RNase H Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. Sense and anti-sense: Quantitative PCR was done using the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Foster City, CA).

    Article Title: Chronic Ethanol Feeding Alters Hepatocyte Memory Which is not Altered by Acute Feeding
    Article Snippet: Synthesis of cDNAs was performed with 5 γg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen). .. The primers were: Sense and anti-sense: Quantitative PCR was achieved using the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems).

    Article Title: MALLORY BODY FORMATION IS ASSOCIATED WITH EPIGENETIC PHENOTYPIC CHANGE IN HEPATOCYTES IN VIVO
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, 50ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. Quantitative PCR was achieved us ing the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Foster City, CA).

    Article Title: FAT10 IS AN EPIGENETIC MARKER FOR LIVER PRENEOPLASIA IN A DRUG-PRIMED MOUSE MODEL OF TUMORIGENESIS
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. The primers for mouse liver UBD, KLF6 and AFP were: Sense and anti-sense: Quantitative PCR was achieved using the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Foster City, CA).

    Sequencing:

    Article Title: S-ADENOSYLMETHIONINE DECREASES THE PEAK BLOOD ALCOHOL LEVELS 3 HOURS AFTER AN ACUTE BOLUS OF ETHANOL BY INDUCING ALCOHOL METABOLIZING ENZYMES IN THE LIVER
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H-Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. Quantitative PCR was achieved using the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Foster City, CA).

    Article Title: The Regulation of Non-Coding RNA Expression in the Liver of Mice Fed DDC
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. The primers used for H19, AIR, GTL2, AFP and Gankyrin were: Sense and anti-sense: Quantitative PCR was achieved by using the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Foster City, CA).

    Article Title: SAME PREVENTS THE INDUCTION OF THE IMMUNOPROTEASOME AND PRESERVES THE 26S PROTEASOME IN THE DDC-INDUCED MDB MOUSE MODEL
    Article Snippet: Synthesis of cDNAs was performed with 5 µg total RNA, and 50 ng random hexamer primers, using SuperSriptIII RNase H Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. Sense and anti-sense: Quantitative PCR was done using the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Foster City, CA).

    Article Title: SAMe Prevents the Up Regulation of Toll-Like Receptor Signaling in Mallory-Denk Body Forming Hepatocytes
    Article Snippet: Synthesis of cDNAs was performed with 5 µg total RNA, and 50 ng random hexamer primers, using SuperSriptIII RNase H Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. Sense and anti-sense: Quantitative PCR was done using the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Foster City, CA).

    Article Title: Chronic Ethanol Feeding Alters Hepatocyte Memory Which is not Altered by Acute Feeding
    Article Snippet: Synthesis of cDNAs was performed with 5 γg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen). .. The primers were: Sense and anti-sense: Quantitative PCR was achieved using the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems).

    Article Title: MALLORY BODY FORMATION IS ASSOCIATED WITH EPIGENETIC PHENOTYPIC CHANGE IN HEPATOCYTES IN VIVO
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, 50ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. Quantitative PCR was achieved us ing the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Foster City, CA).

    Article Title: FAT10 IS AN EPIGENETIC MARKER FOR LIVER PRENEOPLASIA IN A DRUG-PRIMED MOUSE MODEL OF TUMORIGENESIS
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. The primers for mouse liver UBD, KLF6 and AFP were: Sense and anti-sense: Quantitative PCR was achieved using the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Foster City, CA).

    Random Hexamer Labeling:

    Article Title: PROTECTIVE EFFECT OF QUERCETIN, EGCG, CATECHIN AND BETAINE AGAINST OXIDATIVE STRESS INDUCED BY ETHANOL IN VITRO
    Article Snippet: .. Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: S-ADENOSYLMETHIONINE DECREASES THE PEAK BLOOD ALCOHOL LEVELS 3 HOURS AFTER AN ACUTE BOLUS OF ETHANOL BY INDUCING ALCOHOL METABOLIZING ENZYMES IN THE LIVER
    Article Snippet: .. Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H-Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the assistance of the Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: The Regulation of Non-Coding RNA Expression in the Liver of Mice Fed DDC
    Article Snippet: .. Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the assistance of the Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: SAME PREVENTS THE INDUCTION OF THE IMMUNOPROTEASOME AND PRESERVES THE 26S PROTEASOME IN THE DDC-INDUCED MDB MOUSE MODEL
    Article Snippet: .. Synthesis of cDNAs was performed with 5 µg total RNA, and 50 ng random hexamer primers, using SuperSriptIII RNase H Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. RT-PCR primers were designated using Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: THE ROLE OF CYTOKINES IN UBD PROMOTER REGULATION AND MALLORY-DENK BODY-LIKE AGGRESOMES
    Article Snippet: .. Synthesis of cDNAs was performed with 5 µg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: Chronic Ethanol Feeding Alters Hepatocyte Memory Which is not Altered by Acute Feeding
    Article Snippet: .. Synthesis of cDNAs was performed with 5 γg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen). .. PCR primers were designed with the assistance of the Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: MALLORY BODY FORMATION IS ASSOCIATED WITH EPIGENETIC PHENOTYPIC CHANGE IN HEPATOCYTES IN VIVO
    Article Snippet: .. Synthesis of cDNAs was performed with 5 μg total RNA, 50ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the assistance of the Primer Express software (Applied Biosystems, Foster City, CA) [[the primers for mouse liver Gadd45g were: Sens: 5' TGAATGTGGACCCTGACAATGT 3' and the anti-sens: AATGGATCTGCAGCGCTATGT.

    Article Title: FAT10 IS AN EPIGENETIC MARKER FOR LIVER PRENEOPLASIA IN A DRUG-PRIMED MOUSE MODEL OF TUMORIGENESIS
    Article Snippet: .. Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the assistance of the Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: S-ADENOSYLMETHIONINE PREVENTS THE UP REGULATION OF TOLL-LIKE RECEPTOR (TLR) SIGNALING CAUSED BY CHRONIC ETHANOL FEEDING IN RATS
    Article Snippet: .. Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the Primer Express software (Applied Biosystems, Foster City, CA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: SAME PREVENTS THE INDUCTION OF THE IMMUNOPROTEASOME AND PRESERVES THE 26S PROTEASOME IN THE DDC-INDUCED MDB MOUSE MODEL
    Article Snippet: Synthesis of cDNAs was performed with 5 µg total RNA, and 50 ng random hexamer primers, using SuperSriptIII RNase H Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. RT-PCR primers were designated using Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: SAMe Prevents the Up Regulation of Toll-Like Receptor Signaling in Mallory-Denk Body Forming Hepatocytes
    Article Snippet: Synthesis of cDNAs was performed with 5 µg total RNA, and 50 ng random hexamer primers, using SuperSriptIII RNase H Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. RT-PCR primers were designated using Primer Express software (Applied Biosystems, Foster City, CA).

    Software:

    Article Title: PROTECTIVE EFFECT OF QUERCETIN, EGCG, CATECHIN AND BETAINE AGAINST OXIDATIVE STRESS INDUCED BY ETHANOL IN VITRO
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: S-ADENOSYLMETHIONINE DECREASES THE PEAK BLOOD ALCOHOL LEVELS 3 HOURS AFTER AN ACUTE BOLUS OF ETHANOL BY INDUCING ALCOHOL METABOLIZING ENZYMES IN THE LIVER
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H-Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the assistance of the Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: The Regulation of Non-Coding RNA Expression in the Liver of Mice Fed DDC
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the assistance of the Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: SAME PREVENTS THE INDUCTION OF THE IMMUNOPROTEASOME AND PRESERVES THE 26S PROTEASOME IN THE DDC-INDUCED MDB MOUSE MODEL
    Article Snippet: Synthesis of cDNAs was performed with 5 µg total RNA, and 50 ng random hexamer primers, using SuperSriptIII RNase H Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. RT-PCR primers were designated using Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: THE ROLE OF CYTOKINES IN UBD PROMOTER REGULATION AND MALLORY-DENK BODY-LIKE AGGRESOMES
    Article Snippet: Synthesis of cDNAs was performed with 5 µg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: Chronic Ethanol Feeding Alters Hepatocyte Memory Which is not Altered by Acute Feeding
    Article Snippet: Synthesis of cDNAs was performed with 5 γg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen). .. PCR primers were designed with the assistance of the Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: MALLORY BODY FORMATION IS ASSOCIATED WITH EPIGENETIC PHENOTYPIC CHANGE IN HEPATOCYTES IN VIVO
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, 50ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the assistance of the Primer Express software (Applied Biosystems, Foster City, CA) [[the primers for mouse liver Gadd45g were: Sens: 5' TGAATGTGGACCCTGACAATGT 3' and the anti-sens: AATGGATCTGCAGCGCTATGT.

    Article Title: FAT10 IS AN EPIGENETIC MARKER FOR LIVER PRENEOPLASIA IN A DRUG-PRIMED MOUSE MODEL OF TUMORIGENESIS
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the assistance of the Primer Express software (Applied Biosystems, Foster City, CA).

    Article Title: S-ADENOSYLMETHIONINE PREVENTS THE UP REGULATION OF TOLL-LIKE RECEPTOR (TLR) SIGNALING CAUSED BY CHRONIC ETHANOL FEEDING IN RATS
    Article Snippet: Synthesis of cDNAs was performed with 5 μg total RNA, and 50 ng random hexamer primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). .. PCR primers were designed with the Primer Express software (Applied Biosystems, Foster City, CA).