superscripttii rnase h reverse transcriptase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher superscripttii rnase h reverse transcriptase
    Superscripttii Rnase H Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscripttii rnase h reverse transcriptase/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    superscripttii rnase h reverse transcriptase - by Bioz Stars, 2020-02
    90/100 stars

    Related Products / Commonly Used Together

    pcr
    rna
    rt-pcr
    quantitative real-time pcr qpcr

    Images

    Related Articles

    Centrifugation:

    Article Title: Streptococcus pneumoniae in Biofilms Are Unable to Cause Invasive Disease Due to Altered Virulence Determinant Production
    Article Snippet: Aliquots of 2 µg of the total RNAs were reverse transcribed into single-stranded cDNA using 200 U Superscript II reverse transcriptase (Invitrogen), 6 µg random hexamers (Invitrogen), 1× first strand buffer (Invitrogen), 10 mM dithiothreitol (DTT), 0.5 mM dATP, 0.5 mM dCTP, 0.5 mM dGTP, 0.3 mM dTTP and 0.2 mM of aminoallyl-modified nucleotide (Invitrogen). .. Slides were prehybridized in a 50 ml solution of 5× SSC, 0.1% SDS and 1% BSA for at least 1 h at 42°C, washed 10× in water and once in isopropanol, then dried by brief centrifugation.

    Amplification:

    Article Title: Glutathione-mediated antioxidant response and aerobic metabolism: two crucial factors involved in determining the multi-drug resistance of high-risk neuroblastoma
    Article Snippet: Total RNA (1 μg) was reverse-transcribed into cDNA by a random hexamer primer and SuperScript™ II Reverse Transcriptase (LifeTechnologies). .. Amplification of cDNA by a polymerase chain reaction was performed using AmpliTaq Polymerase (LifeTechnologies) and specific primers for GCLC F 5′-ATG GAG GTG CAA TTA ACA GAC-3′; GCLC R 5′-ACT GCA TTG CCA CCT TTG CA-3′ (206 bp); GCLM F 5′-CCA GAT GTC TTG GAA TGC-3′; GCLM R 5′-TGC AGT CAA ATC TGG TGG-3′(408 bp); GAPDH F 5′-AGC CAC ATC GCT CAG ACA CC-3′; and GAPDH R 5′-TGA GGC TGT TGT CAT ACT TCT C-3′ (426 bp).

    Article Title: Infections of virulent and avirulent viruses differentially influenced the expression of dicer-1, ago-1, and microRNAs in Bombus terrestris
    Article Snippet: An amount of 2 μg total RNA was used to synthesize the cDNA by SuperScript® II Reverse Transcriptase (Invitrogen, USA) using oligo (dT) primers. .. The cDNA should produce an amplicon of 143 bp whereas the presence of genomic DNA will produce an extra amplicon of 452 bp.

    Article Title: Hybrid-Transcriptome Sequencing and Associated Metabolite Analysis Reveal Putative Genes Involved in Flower Color Difference in Rose Mutants
    Article Snippet: Double-stranded RNA-complementary DNA (cDNA) was synthesized using a SuperScript II Double-Stranded cDNA Synthesis Kit (part#18064014, Invitrogen, CA, USA) and random hexamer primers. .. A range of cDNA fragments (200 ± 25 bp) were excised from the gel and selected for PCR amplification as templates.

    Article Title: Molecular Cloning and Characterization of WdPKS1, a Gene Involved in Dihydroxynaphthalene Melanin Biosynthesis and Virulence in Wangiella (Exophiala) dermatitidis
    Article Snippet: The 772-bp PCR fragment of WdPKS1 was amplified from genomic DNA using primers PKS-1 (5′ TGAATTCGACACGGCCTGTTCA/CTCCA 3′) and PKS-2 (5′ ACATATGGCGGCACTGAAGTTGTTGA 3′). .. First-strand synthesis of the cDNA was achieved using SuperScript II reverse transcriptase (Life Technologies Inc., Rockville, Md.) according to the instructions of the manufacturer.

    Article Title: Downregulation of the tumor suppressor HSPB7, involved in the p53 pathway, in renal cell carcinoma by hypermethylation
    Article Snippet: .. RNAs from tissue samples were treated with DNase I and subjected to two rounds of RNA amplification using T7-based in vitro transcription (Epicentre Technologies, Madison, WI, USA), then amplified RNAs were reversely transcribed to single-stranded cDNAs using random primer with Superscript II reverse transcriptase (Invitrogen) according to the manufacturer’s instruction. qPCR was conducted using the SYBR-Green I Master (Roche) on a LightCycler 480 (Roche). ..

    Synthesized:

    Article Title: Hybrid-Transcriptome Sequencing and Associated Metabolite Analysis Reveal Putative Genes Involved in Flower Color Difference in Rose Mutants
    Article Snippet: .. Double-stranded RNA-complementary DNA (cDNA) was synthesized using a SuperScript II Double-Stranded cDNA Synthesis Kit (part#18064014, Invitrogen, CA, USA) and random hexamer primers. .. The cDNA fragments were subjected to purification, end repair, and ligation to sequencing adapters.

    Article Title: Molecular Cloning and Characterization of WdPKS1, a Gene Involved in Dihydroxynaphthalene Melanin Biosynthesis and Virulence in Wangiella (Exophiala) dermatitidis
    Article Snippet: First-strand synthesis of the cDNA was achieved using SuperScript II reverse transcriptase (Life Technologies Inc., Rockville, Md.) according to the instructions of the manufacturer. .. PCR amplification of the first strand synthesized was for 35 cycles as follows: premelt, 94°C for 5 min; denaturation, 94°C for 1 min; hybridization, 50°C for 2 min; and extension, 72°C for 3 min (10 min on the last cycle).

    Quantitative RT-PCR:

    Article Title: In vitro long-term treatment with MAPK inhibitors induces melanoma cells with resistance plasticity to inhibitors while retaining sensitivity to CD8 T cells
    Article Snippet: Paragraph title: Quantitative real-time reverse transcriptase PCR (RT-qPCR) ... One microgram of RNA was reverse-transcribed using SuperScript™ II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA).

    SYBR Green Assay:

    Article Title: Effect of Kangshuanyihao Formula on the Inflammatory Reaction and SIRT1/TLR4/NF-κB Signaling Pathway in Endothelial Injury
    Article Snippet: The total RNA from tissue was extracted using the TRIzol kit according to the manufacturer's instructions. cDNA was generated from 500 ng of total RNA using SuperScript II Reverse Transcriptase (Invitrogen). .. Quantitative reverse transcription-PCR analysis was carried out using SYBR green PCR master mix and was analyzed on a MyIQ real-time PCR cycler (BioRad, Veenendaal, Netherlands).

    Article Title: TDRD6 mediates early steps of spliceosome maturation in primary spermatocytes
    Article Snippet: 100ng to 1μg of total RNA was treated with RQ1 RNase-Free DNase (Promega) according to manufacturer’s instructions and reverse transcribed into first strand cDNA via SuperScript II reverse transcriptase (Invitrogen) and random primer mix (NEB) according to manufacturer’s instructions. .. 2μl of the RT reaction was used directly as a template in a total volume of 20μl of real time PCR reaction with Rotor-Gene SYBR Green PCR Kit (Qiagen) according to manufacturer’s instructions.

    Article Title: Downregulation of the tumor suppressor HSPB7, involved in the p53 pathway, in renal cell carcinoma by hypermethylation
    Article Snippet: .. RNAs from tissue samples were treated with DNase I and subjected to two rounds of RNA amplification using T7-based in vitro transcription (Epicentre Technologies, Madison, WI, USA), then amplified RNAs were reversely transcribed to single-stranded cDNAs using random primer with Superscript II reverse transcriptase (Invitrogen) according to the manufacturer’s instruction. qPCR was conducted using the SYBR-Green I Master (Roche) on a LightCycler 480 (Roche). ..

    Microarray:

    Article Title: GADD45A plays a protective role against temozolomide treatment in glioblastoma cells
    Article Snippet: Paragraph title: RNA isolation and microarray hybridization ... Fluorescent labeled cDNA probes were made from 5 μg aliquots of total RNA samples by oligo (dT)-primer reverse transcription using Superscript II reverse transcriptase (Gibco, USA).

    Article Title: Streptococcus pneumoniae in Biofilms Are Unable to Cause Invasive Disease Due to Altered Virulence Determinant Production
    Article Snippet: Paragraph title: Microarray analysis of pneumococcal gene transcription and analysis of hybridization data ... Aliquots of 2 µg of the total RNAs were reverse transcribed into single-stranded cDNA using 200 U Superscript II reverse transcriptase (Invitrogen), 6 µg random hexamers (Invitrogen), 1× first strand buffer (Invitrogen), 10 mM dithiothreitol (DTT), 0.5 mM dATP, 0.5 mM dCTP, 0.5 mM dGTP, 0.3 mM dTTP and 0.2 mM of aminoallyl-modified nucleotide (Invitrogen).

    Random Hexamer Labeling:

    Article Title: Glutathione-mediated antioxidant response and aerobic metabolism: two crucial factors involved in determining the multi-drug resistance of high-risk neuroblastoma
    Article Snippet: .. Total RNA (1 μg) was reverse-transcribed into cDNA by a random hexamer primer and SuperScript™ II Reverse Transcriptase (LifeTechnologies). .. Amplification of cDNA by a polymerase chain reaction was performed using AmpliTaq Polymerase (LifeTechnologies) and specific primers for GCLC F 5′-ATG GAG GTG CAA TTA ACA GAC-3′; GCLC R 5′-ACT GCA TTG CCA CCT TTG CA-3′ (206 bp); GCLM F 5′-CCA GAT GTC TTG GAA TGC-3′; GCLM R 5′-TGC AGT CAA ATC TGG TGG-3′(408 bp); GAPDH F 5′-AGC CAC ATC GCT CAG ACA CC-3′; and GAPDH R 5′-TGA GGC TGT TGT CAT ACT TCT C-3′ (426 bp).

    Article Title: Hybrid-Transcriptome Sequencing and Associated Metabolite Analysis Reveal Putative Genes Involved in Flower Color Difference in Rose Mutants
    Article Snippet: .. Double-stranded RNA-complementary DNA (cDNA) was synthesized using a SuperScript II Double-Stranded cDNA Synthesis Kit (part#18064014, Invitrogen, CA, USA) and random hexamer primers. .. The cDNA fragments were subjected to purification, end repair, and ligation to sequencing adapters.

    Article Title: VOLTAGE-ACTIVATED CALCIUM CHANNEL EXPRESSION PROFILES IN MOUSE BRAIN AND CULTURED HIPPOCAMPAL NEURONS
    Article Snippet: .. Reverse transcription was performed on 5 μ l of RNA using Superscript II reverse transcriptase (Invitrogen, Carlsbad, USA) and random hexamer primers (Promega, Madison WI, USA); the RT mix was incubated at 37 °C for 60 min. .. BALB/c mice of different age (E16, PD1, 2 and 8 weeks) were euthanized by CO2 exposure and decapitated.

    Expressing:

    Article Title: MicroRNA-196a Is a Potential Marker of Progression during Barrett's Metaplasia-Dysplasia-Invasive Adenocarcinoma Sequence in Esophagus
    Article Snippet: For cDNA synthesis, 200 ng of total RNA from each adenocarcinoma sample was reverse-transcribed in a final volume of 20 μl using random primers and SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA). .. The primers and probes for SPRR2C, S100A9, KRT5 and an internal control, glucuronidase-β (GUSB), were obtained from PE Applied Biosystems via their Assays-on-Demand gene expression products services.

    Article Title: Apolipoprotein E mRNA expression in mononuclear cells from normolipidemic and hypercholesterolemic individuals treated with atorvastatin
    Article Snippet: APOE mRNA quantification in PBMC APOE mRNA expression was measured in individuals from NL (n = 88) and ATORVA (n = 94) groups. .. Samples with RNA integrity number (RIN) lower than 5 were not used for mRNA experiments. cDNA was produced from 1 μg of total RNA by Superscript™ II Reverse Transcriptase (Invitrogen-Life Technologies, CA, USA).

    Article Title: Effect of Kangshuanyihao Formula on the Inflammatory Reaction and SIRT1/TLR4/NF-κB Signaling Pathway in Endothelial Injury
    Article Snippet: Reverse Transcription-Polymerase Chain Reaction (RT-PCR) The tissue samples from each rat from all the groups were removed and stored at −80°C to examine the mRNA expression. .. The total RNA from tissue was extracted using the TRIzol kit according to the manufacturer's instructions. cDNA was generated from 500 ng of total RNA using SuperScript II Reverse Transcriptase (Invitrogen).

    Article Title: In vitro long-term treatment with MAPK inhibitors induces melanoma cells with resistance plasticity to inhibitors while retaining sensitivity to CD8 T cells
    Article Snippet: One microgram of RNA was reverse-transcribed using SuperScript™ II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). .. Relative expression levels were determined by the ΔΔCq method , using β-actin gene expression to normalize all samples.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Glutathione-mediated antioxidant response and aerobic metabolism: two crucial factors involved in determining the multi-drug resistance of high-risk neuroblastoma
    Article Snippet: Total RNA (1 μg) was reverse-transcribed into cDNA by a random hexamer primer and SuperScript™ II Reverse Transcriptase (LifeTechnologies). .. Amplification of cDNA by a polymerase chain reaction was performed using AmpliTaq Polymerase (LifeTechnologies) and specific primers for GCLC F 5′-ATG GAG GTG CAA TTA ACA GAC-3′; GCLC R 5′-ACT GCA TTG CCA CCT TTG CA-3′ (206 bp); GCLM F 5′-CCA GAT GTC TTG GAA TGC-3′; GCLM R 5′-TGC AGT CAA ATC TGG TGG-3′(408 bp); GAPDH F 5′-AGC CAC ATC GCT CAG ACA CC-3′; and GAPDH R 5′-TGA GGC TGT TGT CAT ACT TCT C-3′ (426 bp).

    Hybridization:

    Article Title: GADD45A plays a protective role against temozolomide treatment in glioblastoma cells
    Article Snippet: Paragraph title: RNA isolation and microarray hybridization ... Fluorescent labeled cDNA probes were made from 5 μg aliquots of total RNA samples by oligo (dT)-primer reverse transcription using Superscript II reverse transcriptase (Gibco, USA).

    Article Title: Molecular Cloning and Characterization of WdPKS1, a Gene Involved in Dihydroxynaphthalene Melanin Biosynthesis and Virulence in Wangiella (Exophiala) dermatitidis
    Article Snippet: First-strand synthesis of the cDNA was achieved using SuperScript II reverse transcriptase (Life Technologies Inc., Rockville, Md.) according to the instructions of the manufacturer. .. PCR amplification of the first strand synthesized was for 35 cycles as follows: premelt, 94°C for 5 min; denaturation, 94°C for 1 min; hybridization, 50°C for 2 min; and extension, 72°C for 3 min (10 min on the last cycle).

    Article Title: Streptococcus pneumoniae in Biofilms Are Unable to Cause Invasive Disease Due to Altered Virulence Determinant Production
    Article Snippet: Paragraph title: Microarray analysis of pneumococcal gene transcription and analysis of hybridization data ... Aliquots of 2 µg of the total RNAs were reverse transcribed into single-stranded cDNA using 200 U Superscript II reverse transcriptase (Invitrogen), 6 µg random hexamers (Invitrogen), 1× first strand buffer (Invitrogen), 10 mM dithiothreitol (DTT), 0.5 mM dATP, 0.5 mM dCTP, 0.5 mM dGTP, 0.3 mM dTTP and 0.2 mM of aminoallyl-modified nucleotide (Invitrogen).

    Electroporation:

    Article Title: Molecular Cloning and Characterization of WdPKS1, a Gene Involved in Dihydroxynaphthalene Melanin Biosynthesis and Virulence in Wangiella (Exophiala) dermatitidis
    Article Snippet: First-strand synthesis of the cDNA was achieved using SuperScript II reverse transcriptase (Life Technologies Inc., Rockville, Md.) according to the instructions of the manufacturer. .. After transfection of E. coli XL1-Blue (Stratagene) by electroporation using a Gene Pulse apparatus (Bio-Rad Laboratories, Richmond, Calif.), plasmids were isolated from chloramphenicol-resistant colonies.

    Transfection:

    Article Title: Molecular Cloning and Characterization of WdPKS1, a Gene Involved in Dihydroxynaphthalene Melanin Biosynthesis and Virulence in Wangiella (Exophiala) dermatitidis
    Article Snippet: First-strand synthesis of the cDNA was achieved using SuperScript II reverse transcriptase (Life Technologies Inc., Rockville, Md.) according to the instructions of the manufacturer. .. After transfection of E. coli XL1-Blue (Stratagene) by electroporation using a Gene Pulse apparatus (Bio-Rad Laboratories, Richmond, Calif.), plasmids were isolated from chloramphenicol-resistant colonies.

    Ligation:

    Article Title: Hybrid-Transcriptome Sequencing and Associated Metabolite Analysis Reveal Putative Genes Involved in Flower Color Difference in Rose Mutants
    Article Snippet: Double-stranded RNA-complementary DNA (cDNA) was synthesized using a SuperScript II Double-Stranded cDNA Synthesis Kit (part#18064014, Invitrogen, CA, USA) and random hexamer primers. .. The cDNA fragments were subjected to purification, end repair, and ligation to sequencing adapters.

    Article Title: Molecular Cloning and Characterization of WdPKS1, a Gene Involved in Dihydroxynaphthalene Melanin Biosynthesis and Virulence in Wangiella (Exophiala) dermatitidis
    Article Snippet: First-strand synthesis of the cDNA was achieved using SuperScript II reverse transcriptase (Life Technologies Inc., Rockville, Md.) according to the instructions of the manufacturer. .. For the rescue of fragments flanking the WdPKS1 transgene insertion, DNA from the wdpks1 Δ- 1 clone was digested to completion with appropriate restriction enzymes and diluted to ≤1 μg/ml to favor intramolecular ligation with T4 DNA ligase (New England Biolabs Inc., Beverly, Mass.).

    Transferring:

    Article Title: VOLTAGE-ACTIVATED CALCIUM CHANNEL EXPRESSION PROFILES IN MOUSE BRAIN AND CULTURED HIPPOCAMPAL NEURONS
    Article Snippet: After plating, cells were allowed to attach for 3–4 h before transferring the coverslips neuron-side-down into 60-mm culture dishes with a glial feeder layer. .. Reverse transcription was performed on 5 μ l of RNA using Superscript II reverse transcriptase (Invitrogen, Carlsbad, USA) and random hexamer primers (Promega, Madison WI, USA); the RT mix was incubated at 37 °C for 60 min.

    Cell Culture:

    Article Title: VOLTAGE-ACTIVATED CALCIUM CHANNEL EXPRESSION PROFILES IN MOUSE BRAIN AND CULTURED HIPPOCAMPAL NEURONS
    Article Snippet: Paragraph title: RNA isolation from cultured hippocampal neurons ... Reverse transcription was performed on 5 μ l of RNA using Superscript II reverse transcriptase (Invitrogen, Carlsbad, USA) and random hexamer primers (Promega, Madison WI, USA); the RT mix was incubated at 37 °C for 60 min.

    Article Title: Downregulation of the tumor suppressor HSPB7, involved in the p53 pathway, in renal cell carcinoma by hypermethylation
    Article Snippet: Quantitative real-time PCR (qPCR) We extracted total RNA from the microdissected RCC clinical samples, microdissected normal renal cortex, 25 different normal organs ( ) and cultured cells using RNeasy mini kits (Qiagen, Valencia, CA, USA). .. RNAs from tissue samples were treated with DNase I and subjected to two rounds of RNA amplification using T7-based in vitro transcription (Epicentre Technologies, Madison, WI, USA), then amplified RNAs were reversely transcribed to single-stranded cDNAs using random primer with Superscript II reverse transcriptase (Invitrogen) according to the manufacturer’s instruction. qPCR was conducted using the SYBR-Green I Master (Roche) on a LightCycler 480 (Roche).

    Generated:

    Article Title: Effect of Kangshuanyihao Formula on the Inflammatory Reaction and SIRT1/TLR4/NF-κB Signaling Pathway in Endothelial Injury
    Article Snippet: .. The total RNA from tissue was extracted using the TRIzol kit according to the manufacturer's instructions. cDNA was generated from 500 ng of total RNA using SuperScript II Reverse Transcriptase (Invitrogen). ..

    Article Title: BRI2 Interacts with BACE1 and Regulates Its Cellular Levels by Promoting its Degradation and Reducing Its mRNA Levels
    Article Snippet: Total mRNA was extracted using Magnapure Compact RNA Isolation kit on a Magnapure DNA/RNA extractor (F. Hoffmann-La Roche AG, Basel, Switzerland) according to the manufacturer’s instructions. cDNA synthesis was performed using the Superscript II Reverse Transcriptase and random primers both from Invitrogen (Carlsbad, CA, USA) according to the manufacturer’s instructions. .. Initially, using the same primers to be used in real time PCR but not the labeled probes, we performed PCR reactions, purified the corresponding BACE1 and GAPDH fragments and generated DNA solutions covering a range of concentrations from 25ng/ul to 25×10−9 ng/ul.

    Polymerase Chain Reaction:

    Article Title: MicroRNA-196a Is a Potential Marker of Progression during Barrett's Metaplasia-Dysplasia-Invasive Adenocarcinoma Sequence in Esophagus
    Article Snippet: For cDNA synthesis, 200 ng of total RNA from each adenocarcinoma sample was reverse-transcribed in a final volume of 20 μl using random primers and SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA). .. PCR assays included 10 μl of TaqMan Universal Master Mix No Amperase UNG (2×), 1 μl of 20× Assays-on-Demand Gene Expression Assay Mix, and 2 μl of cDNA diluted in RNase-free water in a final volume of 20 μl.

    Article Title: Effect of Kangshuanyihao Formula on the Inflammatory Reaction and SIRT1/TLR4/NF-κB Signaling Pathway in Endothelial Injury
    Article Snippet: The total RNA from tissue was extracted using the TRIzol kit according to the manufacturer's instructions. cDNA was generated from 500 ng of total RNA using SuperScript II Reverse Transcriptase (Invitrogen). .. Quantitative reverse transcription-PCR analysis was carried out using SYBR green PCR master mix and was analyzed on a MyIQ real-time PCR cycler (BioRad, Veenendaal, Netherlands).

    Article Title: Glutathione-mediated antioxidant response and aerobic metabolism: two crucial factors involved in determining the multi-drug resistance of high-risk neuroblastoma
    Article Snippet: Total RNA (1 μg) was reverse-transcribed into cDNA by a random hexamer primer and SuperScript™ II Reverse Transcriptase (LifeTechnologies). .. Amplification of cDNA by a polymerase chain reaction was performed using AmpliTaq Polymerase (LifeTechnologies) and specific primers for GCLC F 5′-ATG GAG GTG CAA TTA ACA GAC-3′; GCLC R 5′-ACT GCA TTG CCA CCT TTG CA-3′ (206 bp); GCLM F 5′-CCA GAT GTC TTG GAA TGC-3′; GCLM R 5′-TGC AGT CAA ATC TGG TGG-3′(408 bp); GAPDH F 5′-AGC CAC ATC GCT CAG ACA CC-3′; and GAPDH R 5′-TGA GGC TGT TGT CAT ACT TCT C-3′ (426 bp).

    Article Title: Infections of virulent and avirulent viruses differentially influenced the expression of dicer-1, ago-1, and microRNAs in Bombus terrestris
    Article Snippet: An amount of 2 μg total RNA was used to synthesize the cDNA by SuperScript® II Reverse Transcriptase (Invitrogen, USA) using oligo (dT) primers. .. To make sure there was no genomic DNA contamination, we checked cDNA samples by PCR with exon spanning primers for RPL23 ( ).

    Article Title: Hybrid-Transcriptome Sequencing and Associated Metabolite Analysis Reveal Putative Genes Involved in Flower Color Difference in Rose Mutants
    Article Snippet: Double-stranded RNA-complementary DNA (cDNA) was synthesized using a SuperScript II Double-Stranded cDNA Synthesis Kit (part#18064014, Invitrogen, CA, USA) and random hexamer primers. .. A range of cDNA fragments (200 ± 25 bp) were excised from the gel and selected for PCR amplification as templates.

    Article Title: Molecular Cloning and Characterization of WdPKS1, a Gene Involved in Dihydroxynaphthalene Melanin Biosynthesis and Virulence in Wangiella (Exophiala) dermatitidis
    Article Snippet: The 772-bp PCR fragment of WdPKS1 was amplified from genomic DNA using primers PKS-1 (5′ TGAATTCGACACGGCCTGTTCA/CTCCA 3′) and PKS-2 (5′ ACATATGGCGGCACTGAAGTTGTTGA 3′). .. First-strand synthesis of the cDNA was achieved using SuperScript II reverse transcriptase (Life Technologies Inc., Rockville, Md.) according to the instructions of the manufacturer.

    Article Title: TDRD6 mediates early steps of spliceosome maturation in primary spermatocytes
    Article Snippet: 100ng to 1μg of total RNA was treated with RQ1 RNase-Free DNase (Promega) according to manufacturer’s instructions and reverse transcribed into first strand cDNA via SuperScript II reverse transcriptase (Invitrogen) and random primer mix (NEB) according to manufacturer’s instructions. .. 2μl of the RT reaction was used directly as a template in a total volume of 20μl of real time PCR reaction with Rotor-Gene SYBR Green PCR Kit (Qiagen) according to manufacturer’s instructions.

    Article Title: In vitro long-term treatment with MAPK inhibitors induces melanoma cells with resistance plasticity to inhibitors while retaining sensitivity to CD8 T cells
    Article Snippet: Paragraph title: Quantitative real-time reverse transcriptase PCR (RT-qPCR) ... One microgram of RNA was reverse-transcribed using SuperScript™ II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA).

    Article Title: Streptococcus pneumoniae in Biofilms Are Unable to Cause Invasive Disease Due to Altered Virulence Determinant Production
    Article Snippet: Aliquots of 2 µg of the total RNAs were reverse transcribed into single-stranded cDNA using 200 U Superscript II reverse transcriptase (Invitrogen), 6 µg random hexamers (Invitrogen), 1× first strand buffer (Invitrogen), 10 mM dithiothreitol (DTT), 0.5 mM dATP, 0.5 mM dCTP, 0.5 mM dGTP, 0.3 mM dTTP and 0.2 mM of aminoallyl-modified nucleotide (Invitrogen). .. Amine-modified cDNA was purified using QIAquick PCR purification kit (QIAGEN) followed by chemical labeling with Cy3- or Cy5-NHS-ester fluorescent dyes (GE Healthcare, Piscataway, NJ) in a final step.

    Article Title: BRI2 Interacts with BACE1 and Regulates Its Cellular Levels by Promoting its Degradation and Reducing Its mRNA Levels
    Article Snippet: Total mRNA was extracted using Magnapure Compact RNA Isolation kit on a Magnapure DNA/RNA extractor (F. Hoffmann-La Roche AG, Basel, Switzerland) according to the manufacturer’s instructions. cDNA synthesis was performed using the Superscript II Reverse Transcriptase and random primers both from Invitrogen (Carlsbad, CA, USA) according to the manufacturer’s instructions. .. Initially, using the same primers to be used in real time PCR but not the labeled probes, we performed PCR reactions, purified the corresponding BACE1 and GAPDH fragments and generated DNA solutions covering a range of concentrations from 25ng/ul to 25×10−9 ng/ul.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Effect of Kangshuanyihao Formula on the Inflammatory Reaction and SIRT1/TLR4/NF-κB Signaling Pathway in Endothelial Injury
    Article Snippet: Paragraph title: 2.9. Reverse Transcription-Polymerase Chain Reaction (RT-PCR) ... The total RNA from tissue was extracted using the TRIzol kit according to the manufacturer's instructions. cDNA was generated from 500 ng of total RNA using SuperScript II Reverse Transcriptase (Invitrogen).

    Article Title: Glutathione-mediated antioxidant response and aerobic metabolism: two crucial factors involved in determining the multi-drug resistance of high-risk neuroblastoma
    Article Snippet: Paragraph title: RT-PCR analysis ... Total RNA (1 μg) was reverse-transcribed into cDNA by a random hexamer primer and SuperScript™ II Reverse Transcriptase (LifeTechnologies).

    Article Title: Molecular Cloning and Characterization of WdPKS1, a Gene Involved in Dihydroxynaphthalene Melanin Biosynthesis and Virulence in Wangiella (Exophiala) dermatitidis
    Article Snippet: The primers used for reverse transcription (RT)-PCR were RT-PKS1 (5′ CGTCCACTCGCTCACACTCT 3′), RT-PKS2 (5′ ACCGACTAGTCGAGCAT 3′), RT-PKS9 (5′ GGGTGCTGAAGTCTGTAAA 3′), and RT-PKS10 (5′ TCCCTCTGTGTCGAGAAT 3′). .. First-strand synthesis of the cDNA was achieved using SuperScript II reverse transcriptase (Life Technologies Inc., Rockville, Md.) according to the instructions of the manufacturer.

    Cellular Antioxidant Activity Assay:

    Article Title: Glutathione-mediated antioxidant response and aerobic metabolism: two crucial factors involved in determining the multi-drug resistance of high-risk neuroblastoma
    Article Snippet: Total RNA (1 μg) was reverse-transcribed into cDNA by a random hexamer primer and SuperScript™ II Reverse Transcriptase (LifeTechnologies). .. Amplification of cDNA by a polymerase chain reaction was performed using AmpliTaq Polymerase (LifeTechnologies) and specific primers for GCLC F 5′-ATG GAG GTG CAA TTA ACA GAC-3′; GCLC R 5′-ACT GCA TTG CCA CCT TTG CA-3′ (206 bp); GCLM F 5′-CCA GAT GTC TTG GAA TGC-3′; GCLM R 5′-TGC AGT CAA ATC TGG TGG-3′(408 bp); GAPDH F 5′-AGC CAC ATC GCT CAG ACA CC-3′; and GAPDH R 5′-TGA GGC TGT TGT CAT ACT TCT C-3′ (426 bp).

    Magnetic Cell Separation:

    Article Title: TDRD6 mediates early steps of spliceosome maturation in primary spermatocytes
    Article Snippet: RNA extraction, DNase treatment, reverse transcription (RT), real time PCR Depending on experiment, total RNA was extracted from either whole testes or MACS-purified hCD4+ cells via Trizol (Invitrogen) according to manufacturer’s instructions. .. 100ng to 1μg of total RNA was treated with RQ1 RNase-Free DNase (Promega) according to manufacturer’s instructions and reverse transcribed into first strand cDNA via SuperScript II reverse transcriptase (Invitrogen) and random primer mix (NEB) according to manufacturer’s instructions.

    Nucleic Acid Electrophoresis:

    Article Title: GADD45A plays a protective role against temozolomide treatment in glioblastoma cells
    Article Snippet: The quality of RNA was estimated by the OD 260/280 ratio and 28 S/18 S ratio on argarose gel electrophoresis. .. Fluorescent labeled cDNA probes were made from 5 μg aliquots of total RNA samples by oligo (dT)-primer reverse transcription using Superscript II reverse transcriptase (Gibco, USA).

    Article Title: In vitro long-term treatment with MAPK inhibitors induces melanoma cells with resistance plasticity to inhibitors while retaining sensitivity to CD8 T cells
    Article Snippet: One microgram of RNA was reverse-transcribed using SuperScript™ II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). .. Α melting curve analysis and gel electrophoresis assessment were used to confirm the specificity of PCR reactions.

    Isolation:

    Article Title: Heparanase activity in alveolar and embryonal rhabdomyosarcoma: implications for tumor invasion
    Article Snippet: Tumor RNA was isolated by using RNA-zol (Tel-Test, Friendswood, USA) following the manufacturer's instructions. .. 1 μg of total RNA from each sample was reverse transcribed into cDNA using 500 ng random primers and 200 U SuperScript II Reverse Transcriptase (Invitrogen, Milan, Italy).

    Article Title: GADD45A plays a protective role against temozolomide treatment in glioblastoma cells
    Article Snippet: Paragraph title: RNA isolation and microarray hybridization ... Fluorescent labeled cDNA probes were made from 5 μg aliquots of total RNA samples by oligo (dT)-primer reverse transcription using Superscript II reverse transcriptase (Gibco, USA).

    Article Title: Infections of virulent and avirulent viruses differentially influenced the expression of dicer-1, ago-1, and microRNAs in Bombus terrestris
    Article Snippet: Paragraph title: RNA isolation, cDNA synthesis, and qPCR ... An amount of 2 μg total RNA was used to synthesize the cDNA by SuperScript® II Reverse Transcriptase (Invitrogen, USA) using oligo (dT) primers.

    Article Title: Hybrid-Transcriptome Sequencing and Associated Metabolite Analysis Reveal Putative Genes Involved in Flower Color Difference in Rose Mutants
    Article Snippet: RNA Extraction, NGS Library Construction, and Sequencing Total RNA was extracted using an mRNA Isolation Kit in accordance with the manufacturer’s protocol. .. Double-stranded RNA-complementary DNA (cDNA) was synthesized using a SuperScript II Double-Stranded cDNA Synthesis Kit (part#18064014, Invitrogen, CA, USA) and random hexamer primers.

    Article Title: VOLTAGE-ACTIVATED CALCIUM CHANNEL EXPRESSION PROFILES IN MOUSE BRAIN AND CULTURED HIPPOCAMPAL NEURONS
    Article Snippet: Paragraph title: RNA isolation from cultured hippocampal neurons ... Reverse transcription was performed on 5 μ l of RNA using Superscript II reverse transcriptase (Invitrogen, Carlsbad, USA) and random hexamer primers (Promega, Madison WI, USA); the RT mix was incubated at 37 °C for 60 min.

    Article Title: Molecular Cloning and Characterization of WdPKS1, a Gene Involved in Dihydroxynaphthalene Melanin Biosynthesis and Virulence in Wangiella (Exophiala) dermatitidis
    Article Snippet: First-strand synthesis of the cDNA was achieved using SuperScript II reverse transcriptase (Life Technologies Inc., Rockville, Md.) according to the instructions of the manufacturer. .. After transfection of E. coli XL1-Blue (Stratagene) by electroporation using a Gene Pulse apparatus (Bio-Rad Laboratories, Richmond, Calif.), plasmids were isolated from chloramphenicol-resistant colonies.

    Article Title: BRI2 Interacts with BACE1 and Regulates Its Cellular Levels by Promoting its Degradation and Reducing Its mRNA Levels
    Article Snippet: .. Total mRNA was extracted using Magnapure Compact RNA Isolation kit on a Magnapure DNA/RNA extractor (F. Hoffmann-La Roche AG, Basel, Switzerland) according to the manufacturer’s instructions. cDNA synthesis was performed using the Superscript II Reverse Transcriptase and random primers both from Invitrogen (Carlsbad, CA, USA) according to the manufacturer’s instructions. .. Initially, using the same primers to be used in real time PCR but not the labeled probes, we performed PCR reactions, purified the corresponding BACE1 and GAPDH fragments and generated DNA solutions covering a range of concentrations from 25ng/ul to 25×10−9 ng/ul.

    RNA Extraction:

    Article Title: Apolipoprotein E mRNA expression in mononuclear cells from normolipidemic and hypercholesterolemic individuals treated with atorvastatin
    Article Snippet: EDTA-anticoagulated blood samples were used to obtain peripheral blood mononuclear cells (PBMC) as previously described [ ] and immediately used for RNA extraction. .. Samples with RNA integrity number (RIN) lower than 5 were not used for mRNA experiments. cDNA was produced from 1 μg of total RNA by Superscript™ II Reverse Transcriptase (Invitrogen-Life Technologies, CA, USA).

    Article Title: Heparanase activity in alveolar and embryonal rhabdomyosarcoma: implications for tumor invasion
    Article Snippet: Paragraph title: RNA extraction and cDNA synthesis ... 1 μg of total RNA from each sample was reverse transcribed into cDNA using 500 ng random primers and 200 U SuperScript II Reverse Transcriptase (Invitrogen, Milan, Italy).

    Article Title: Hybrid-Transcriptome Sequencing and Associated Metabolite Analysis Reveal Putative Genes Involved in Flower Color Difference in Rose Mutants
    Article Snippet: Paragraph title: 4.3. RNA Extraction, NGS Library Construction, and Sequencing ... Double-stranded RNA-complementary DNA (cDNA) was synthesized using a SuperScript II Double-Stranded cDNA Synthesis Kit (part#18064014, Invitrogen, CA, USA) and random hexamer primers.

    Article Title: TDRD6 mediates early steps of spliceosome maturation in primary spermatocytes
    Article Snippet: Paragraph title: RNA extraction, DNase treatment, reverse transcription (RT), real time PCR ... 100ng to 1μg of total RNA was treated with RQ1 RNase-Free DNase (Promega) according to manufacturer’s instructions and reverse transcribed into first strand cDNA via SuperScript II reverse transcriptase (Invitrogen) and random primer mix (NEB) according to manufacturer’s instructions.

    Labeling:

    Article Title: GADD45A plays a protective role against temozolomide treatment in glioblastoma cells
    Article Snippet: .. Fluorescent labeled cDNA probes were made from 5 μg aliquots of total RNA samples by oligo (dT)-primer reverse transcription using Superscript II reverse transcriptase (Gibco, USA). .. Fluorescent nucleotide Cy5- and Cy3-dUTPs (GE Healthcare, UK) were used to label the cDNA of the experimental and reference tissue, respectively.

    Article Title: Streptococcus pneumoniae in Biofilms Are Unable to Cause Invasive Disease Due to Altered Virulence Determinant Production
    Article Snippet: Aliquots of 2 µg of the total RNAs were reverse transcribed into single-stranded cDNA using 200 U Superscript II reverse transcriptase (Invitrogen), 6 µg random hexamers (Invitrogen), 1× first strand buffer (Invitrogen), 10 mM dithiothreitol (DTT), 0.5 mM dATP, 0.5 mM dCTP, 0.5 mM dGTP, 0.3 mM dTTP and 0.2 mM of aminoallyl-modified nucleotide (Invitrogen). .. Amine-modified cDNA was purified using QIAquick PCR purification kit (QIAGEN) followed by chemical labeling with Cy3- or Cy5-NHS-ester fluorescent dyes (GE Healthcare, Piscataway, NJ) in a final step.

    Article Title: BRI2 Interacts with BACE1 and Regulates Its Cellular Levels by Promoting its Degradation and Reducing Its mRNA Levels
    Article Snippet: Total mRNA was extracted using Magnapure Compact RNA Isolation kit on a Magnapure DNA/RNA extractor (F. Hoffmann-La Roche AG, Basel, Switzerland) according to the manufacturer’s instructions. cDNA synthesis was performed using the Superscript II Reverse Transcriptase and random primers both from Invitrogen (Carlsbad, CA, USA) according to the manufacturer’s instructions. .. Initially, using the same primers to be used in real time PCR but not the labeled probes, we performed PCR reactions, purified the corresponding BACE1 and GAPDH fragments and generated DNA solutions covering a range of concentrations from 25ng/ul to 25×10−9 ng/ul.

    Purification:

    Article Title: GADD45A plays a protective role against temozolomide treatment in glioblastoma cells
    Article Snippet: Briefly, total of 5 × 106 cells were collected and processed for total RNA with a commercial kit (TRIzol Plus RNA Purification System, Invitrogen, USA) according to the manufacturer’s protocol. .. Fluorescent labeled cDNA probes were made from 5 μg aliquots of total RNA samples by oligo (dT)-primer reverse transcription using Superscript II reverse transcriptase (Gibco, USA).

    Article Title: Hybrid-Transcriptome Sequencing and Associated Metabolite Analysis Reveal Putative Genes Involved in Flower Color Difference in Rose Mutants
    Article Snippet: Double-stranded RNA-complementary DNA (cDNA) was synthesized using a SuperScript II Double-Stranded cDNA Synthesis Kit (part#18064014, Invitrogen, CA, USA) and random hexamer primers. .. The cDNA fragments were subjected to purification, end repair, and ligation to sequencing adapters.

    Article Title: In vitro long-term treatment with MAPK inhibitors induces melanoma cells with resistance plasticity to inhibitors while retaining sensitivity to CD8 T cells
    Article Snippet: Quantitative real-time reverse transcriptase PCR (RT-qPCR) Total RNA was purified using TRIzol reagent (Ambion, Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. .. One microgram of RNA was reverse-transcribed using SuperScript™ II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA).

    Article Title: Streptococcus pneumoniae in Biofilms Are Unable to Cause Invasive Disease Due to Altered Virulence Determinant Production
    Article Snippet: Aliquots of 2 µg of the total RNAs were reverse transcribed into single-stranded cDNA using 200 U Superscript II reverse transcriptase (Invitrogen), 6 µg random hexamers (Invitrogen), 1× first strand buffer (Invitrogen), 10 mM dithiothreitol (DTT), 0.5 mM dATP, 0.5 mM dCTP, 0.5 mM dGTP, 0.3 mM dTTP and 0.2 mM of aminoallyl-modified nucleotide (Invitrogen). .. Amine-modified cDNA was purified using QIAquick PCR purification kit (QIAGEN) followed by chemical labeling with Cy3- or Cy5-NHS-ester fluorescent dyes (GE Healthcare, Piscataway, NJ) in a final step.

    Article Title: BRI2 Interacts with BACE1 and Regulates Its Cellular Levels by Promoting its Degradation and Reducing Its mRNA Levels
    Article Snippet: Total mRNA was extracted using Magnapure Compact RNA Isolation kit on a Magnapure DNA/RNA extractor (F. Hoffmann-La Roche AG, Basel, Switzerland) according to the manufacturer’s instructions. cDNA synthesis was performed using the Superscript II Reverse Transcriptase and random primers both from Invitrogen (Carlsbad, CA, USA) according to the manufacturer’s instructions. .. Initially, using the same primers to be used in real time PCR but not the labeled probes, we performed PCR reactions, purified the corresponding BACE1 and GAPDH fragments and generated DNA solutions covering a range of concentrations from 25ng/ul to 25×10−9 ng/ul.

    Sequencing:

    Article Title: MicroRNA-196a Is a Potential Marker of Progression during Barrett's Metaplasia-Dysplasia-Invasive Adenocarcinoma Sequence in Esophagus
    Article Snippet: For cDNA synthesis, 200 ng of total RNA from each adenocarcinoma sample was reverse-transcribed in a final volume of 20 μl using random primers and SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA). .. The TaqMan minor groove binder probe and the ABI Prism 7900 HT sequence detection system (PE Applied Biosystems) were used to perform real-time qPCR.

    Article Title: Hybrid-Transcriptome Sequencing and Associated Metabolite Analysis Reveal Putative Genes Involved in Flower Color Difference in Rose Mutants
    Article Snippet: Paragraph title: 4.3. RNA Extraction, NGS Library Construction, and Sequencing ... Double-stranded RNA-complementary DNA (cDNA) was synthesized using a SuperScript II Double-Stranded cDNA Synthesis Kit (part#18064014, Invitrogen, CA, USA) and random hexamer primers.

    Blocking Assay:

    Article Title: GADD45A plays a protective role against temozolomide treatment in glioblastoma cells
    Article Snippet: Fluorescent labeled cDNA probes were made from 5 μg aliquots of total RNA samples by oligo (dT)-primer reverse transcription using Superscript II reverse transcriptase (Gibco, USA). .. The blocking reagents, 50% formamide, 10X SSC (sodium saline citrate, Sigma-Aldrich, USA), 0.2% SDS (sodium dodecyl sulfate, Sigma-Aldrich, USA), 20 μg of poly (dA) polymer (GE Healthcare, UK), and 20 μg of human COT-1 DNA (Gibco, USA), were added to the probes.

    Agarose Gel Electrophoresis:

    Article Title: Glutathione-mediated antioxidant response and aerobic metabolism: two crucial factors involved in determining the multi-drug resistance of high-risk neuroblastoma
    Article Snippet: Total RNA (1 μg) was reverse-transcribed into cDNA by a random hexamer primer and SuperScript™ II Reverse Transcriptase (LifeTechnologies). .. PCR products were separated by electrophoresis on 2 % agarose gel, pre-stained with ethidium bromide, and then visualized under UV light and quantified by densitometric analysis by using a specific software (GelDoc, BioRad, Milan, Italy).

    Article Title: Infections of virulent and avirulent viruses differentially influenced the expression of dicer-1, ago-1, and microRNAs in Bombus terrestris
    Article Snippet: The quantity and quality of RNA samples were checked by Nanodrop and electrophoresis on 1.5% agarose gel. .. An amount of 2 μg total RNA was used to synthesize the cDNA by SuperScript® II Reverse Transcriptase (Invitrogen, USA) using oligo (dT) primers.

    Activated Clotting Time Assay:

    Article Title: Glutathione-mediated antioxidant response and aerobic metabolism: two crucial factors involved in determining the multi-drug resistance of high-risk neuroblastoma
    Article Snippet: Total RNA (1 μg) was reverse-transcribed into cDNA by a random hexamer primer and SuperScript™ II Reverse Transcriptase (LifeTechnologies). .. Amplification of cDNA by a polymerase chain reaction was performed using AmpliTaq Polymerase (LifeTechnologies) and specific primers for GCLC F 5′-ATG GAG GTG CAA TTA ACA GAC-3′; GCLC R 5′-ACT GCA TTG CCA CCT TTG CA-3′ (206 bp); GCLM F 5′-CCA GAT GTC TTG GAA TGC-3′; GCLM R 5′-TGC AGT CAA ATC TGG TGG-3′(408 bp); GAPDH F 5′-AGC CAC ATC GCT CAG ACA CC-3′; and GAPDH R 5′-TGA GGC TGT TGT CAT ACT TCT C-3′ (426 bp).

    Software:

    Article Title: Apolipoprotein E mRNA expression in mononuclear cells from normolipidemic and hypercholesterolemic individuals treated with atorvastatin
    Article Snippet: Samples with RNA integrity number (RIN) lower than 5 were not used for mRNA experiments. cDNA was produced from 1 μg of total RNA by Superscript™ II Reverse Transcriptase (Invitrogen-Life Technologies, CA, USA). .. Genorm software http://medgen.ugent.be/genorm was used to select the most stable among six endogenous reference genes [ubiquitin C (UBC ), glyceraldehyde-3-phosphate dehydrogenase (GAPD ), beta-2-microglobulin (B2M ), Hypoxanthine phosphoribosyl-transferase I (HPRTI ), succinate dehydrogenase complex, subunit A (SDHA ) and hydroxymethyl-bilane synthase (HMBS )], and the most stable in the experimental conditions was UBC .

    Article Title: Glutathione-mediated antioxidant response and aerobic metabolism: two crucial factors involved in determining the multi-drug resistance of high-risk neuroblastoma
    Article Snippet: Total RNA (1 μg) was reverse-transcribed into cDNA by a random hexamer primer and SuperScript™ II Reverse Transcriptase (LifeTechnologies). .. PCR products were separated by electrophoresis on 2 % agarose gel, pre-stained with ethidium bromide, and then visualized under UV light and quantified by densitometric analysis by using a specific software (GelDoc, BioRad, Milan, Italy).

    Real-time Polymerase Chain Reaction:

    Article Title: MicroRNA-196a Is a Potential Marker of Progression during Barrett's Metaplasia-Dysplasia-Invasive Adenocarcinoma Sequence in Esophagus
    Article Snippet: For cDNA synthesis, 200 ng of total RNA from each adenocarcinoma sample was reverse-transcribed in a final volume of 20 μl using random primers and SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA). .. The TaqMan minor groove binder probe and the ABI Prism 7900 HT sequence detection system (PE Applied Biosystems) were used to perform real-time qPCR.

    Article Title: Apolipoprotein E mRNA expression in mononuclear cells from normolipidemic and hypercholesterolemic individuals treated with atorvastatin
    Article Snippet: Samples with RNA integrity number (RIN) lower than 5 were not used for mRNA experiments. cDNA was produced from 1 μg of total RNA by Superscript™ II Reverse Transcriptase (Invitrogen-Life Technologies, CA, USA). .. APOE mRNA expression was measured by quantitative TaqMan real-time PCR (qPCR).

    Article Title: Effect of Kangshuanyihao Formula on the Inflammatory Reaction and SIRT1/TLR4/NF-κB Signaling Pathway in Endothelial Injury
    Article Snippet: The total RNA from tissue was extracted using the TRIzol kit according to the manufacturer's instructions. cDNA was generated from 500 ng of total RNA using SuperScript II Reverse Transcriptase (Invitrogen). .. Quantitative reverse transcription-PCR analysis was carried out using SYBR green PCR master mix and was analyzed on a MyIQ real-time PCR cycler (BioRad, Veenendaal, Netherlands).

    Article Title: Infections of virulent and avirulent viruses differentially influenced the expression of dicer-1, ago-1, and microRNAs in Bombus terrestris
    Article Snippet: Paragraph title: RNA isolation, cDNA synthesis, and qPCR ... An amount of 2 μg total RNA was used to synthesize the cDNA by SuperScript® II Reverse Transcriptase (Invitrogen, USA) using oligo (dT) primers.

    Article Title: TDRD6 mediates early steps of spliceosome maturation in primary spermatocytes
    Article Snippet: Paragraph title: RNA extraction, DNase treatment, reverse transcription (RT), real time PCR ... 100ng to 1μg of total RNA was treated with RQ1 RNase-Free DNase (Promega) according to manufacturer’s instructions and reverse transcribed into first strand cDNA via SuperScript II reverse transcriptase (Invitrogen) and random primer mix (NEB) according to manufacturer’s instructions.

    Article Title: Downregulation of the tumor suppressor HSPB7, involved in the p53 pathway, in renal cell carcinoma by hypermethylation
    Article Snippet: .. RNAs from tissue samples were treated with DNase I and subjected to two rounds of RNA amplification using T7-based in vitro transcription (Epicentre Technologies, Madison, WI, USA), then amplified RNAs were reversely transcribed to single-stranded cDNAs using random primer with Superscript II reverse transcriptase (Invitrogen) according to the manufacturer’s instruction. qPCR was conducted using the SYBR-Green I Master (Roche) on a LightCycler 480 (Roche). ..

    Article Title: BRI2 Interacts with BACE1 and Regulates Its Cellular Levels by Promoting its Degradation and Reducing Its mRNA Levels
    Article Snippet: Paragraph title: Preparation of mRNA, Synthesis of cDNA and Quantitative Real Time PCR ... Total mRNA was extracted using Magnapure Compact RNA Isolation kit on a Magnapure DNA/RNA extractor (F. Hoffmann-La Roche AG, Basel, Switzerland) according to the manufacturer’s instructions. cDNA synthesis was performed using the Superscript II Reverse Transcriptase and random primers both from Invitrogen (Carlsbad, CA, USA) according to the manufacturer’s instructions.

    Functional Assay:

    Article Title: Streptococcus pneumoniae in Biofilms Are Unable to Cause Invasive Disease Due to Altered Virulence Determinant Production
    Article Snippet: The microarrays (version 8) were kindly provided by the Pathogen Functional Genomics Resource Center ( http://pfgrc.jcvi.org/index.php/microarray/array_description/streptococcus_pneumoniae/version8.html ) and experiments were performed as previously described . .. Aliquots of 2 µg of the total RNAs were reverse transcribed into single-stranded cDNA using 200 U Superscript II reverse transcriptase (Invitrogen), 6 µg random hexamers (Invitrogen), 1× first strand buffer (Invitrogen), 10 mM dithiothreitol (DTT), 0.5 mM dATP, 0.5 mM dCTP, 0.5 mM dGTP, 0.3 mM dTTP and 0.2 mM of aminoallyl-modified nucleotide (Invitrogen).

    Sample Prep:

    Article Title: Hybrid-Transcriptome Sequencing and Associated Metabolite Analysis Reveal Putative Genes Involved in Flower Color Difference in Rose Mutants
    Article Snippet: The libraries were constructed using a TruSeq Stranded mRNA LT Sample Prep Kit (Illumina, San Diego, CA, USA) in accordance with the manufacturer’s instructions. .. Double-stranded RNA-complementary DNA (cDNA) was synthesized using a SuperScript II Double-Stranded cDNA Synthesis Kit (part#18064014, Invitrogen, CA, USA) and random hexamer primers.

    In Vitro:

    Article Title: Downregulation of the tumor suppressor HSPB7, involved in the p53 pathway, in renal cell carcinoma by hypermethylation
    Article Snippet: .. RNAs from tissue samples were treated with DNase I and subjected to two rounds of RNA amplification using T7-based in vitro transcription (Epicentre Technologies, Madison, WI, USA), then amplified RNAs were reversely transcribed to single-stranded cDNAs using random primer with Superscript II reverse transcriptase (Invitrogen) according to the manufacturer’s instruction. qPCR was conducted using the SYBR-Green I Master (Roche) on a LightCycler 480 (Roche). ..

    Electrophoresis:

    Article Title: Glutathione-mediated antioxidant response and aerobic metabolism: two crucial factors involved in determining the multi-drug resistance of high-risk neuroblastoma
    Article Snippet: Total RNA (1 μg) was reverse-transcribed into cDNA by a random hexamer primer and SuperScript™ II Reverse Transcriptase (LifeTechnologies). .. PCR products were separated by electrophoresis on 2 % agarose gel, pre-stained with ethidium bromide, and then visualized under UV light and quantified by densitometric analysis by using a specific software (GelDoc, BioRad, Milan, Italy).

    Article Title: Infections of virulent and avirulent viruses differentially influenced the expression of dicer-1, ago-1, and microRNAs in Bombus terrestris
    Article Snippet: The quantity and quality of RNA samples were checked by Nanodrop and electrophoresis on 1.5% agarose gel. .. An amount of 2 μg total RNA was used to synthesize the cDNA by SuperScript® II Reverse Transcriptase (Invitrogen, USA) using oligo (dT) primers.

    Next-Generation Sequencing:

    Article Title: Hybrid-Transcriptome Sequencing and Associated Metabolite Analysis Reveal Putative Genes Involved in Flower Color Difference in Rose Mutants
    Article Snippet: Paragraph title: 4.3. RNA Extraction, NGS Library Construction, and Sequencing ... Double-stranded RNA-complementary DNA (cDNA) was synthesized using a SuperScript II Double-Stranded cDNA Synthesis Kit (part#18064014, Invitrogen, CA, USA) and random hexamer primers.

    Incubation:

    Article Title: VOLTAGE-ACTIVATED CALCIUM CHANNEL EXPRESSION PROFILES IN MOUSE BRAIN AND CULTURED HIPPOCAMPAL NEURONS
    Article Snippet: .. Reverse transcription was performed on 5 μ l of RNA using Superscript II reverse transcriptase (Invitrogen, Carlsbad, USA) and random hexamer primers (Promega, Madison WI, USA); the RT mix was incubated at 37 °C for 60 min. .. BALB/c mice of different age (E16, PD1, 2 and 8 weeks) were euthanized by CO2 exposure and decapitated.

    Article Title: Streptococcus pneumoniae in Biofilms Are Unable to Cause Invasive Disease Due to Altered Virulence Determinant Production
    Article Snippet: Aliquots of 2 µg of the total RNAs were reverse transcribed into single-stranded cDNA using 200 U Superscript II reverse transcriptase (Invitrogen), 6 µg random hexamers (Invitrogen), 1× first strand buffer (Invitrogen), 10 mM dithiothreitol (DTT), 0.5 mM dATP, 0.5 mM dCTP, 0.5 mM dGTP, 0.3 mM dTTP and 0.2 mM of aminoallyl-modified nucleotide (Invitrogen). .. The mixture was incubated overnight at 42°C and the reaction stopped by addition of 10 µl 0.5 M EDTA and 10 µl 1 M NaOH.

    Spectrophotometry:

    Article Title: Apolipoprotein E mRNA expression in mononuclear cells from normolipidemic and hypercholesterolemic individuals treated with atorvastatin
    Article Snippet: RNA was dissolved in DEPC-treated water and the concentration was measured by spectrophotometry using the NanoDrop® (NanoDrop Technologies INC., DE, USA). .. Samples with RNA integrity number (RIN) lower than 5 were not used for mRNA experiments. cDNA was produced from 1 μg of total RNA by Superscript™ II Reverse Transcriptase (Invitrogen-Life Technologies, CA, USA).

    Article Title: TDRD6 mediates early steps of spliceosome maturation in primary spermatocytes
    Article Snippet: Concentration and purity of the RNA samples were determined by UV absorbance measurements using the NanoDrop 2000c Spectrophotometer (Thermo Scientific). .. 100ng to 1μg of total RNA was treated with RQ1 RNase-Free DNase (Promega) according to manufacturer’s instructions and reverse transcribed into first strand cDNA via SuperScript II reverse transcriptase (Invitrogen) and random primer mix (NEB) according to manufacturer’s instructions.

    Produced:

    Article Title: Apolipoprotein E mRNA expression in mononuclear cells from normolipidemic and hypercholesterolemic individuals treated with atorvastatin
    Article Snippet: .. Samples with RNA integrity number (RIN) lower than 5 were not used for mRNA experiments. cDNA was produced from 1 μg of total RNA by Superscript™ II Reverse Transcriptase (Invitrogen-Life Technologies, CA, USA). .. APOE mRNA expression was measured by quantitative TaqMan real-time PCR (qPCR).

    Concentration Assay:

    Article Title: Apolipoprotein E mRNA expression in mononuclear cells from normolipidemic and hypercholesterolemic individuals treated with atorvastatin
    Article Snippet: RNA was dissolved in DEPC-treated water and the concentration was measured by spectrophotometry using the NanoDrop® (NanoDrop Technologies INC., DE, USA). .. Samples with RNA integrity number (RIN) lower than 5 were not used for mRNA experiments. cDNA was produced from 1 μg of total RNA by Superscript™ II Reverse Transcriptase (Invitrogen-Life Technologies, CA, USA).

    Article Title: TDRD6 mediates early steps of spliceosome maturation in primary spermatocytes
    Article Snippet: Concentration and purity of the RNA samples were determined by UV absorbance measurements using the NanoDrop 2000c Spectrophotometer (Thermo Scientific). .. 100ng to 1μg of total RNA was treated with RQ1 RNase-Free DNase (Promega) according to manufacturer’s instructions and reverse transcribed into first strand cDNA via SuperScript II reverse transcriptase (Invitrogen) and random primer mix (NEB) according to manufacturer’s instructions.

    Construct:

    Article Title: Hybrid-Transcriptome Sequencing and Associated Metabolite Analysis Reveal Putative Genes Involved in Flower Color Difference in Rose Mutants
    Article Snippet: The libraries were constructed using a TruSeq Stranded mRNA LT Sample Prep Kit (Illumina, San Diego, CA, USA) in accordance with the manufacturer’s instructions. .. Double-stranded RNA-complementary DNA (cDNA) was synthesized using a SuperScript II Double-Stranded cDNA Synthesis Kit (part#18064014, Invitrogen, CA, USA) and random hexamer primers.