superscriptiii  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Thermo Fisher superscriptiii
    Superscriptiii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscriptiii/product/Thermo Fisher
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    superscriptiii - by Bioz Stars, 2020-04
    94/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: The peach (Prunus persica L. Batsch) genome harbours 10 KNOX genes, which are differentially expressed in stem development, and the class 1 KNOPE1 regulates elongation and lignification during primary growth
    Article Snippet: Isolation and sequence analysis of KNOPE genes in ‘Chiripa’ The KNOPE2 , KNOPE6 , STMlike1 , STMlike2, and KNOPE4 genes ( ; Supplementary Table S1 at JXB online) were cloned through degenerate primer strategies to amplify sequences in the MEINOX and HD of class 1 and 2 genes, followed by 5′ and 3′ rapid amplification of cDNA ends (RACEs) to produce full-length genes, and further checked by whole gene sequencing. .. The herbaceous stem RNA was isolated (Giannino et al. , 2000), DNase treated (RQ1, Promega), and 1 µg was reverse-transcribed at 55 °C by SuperscriptIII (Life Technologies).

    Article Title: Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria
    Article Snippet: .. Cloning, RNAi screening, and feeding assay Primers with overhangs homologous to pPR-T4P vector (J Rink) were used for PCR amplification from a cDNA library generated with SuperScriptIII (Life Technologies). .. PCR products were treated with T4 polymerase, mixed with linearized vector (digested with SmaI and treated with T4 polymerase) and incubated for 15 min at room temperature.

    Amplification:

    Article Title: Comparative genomics of xylose-fermenting fungi for enhanced biofuel production
    Article Snippet: Illumina reads improved the final consensus quality with Polisher ( ). mRNA was purified using the Absolutely mRNA purification kit (Stratagene) and was reverse transcribed with SuperScriptIII using dT15 VN2 primer. cDNA was synthesized with Escherichia coli DNA ligase, polymerase I, and RNaseH (Invitrogen), nebulized, and gel purified for fragment sizes between 500–800 bp. .. Single-stranded DNA libraries were amplified in bulk and sequenced using a 454 Genome Sequencer FLX.

    Article Title: Genome-wide characterization of methylguanosine-capped and polyadenylated small RNAs in the rice blast fungus Magnaporthe oryzae
    Article Snippet: The 3′-oligo (dT)20 VN linker (5′-GCGGCTGAAGACGGCCTATGTGGCC(T)20 VN-3′) was used to synthesize cDNA using SuperScriptIII (Invitrogen) according to supplier’s procedure. .. Double-stranded cDNA was amplified with high fidelity Platinum Taq DNA polymerase (Invitrogen) using 5′-PCR primers specific for the 5′-RNA linker (5′-AGCATCGAGTCGGCCTTGTTG-3′) and 3′-PCR primers specific for the 3′-oligo(dT)20 VN linker (5′-GCGGCTGAAGACGGCCTATGTG-3′).

    Article Title: Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria
    Article Snippet: .. Cloning, RNAi screening, and feeding assay Primers with overhangs homologous to pPR-T4P vector (J Rink) were used for PCR amplification from a cDNA library generated with SuperScriptIII (Life Technologies). .. PCR products were treated with T4 polymerase, mixed with linearized vector (digested with SmaI and treated with T4 polymerase) and incubated for 15 min at room temperature.

    Random Hexamer Labeling:

    Article Title: A role for sphingosine kinase 1 in dextran sulfate sodium-induced colitis
    Article Snippet: .. RNA extracted from colon tissue was reverse-transcribed into cDNA using the SuperScript III First Strand cDNA synthesis system from Invitrogen (Carlsbad, CA, USA). cDNA was synthesized from 0.5 μg RNA using random hexamer primers and SuperScriptIII from Invitrogen. .. Real-time RT-PCR was performed on a Bio-Rad iCycler to quantify mRNA levels of SK1, COX-2, and TNF-α.

    Synthesized:

    Article Title: Fematrin-1 Is Involved in Fetomaternal Cell-to-Cell Fusion in Bovinae Placenta and Has Contributed to Diversity of Ruminant Placentation
    Article Snippet: .. Total RNA was isolated from frozen tissues and cultured cells by using TRIzol reagent (Invitrogen). cDNA was synthesized from 1 μg of total RNA by using SuperScriptIII (Invitrogen) and stored at −80°C prior to experiments. .. Reverse transcription-PCR (RT-PCR) of bovine FAT2 ( bFAT2 ) was performed by using PrimeStar GXL polymerase.

    Article Title: The tumour antigen PRAME is a subunit of a Cul2 ubiquitin ligase and associates with active NFY promoters
    Article Snippet: .. Double-stranded cDNA was synthesized from the fragmented RNA with SuperscriptIII (Invitrogen) using random hexamers, and then used for Illumina sample prepping and sequencing (see below). .. A total of 7 246 489 RNA-seq reads were uniquely mapped to hg18 and used for bioinformatical analysis.

    Article Title: Comparative genomics of xylose-fermenting fungi for enhanced biofuel production
    Article Snippet: .. Illumina reads improved the final consensus quality with Polisher ( ). mRNA was purified using the Absolutely mRNA purification kit (Stratagene) and was reverse transcribed with SuperScriptIII using dT15 VN2 primer. cDNA was synthesized with Escherichia coli DNA ligase, polymerase I, and RNaseH (Invitrogen), nebulized, and gel purified for fragment sizes between 500–800 bp. ..

    Article Title: A role for sphingosine kinase 1 in dextran sulfate sodium-induced colitis
    Article Snippet: .. RNA extracted from colon tissue was reverse-transcribed into cDNA using the SuperScript III First Strand cDNA synthesis system from Invitrogen (Carlsbad, CA, USA). cDNA was synthesized from 0.5 μg RNA using random hexamer primers and SuperScriptIII from Invitrogen. .. Real-time RT-PCR was performed on a Bio-Rad iCycler to quantify mRNA levels of SK1, COX-2, and TNF-α.

    Article Title: Regulated motion of glycoproteins revealed by direct visualization of a single cargo in the endoplasmic reticulum
    Article Snippet: .. RNA was extracted using RNAiso (Takara Bio) from cells transfected with Stealth siRNA (Invitrogen) at 24 h after transfection. cDNA was synthesized from the total RNA using SuperscriptIII (Invitrogen) with an oligo(dT) primer. .. For real-time PCR, the prepared cDNA wasanalyzed in triplicate with the SYBR PremixEX Taq (Takara Bio) in a LightCycler (Roche).

    Quantitative RT-PCR:

    Article Title: Fematrin-1 Is Involved in Fetomaternal Cell-to-Cell Fusion in Bovinae Placenta and Has Contributed to Diversity of Ruminant Placentation
    Article Snippet: Paragraph title: RT-PCR and quantitative real-time RT-PCR. ... Total RNA was isolated from frozen tissues and cultured cells by using TRIzol reagent (Invitrogen). cDNA was synthesized from 1 μg of total RNA by using SuperScriptIII (Invitrogen) and stored at −80°C prior to experiments.

    Article Title: A role for sphingosine kinase 1 in dextran sulfate sodium-induced colitis
    Article Snippet: RNA extracted from colon tissue was reverse-transcribed into cDNA using the SuperScript III First Strand cDNA synthesis system from Invitrogen (Carlsbad, CA, USA). cDNA was synthesized from 0.5 μg RNA using random hexamer primers and SuperScriptIII from Invitrogen. .. Real-time RT-PCR was performed on a Bio-Rad iCycler to quantify mRNA levels of SK1, COX-2, and TNF-α.

    SYBR Green Assay:

    Article Title: Conserved Gene Microsynteny Unveils Functional Interaction Between Protein Disulfide Isomerase and Rho Guanine-Dissociation Inhibitor Families
    Article Snippet: Total RNA of each sample was reverse transcribed into cDNA using SuperScriptIII and random primers (Invitrogen). .. Briefly, qPCR was performed on selected genes using Brilliant II SYBR Green QPCR Master Mix(Stratagene) with custom-designed primers on a Real-Time PCR System (ABI StepOne Plus).

    Article Title: Jun-regulated genes promote interaction of diffuse large B-cell lymphoma with the microenvironment
    Article Snippet: Total RNA was isolated by using an RNeasy kit (QIAGEN) and reverse transcribed by using SuperScriptIII (Invitrogen). .. Quantitative polymerase chain reaction (qPCR) was performed with Power SYBR Green PCR Master Mix (Applied Biosystems).

    Article Title: A role for sphingosine kinase 1 in dextran sulfate sodium-induced colitis
    Article Snippet: RNA extracted from colon tissue was reverse-transcribed into cDNA using the SuperScript III First Strand cDNA synthesis system from Invitrogen (Carlsbad, CA, USA). cDNA was synthesized from 0.5 μg RNA using random hexamer primers and SuperScriptIII from Invitrogen. .. The standard real-time RT-PCR reaction volume was 25 μl, including 12.5 μl SYBR Green PCR reagents (Bio-Rad, Hercules, CA, USA), 5 μl cDNA template, 1 μl forward primer (4 μM), 1 μl reverse primer (4 μM), and 5.5 μl water.

    Quantitation Assay:

    Article Title: Regulated motion of glycoproteins revealed by direct visualization of a single cargo in the endoplasmic reticulum
    Article Snippet: Paragraph title: RNA interference and quantitation of mRNA expression ... RNA was extracted using RNAiso (Takara Bio) from cells transfected with Stealth siRNA (Invitrogen) at 24 h after transfection. cDNA was synthesized from the total RNA using SuperscriptIII (Invitrogen) with an oligo(dT) primer.

    Article Title: Discovery of a Novel Compound with Anti-Venezuelan Equine Encephalitis Virus Activity That Targets the Nonstructural Protein 2
    Article Snippet: Paragraph title: VEEV RNA quantitation ... Ten microliter of RNA samples were subjected to a cDNA synthesis with SuperScriptIII (Life Technologies) and random hexamers by following the manufacturer's protocol.

    Infection:

    Article Title: Compromised genomic integrity impedes muscle growth after Atrx inactivation
    Article Snippet: .. RNA was harvested 48 hours after infection (Qiagen), and 1 μg RNA was reverse transcribed (SuperScriptIII; Invitrogen). cDNA was used for expression analysis of cell cycle genes by qPCR SuperArray (PAMM-020, SABiosciences). .. QPCR was performed on a Stratagene Mx3000P system.

    Article Title: Discovery of a Novel Compound with Anti-Venezuelan Equine Encephalitis Virus Activity That Targets the Nonstructural Protein 2
    Article Snippet: VEEV RNA quantitation Total RNAs from infected cells were isolated with Trizol (Life Technologies) reagent as per the manufacturer's protocol and were dissolved in 50 µL of deionized water. .. Ten microliter of RNA samples were subjected to a cDNA synthesis with SuperScriptIII (Life Technologies) and random hexamers by following the manufacturer's protocol.

    Expressing:

    Article Title: Compromised genomic integrity impedes muscle growth after Atrx inactivation
    Article Snippet: .. RNA was harvested 48 hours after infection (Qiagen), and 1 μg RNA was reverse transcribed (SuperScriptIII; Invitrogen). cDNA was used for expression analysis of cell cycle genes by qPCR SuperArray (PAMM-020, SABiosciences). .. QPCR was performed on a Stratagene Mx3000P system.

    Article Title: The tumour antigen PRAME is a subunit of a Cul2 ubiquitin ligase and associates with active NFY promoters
    Article Snippet: Double-stranded cDNA was synthesized from the fragmented RNA with SuperscriptIII (Invitrogen) using random hexamers, and then used for Illumina sample prepping and sequencing (see below). .. Normalized gene expression values (NE) for RefSeq genes were computed with Genomatix Region Miner tools.

    Article Title: Regulated motion of glycoproteins revealed by direct visualization of a single cargo in the endoplasmic reticulum
    Article Snippet: Paragraph title: RNA interference and quantitation of mRNA expression ... RNA was extracted using RNAiso (Takara Bio) from cells transfected with Stealth siRNA (Invitrogen) at 24 h after transfection. cDNA was synthesized from the total RNA using SuperscriptIII (Invitrogen) with an oligo(dT) primer.

    Transformation Assay:

    Article Title: Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria
    Article Snippet: Cloning, RNAi screening, and feeding assay Primers with overhangs homologous to pPR-T4P vector (J Rink) were used for PCR amplification from a cDNA library generated with SuperScriptIII (Life Technologies). .. Ligations were transformed directly into Escherichia coli strain HT115, then verified by PCR and sequencing.

    Over Expression:

    Article Title: Conserved Gene Microsynteny Unveils Functional Interaction Between Protein Disulfide Isomerase and Rho Guanine-Dissociation Inhibitor Families
    Article Snippet: Total RNA of each sample was reverse transcribed into cDNA using SuperScriptIII and random primers (Invitrogen). .. Primer sequences were as follows: PDIA1_Fw:AAGCTGCCGCAAAACTGAAG; PDIA1_Rv:TCACTTCGCTTGAGTCCACC; RhoGDIα_Fw:GACAAGGACGATGAAAGCCTCC; RhoGDIα_Rv:CCTGTCAGGTCCAGTTCCAGAG; 18s_Fw:AGGAATTGACGGAAGGGCACCA; 18s_Rv: GTGCAGCCCCGGACATCTAAG. b) Transgenic PDI mouse: Some experiments were performed with a newly-developed model of global transgenic constitutive overexpression of PDIA1 in mice (Fernandes DC et al ., paper under review).

    Transfection:

    Article Title: Regulated motion of glycoproteins revealed by direct visualization of a single cargo in the endoplasmic reticulum
    Article Snippet: .. RNA was extracted using RNAiso (Takara Bio) from cells transfected with Stealth siRNA (Invitrogen) at 24 h after transfection. cDNA was synthesized from the total RNA using SuperscriptIII (Invitrogen) with an oligo(dT) primer. .. For real-time PCR, the prepared cDNA wasanalyzed in triplicate with the SYBR PremixEX Taq (Takara Bio) in a LightCycler (Roche).

    Sequencing:

    Article Title: The peach (Prunus persica L. Batsch) genome harbours 10 KNOX genes, which are differentially expressed in stem development, and the class 1 KNOPE1 regulates elongation and lignification during primary growth
    Article Snippet: Paragraph title: Isolation and sequence analysis of KNOPE genes in ‘Chiripa’ ... The herbaceous stem RNA was isolated (Giannino et al. , 2000), DNase treated (RQ1, Promega), and 1 µg was reverse-transcribed at 55 °C by SuperscriptIII (Life Technologies).

    Article Title: The tumour antigen PRAME is a subunit of a Cul2 ubiquitin ligase and associates with active NFY promoters
    Article Snippet: .. Double-stranded cDNA was synthesized from the fragmented RNA with SuperscriptIII (Invitrogen) using random hexamers, and then used for Illumina sample prepping and sequencing (see below). .. A total of 7 246 489 RNA-seq reads were uniquely mapped to hg18 and used for bioinformatical analysis.

    Article Title: Comparative genomics of xylose-fermenting fungi for enhanced biofuel production
    Article Snippet: Paragraph title: Genome and EST Sequencing, Assembly, and Annotation. ... Illumina reads improved the final consensus quality with Polisher ( ). mRNA was purified using the Absolutely mRNA purification kit (Stratagene) and was reverse transcribed with SuperScriptIII using dT15 VN2 primer. cDNA was synthesized with Escherichia coli DNA ligase, polymerase I, and RNaseH (Invitrogen), nebulized, and gel purified for fragment sizes between 500–800 bp.

    Article Title: Genome-wide characterization of methylguanosine-capped and polyadenylated small RNAs in the rice blast fungus Magnaporthe oryzae
    Article Snippet: Paragraph title: RNA isolation, CPA-sRNA library construction and 454 sequencing ... The 3′-oligo (dT)20 VN linker (5′-GCGGCTGAAGACGGCCTATGTGGCC(T)20 VN-3′) was used to synthesize cDNA using SuperScriptIII (Invitrogen) according to supplier’s procedure.

    Article Title: Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria
    Article Snippet: Cloning, RNAi screening, and feeding assay Primers with overhangs homologous to pPR-T4P vector (J Rink) were used for PCR amplification from a cDNA library generated with SuperScriptIII (Life Technologies). .. Ligations were transformed directly into Escherichia coli strain HT115, then verified by PCR and sequencing.

    Article Title: The Star-Nosed Mole Reveals Clues to the Molecular Basis of Mammalian Touch
    Article Snippet: .. Total RNA was either DNAsed, re-purified (RNAeasy, Quiagen) and reverse transcribed (SuperScriptIII, Invitrogen) for qPCR or RT-PCR, or further purified with two rounds of poly-A selection (Dynabeads mRNA purification Kit, Invitrogen) for sequencing. .. Illumina Sequencing Poly-A selected mRNA from trigeminal ganglia and dorsal root ganglia were fragmented using Fragmentation Reagents (Applied Biosystems).

    Cell Culture:

    Article Title: Fematrin-1 Is Involved in Fetomaternal Cell-to-Cell Fusion in Bovinae Placenta and Has Contributed to Diversity of Ruminant Placentation
    Article Snippet: .. Total RNA was isolated from frozen tissues and cultured cells by using TRIzol reagent (Invitrogen). cDNA was synthesized from 1 μg of total RNA by using SuperScriptIII (Invitrogen) and stored at −80°C prior to experiments. .. Reverse transcription-PCR (RT-PCR) of bovine FAT2 ( bFAT2 ) was performed by using PrimeStar GXL polymerase.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Fematrin-1 Is Involved in Fetomaternal Cell-to-Cell Fusion in Bovinae Placenta and Has Contributed to Diversity of Ruminant Placentation
    Article Snippet: Paragraph title: RT-PCR and quantitative real-time RT-PCR. ... Total RNA was isolated from frozen tissues and cultured cells by using TRIzol reagent (Invitrogen). cDNA was synthesized from 1 μg of total RNA by using SuperScriptIII (Invitrogen) and stored at −80°C prior to experiments.

    Article Title: A protein complex required for polymerase V transcripts and RNA-directed DNA methylation in plants
    Article Snippet: Paragraph title: Detection of Pol-V dependent transcripts by reverse transcriptase PCR (RT-PCR) Highlights ... 14μl of a mix containing 2.5μl Platinum Taq buffer (minus MgCl2 ), 2μl 50 mM MgCl2 , 1μl 0.1 M DTT, 0.3μl RNaseOUT, 0.3μl Platinum Taq (Invitrogen), 0.3μl SuperScriptIII (Invitrogen) and 0.25μl 10 μM Taqman probe was added to each sample and incubation continued for 30 minutes at 55°C, followed by 15 minutes at 70°C.

    Article Title: A role for sphingosine kinase 1 in dextran sulfate sodium-induced colitis
    Article Snippet: Paragraph title: Real-time reverse transcriptase-polymerase chain reaction (RT-PCR) ... RNA extracted from colon tissue was reverse-transcribed into cDNA using the SuperScript III First Strand cDNA synthesis system from Invitrogen (Carlsbad, CA, USA). cDNA was synthesized from 0.5 μg RNA using random hexamer primers and SuperScriptIII from Invitrogen.

    Article Title: The Star-Nosed Mole Reveals Clues to the Molecular Basis of Mammalian Touch
    Article Snippet: .. Total RNA was either DNAsed, re-purified (RNAeasy, Quiagen) and reverse transcribed (SuperScriptIII, Invitrogen) for qPCR or RT-PCR, or further purified with two rounds of poly-A selection (Dynabeads mRNA purification Kit, Invitrogen) for sequencing. .. Illumina Sequencing Poly-A selected mRNA from trigeminal ganglia and dorsal root ganglia were fragmented using Fragmentation Reagents (Applied Biosystems).

    Generated:

    Article Title: Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria
    Article Snippet: .. Cloning, RNAi screening, and feeding assay Primers with overhangs homologous to pPR-T4P vector (J Rink) were used for PCR amplification from a cDNA library generated with SuperScriptIII (Life Technologies). .. PCR products were treated with T4 polymerase, mixed with linearized vector (digested with SmaI and treated with T4 polymerase) and incubated for 15 min at room temperature.

    Polymerase Chain Reaction:

    Article Title: The peach (Prunus persica L. Batsch) genome harbours 10 KNOX genes, which are differentially expressed in stem development, and the class 1 KNOPE1 regulates elongation and lignification during primary growth
    Article Snippet: The herbaceous stem RNA was isolated (Giannino et al. , 2000), DNase treated (RQ1, Promega), and 1 µg was reverse-transcribed at 55 °C by SuperscriptIII (Life Technologies). .. The PCR conditions of all experiments were: cDNA (200ng) or genomic DNA (gDNA; 500ng), and 0.2 µM primers, 0.5mM dNTPs, 2.5U of Taq DNA polymerase (Qiagen), 1× Taq buffer, 2.5mM MgCl2 , in a total volume of 50 µl; starting at 95 °C for 5min, 35 cycles at 95 °C for 40 s, 58 °C for either 30 s (for cDNA) or 60 s (for gDNA), and 72°C for 30–90 s, and final extension at 72 °C for 5min.

    Article Title: Fematrin-1 Is Involved in Fetomaternal Cell-to-Cell Fusion in Bovinae Placenta and Has Contributed to Diversity of Ruminant Placentation
    Article Snippet: Total RNA was isolated from frozen tissues and cultured cells by using TRIzol reagent (Invitrogen). cDNA was synthesized from 1 μg of total RNA by using SuperScriptIII (Invitrogen) and stored at −80°C prior to experiments. .. Quantitative real-time RT-PCR was conducted by using TaqMan universal PCR master mix (Applied Biosystems, Foster City, CA) and an ABI Prism 7000 real-time PCR system (Applied Biosystems) according to the manufacturer's instructions.

    Article Title: Jun-regulated genes promote interaction of diffuse large B-cell lymphoma with the microenvironment
    Article Snippet: Total RNA was isolated by using an RNeasy kit (QIAGEN) and reverse transcribed by using SuperScriptIII (Invitrogen). .. Quantitative polymerase chain reaction (qPCR) was performed with Power SYBR Green PCR Master Mix (Applied Biosystems).

    Article Title: Comparative genomics of xylose-fermenting fungi for enhanced biofuel production
    Article Snippet: Gaps were closed by gapResolution , PCR and fosmid clone primer walks, or editing in Consed ( ). .. Illumina reads improved the final consensus quality with Polisher ( ). mRNA was purified using the Absolutely mRNA purification kit (Stratagene) and was reverse transcribed with SuperScriptIII using dT15 VN2 primer. cDNA was synthesized with Escherichia coli DNA ligase, polymerase I, and RNaseH (Invitrogen), nebulized, and gel purified for fragment sizes between 500–800 bp.

    Article Title: Human Primordial Germ Cell Formation Is Diminished by Exposure to Environmental Toxicants Acting through the AHR Signaling Pathway
    Article Snippet: Paragraph title: High-density Real Time-PCR/Quantitative PCR analysis by Fluidigm. ... Total RNA was extracted using the RNeasy kit (Qiagen, Inc., Valencia, CA) and complementary DNA (cDNA) prepared with SuperScriptIII (Invitrogen) according to the manufacturer's protocols using 1 μg RNA.

    Article Title: A protein complex required for polymerase V transcripts and RNA-directed DNA methylation in plants
    Article Snippet: Paragraph title: Detection of Pol-V dependent transcripts by reverse transcriptase PCR (RT-PCR) Highlights ... 14μl of a mix containing 2.5μl Platinum Taq buffer (minus MgCl2 ), 2μl 50 mM MgCl2 , 1μl 0.1 M DTT, 0.3μl RNaseOUT, 0.3μl Platinum Taq (Invitrogen), 0.3μl SuperScriptIII (Invitrogen) and 0.25μl 10 μM Taqman probe was added to each sample and incubation continued for 30 minutes at 55°C, followed by 15 minutes at 70°C.

    Article Title: A role for sphingosine kinase 1 in dextran sulfate sodium-induced colitis
    Article Snippet: RNA extracted from colon tissue was reverse-transcribed into cDNA using the SuperScript III First Strand cDNA synthesis system from Invitrogen (Carlsbad, CA, USA). cDNA was synthesized from 0.5 μg RNA using random hexamer primers and SuperScriptIII from Invitrogen. .. The standard real-time RT-PCR reaction volume was 25 μl, including 12.5 μl SYBR Green PCR reagents (Bio-Rad, Hercules, CA, USA), 5 μl cDNA template, 1 μl forward primer (4 μM), 1 μl reverse primer (4 μM), and 5.5 μl water.

    Article Title: Genome-wide characterization of methylguanosine-capped and polyadenylated small RNAs in the rice blast fungus Magnaporthe oryzae
    Article Snippet: The 3′-oligo (dT)20 VN linker (5′-GCGGCTGAAGACGGCCTATGTGGCC(T)20 VN-3′) was used to synthesize cDNA using SuperScriptIII (Invitrogen) according to supplier’s procedure. .. The conditions used for PCR amplification were 94°C for 2 min followed by 30 cycles of 94°C for 30 s, 60°C for 30 s and 72°C for 1 min and a final extension at 72°C for 10 min. PCR products were resolved on 3% agarose gels and cDNA between 60 and 200 nt were purified using a Gel and PCR Clean-Up System (Promega).

    Article Title: Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria
    Article Snippet: .. Cloning, RNAi screening, and feeding assay Primers with overhangs homologous to pPR-T4P vector (J Rink) were used for PCR amplification from a cDNA library generated with SuperScriptIII (Life Technologies). .. PCR products were treated with T4 polymerase, mixed with linearized vector (digested with SmaI and treated with T4 polymerase) and incubated for 15 min at room temperature.

    RNA Sequencing Assay:

    Article Title: The tumour antigen PRAME is a subunit of a Cul2 ubiquitin ligase and associates with active NFY promoters
    Article Snippet: Paragraph title: RNA-seq library preparation and data analysis ... Double-stranded cDNA was synthesized from the fragmented RNA with SuperscriptIII (Invitrogen) using random hexamers, and then used for Illumina sample prepping and sequencing (see below).

    Isolation:

    Article Title: The peach (Prunus persica L. Batsch) genome harbours 10 KNOX genes, which are differentially expressed in stem development, and the class 1 KNOPE1 regulates elongation and lignification during primary growth
    Article Snippet: .. The herbaceous stem RNA was isolated (Giannino et al. , 2000), DNase treated (RQ1, Promega), and 1 µg was reverse-transcribed at 55 °C by SuperscriptIII (Life Technologies). ..

    Article Title: Conserved Gene Microsynteny Unveils Functional Interaction Between Protein Disulfide Isomerase and Rho Guanine-Dissociation Inhibitor Families
    Article Snippet: The eluate was then used for intimal RNA isolation according to manufacturer’s instructions (Zymo Research). .. Total RNA of each sample was reverse transcribed into cDNA using SuperScriptIII and random primers (Invitrogen).

    Article Title: Fematrin-1 Is Involved in Fetomaternal Cell-to-Cell Fusion in Bovinae Placenta and Has Contributed to Diversity of Ruminant Placentation
    Article Snippet: .. Total RNA was isolated from frozen tissues and cultured cells by using TRIzol reagent (Invitrogen). cDNA was synthesized from 1 μg of total RNA by using SuperScriptIII (Invitrogen) and stored at −80°C prior to experiments. .. Reverse transcription-PCR (RT-PCR) of bovine FAT2 ( bFAT2 ) was performed by using PrimeStar GXL polymerase.

    Article Title: Jun-regulated genes promote interaction of diffuse large B-cell lymphoma with the microenvironment
    Article Snippet: .. Total RNA was isolated by using an RNeasy kit (QIAGEN) and reverse transcribed by using SuperScriptIII (Invitrogen). .. Quantitative polymerase chain reaction (qPCR) was performed with Power SYBR Green PCR Master Mix (Applied Biosystems).

    Article Title: Genome-wide characterization of methylguanosine-capped and polyadenylated small RNAs in the rice blast fungus Magnaporthe oryzae
    Article Snippet: Paragraph title: RNA isolation, CPA-sRNA library construction and 454 sequencing ... The 3′-oligo (dT)20 VN linker (5′-GCGGCTGAAGACGGCCTATGTGGCC(T)20 VN-3′) was used to synthesize cDNA using SuperScriptIII (Invitrogen) according to supplier’s procedure.

    Article Title: Discovery of a Novel Compound with Anti-Venezuelan Equine Encephalitis Virus Activity That Targets the Nonstructural Protein 2
    Article Snippet: VEEV RNA quantitation Total RNAs from infected cells were isolated with Trizol (Life Technologies) reagent as per the manufacturer's protocol and were dissolved in 50 µL of deionized water. .. Ten microliter of RNA samples were subjected to a cDNA synthesis with SuperScriptIII (Life Technologies) and random hexamers by following the manufacturer's protocol.

    RNA Extraction:

    Article Title: The Star-Nosed Mole Reveals Clues to the Molecular Basis of Mammalian Touch
    Article Snippet: Paragraph title: RNA Extraction ... Total RNA was either DNAsed, re-purified (RNAeasy, Quiagen) and reverse transcribed (SuperScriptIII, Invitrogen) for qPCR or RT-PCR, or further purified with two rounds of poly-A selection (Dynabeads mRNA purification Kit, Invitrogen) for sequencing.

    Purification:

    Article Title: The tumour antigen PRAME is a subunit of a Cul2 ubiquitin ligase and associates with active NFY promoters
    Article Snippet: In all, 200 ng of purified poly(A)+ RNA were diluted in 160 μl RNAse-free water and fragmented by addition of 40 μl 5 × fragmentation buffer (200 mM Tris acetate pH 8.2, 500 mM potassium acetate and 150 mM magnesium acetate) and incubation at 94°C for 120 s. After purification with RNeasy Minelute Kit (Qiagen), the quality of fragmented RNA was analysed on an Experion (Bio-Rad). .. Double-stranded cDNA was synthesized from the fragmented RNA with SuperscriptIII (Invitrogen) using random hexamers, and then used for Illumina sample prepping and sequencing (see below).

    Article Title: Comparative genomics of xylose-fermenting fungi for enhanced biofuel production
    Article Snippet: .. Illumina reads improved the final consensus quality with Polisher ( ). mRNA was purified using the Absolutely mRNA purification kit (Stratagene) and was reverse transcribed with SuperScriptIII using dT15 VN2 primer. cDNA was synthesized with Escherichia coli DNA ligase, polymerase I, and RNaseH (Invitrogen), nebulized, and gel purified for fragment sizes between 500–800 bp. ..

    Article Title: A protein complex required for polymerase V transcripts and RNA-directed DNA methylation in plants
    Article Snippet: Purified RNA was then eluted with 62μl DEPC-treated H2 O, to which 7μl of 10X Turbo buffer and 1μl of Turbo DNase was added. .. 14μl of a mix containing 2.5μl Platinum Taq buffer (minus MgCl2 ), 2μl 50 mM MgCl2 , 1μl 0.1 M DTT, 0.3μl RNaseOUT, 0.3μl Platinum Taq (Invitrogen), 0.3μl SuperScriptIII (Invitrogen) and 0.25μl 10 μM Taqman probe was added to each sample and incubation continued for 30 minutes at 55°C, followed by 15 minutes at 70°C.

    Article Title: Genome-wide characterization of methylguanosine-capped and polyadenylated small RNAs in the rice blast fungus Magnaporthe oryzae
    Article Snippet: PolyA+ RNA was purified using a PolyATtract mRNA Isolation System III (Promega) according to manufacturer’s procedure. .. The 3′-oligo (dT)20 VN linker (5′-GCGGCTGAAGACGGCCTATGTGGCC(T)20 VN-3′) was used to synthesize cDNA using SuperScriptIII (Invitrogen) according to supplier’s procedure.

    Article Title: The Star-Nosed Mole Reveals Clues to the Molecular Basis of Mammalian Touch
    Article Snippet: .. Total RNA was either DNAsed, re-purified (RNAeasy, Quiagen) and reverse transcribed (SuperScriptIII, Invitrogen) for qPCR or RT-PCR, or further purified with two rounds of poly-A selection (Dynabeads mRNA purification Kit, Invitrogen) for sequencing. .. Illumina Sequencing Poly-A selected mRNA from trigeminal ganglia and dorsal root ganglia were fragmented using Fragmentation Reagents (Applied Biosystems).

    Transgenic Assay:

    Article Title: Conserved Gene Microsynteny Unveils Functional Interaction Between Protein Disulfide Isomerase and Rho Guanine-Dissociation Inhibitor Families
    Article Snippet: Total RNA of each sample was reverse transcribed into cDNA using SuperScriptIII and random primers (Invitrogen). .. Primer sequences were as follows: PDIA1_Fw:AAGCTGCCGCAAAACTGAAG; PDIA1_Rv:TCACTTCGCTTGAGTCCACC; RhoGDIα_Fw:GACAAGGACGATGAAAGCCTCC; RhoGDIα_Rv:CCTGTCAGGTCCAGTTCCAGAG; 18s_Fw:AGGAATTGACGGAAGGGCACCA; 18s_Rv: GTGCAGCCCCGGACATCTAAG. b) Transgenic PDI mouse: Some experiments were performed with a newly-developed model of global transgenic constitutive overexpression of PDIA1 in mice (Fernandes DC et al ., paper under review).

    Construct:

    Article Title: Genome-wide characterization of methylguanosine-capped and polyadenylated small RNAs in the rice blast fungus Magnaporthe oryzae
    Article Snippet: To construct the CPA-sRNA library, protocols used to generate full-length cDNA were followed, from which small molecules were size selected and sequenced ( ). .. The 3′-oligo (dT)20 VN linker (5′-GCGGCTGAAGACGGCCTATGTGGCC(T)20 VN-3′) was used to synthesize cDNA using SuperScriptIII (Invitrogen) according to supplier’s procedure.

    cDNA Library Assay:

    Article Title: Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria
    Article Snippet: .. Cloning, RNAi screening, and feeding assay Primers with overhangs homologous to pPR-T4P vector (J Rink) were used for PCR amplification from a cDNA library generated with SuperScriptIII (Life Technologies). .. PCR products were treated with T4 polymerase, mixed with linearized vector (digested with SmaI and treated with T4 polymerase) and incubated for 15 min at room temperature.

    Mouse Assay:

    Article Title: Conserved Gene Microsynteny Unveils Functional Interaction Between Protein Disulfide Isomerase and Rho Guanine-Dissociation Inhibitor Families
    Article Snippet: Total RNA of each sample was reverse transcribed into cDNA using SuperScriptIII and random primers (Invitrogen). .. Primer sequences were as follows: PDIA1_Fw:AAGCTGCCGCAAAACTGAAG; PDIA1_Rv:TCACTTCGCTTGAGTCCACC; RhoGDIα_Fw:GACAAGGACGATGAAAGCCTCC; RhoGDIα_Rv:CCTGTCAGGTCCAGTTCCAGAG; 18s_Fw:AGGAATTGACGGAAGGGCACCA; 18s_Rv: GTGCAGCCCCGGACATCTAAG. b) Transgenic PDI mouse: Some experiments were performed with a newly-developed model of global transgenic constitutive overexpression of PDIA1 in mice (Fernandes DC et al ., paper under review).

    Plasmid Preparation:

    Article Title: Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria
    Article Snippet: .. Cloning, RNAi screening, and feeding assay Primers with overhangs homologous to pPR-T4P vector (J Rink) were used for PCR amplification from a cDNA library generated with SuperScriptIII (Life Technologies). .. PCR products were treated with T4 polymerase, mixed with linearized vector (digested with SmaI and treated with T4 polymerase) and incubated for 15 min at room temperature.

    Real-time Polymerase Chain Reaction:

    Article Title: Conserved Gene Microsynteny Unveils Functional Interaction Between Protein Disulfide Isomerase and Rho Guanine-Dissociation Inhibitor Families
    Article Snippet: Total RNA of each sample was reverse transcribed into cDNA using SuperScriptIII and random primers (Invitrogen). .. Briefly, qPCR was performed on selected genes using Brilliant II SYBR Green QPCR Master Mix(Stratagene) with custom-designed primers on a Real-Time PCR System (ABI StepOne Plus).

    Article Title: Fematrin-1 Is Involved in Fetomaternal Cell-to-Cell Fusion in Bovinae Placenta and Has Contributed to Diversity of Ruminant Placentation
    Article Snippet: Total RNA was isolated from frozen tissues and cultured cells by using TRIzol reagent (Invitrogen). cDNA was synthesized from 1 μg of total RNA by using SuperScriptIII (Invitrogen) and stored at −80°C prior to experiments. .. Quantitative real-time RT-PCR was conducted by using TaqMan universal PCR master mix (Applied Biosystems, Foster City, CA) and an ABI Prism 7000 real-time PCR system (Applied Biosystems) according to the manufacturer's instructions.

    Article Title: Compromised genomic integrity impedes muscle growth after Atrx inactivation
    Article Snippet: .. RNA was harvested 48 hours after infection (Qiagen), and 1 μg RNA was reverse transcribed (SuperScriptIII; Invitrogen). cDNA was used for expression analysis of cell cycle genes by qPCR SuperArray (PAMM-020, SABiosciences). .. QPCR was performed on a Stratagene Mx3000P system.

    Article Title: Jun-regulated genes promote interaction of diffuse large B-cell lymphoma with the microenvironment
    Article Snippet: Paragraph title: Quantitative polymerase chain reaction ... Total RNA was isolated by using an RNeasy kit (QIAGEN) and reverse transcribed by using SuperScriptIII (Invitrogen).

    Article Title: A protein complex required for polymerase V transcripts and RNA-directed DNA methylation in plants
    Article Snippet: 14μl of a mix containing 2.5μl Platinum Taq buffer (minus MgCl2 ), 2μl 50 mM MgCl2 , 1μl 0.1 M DTT, 0.3μl RNaseOUT, 0.3μl Platinum Taq (Invitrogen), 0.3μl SuperScriptIII (Invitrogen) and 0.25μl 10 μM Taqman probe was added to each sample and incubation continued for 30 minutes at 55°C, followed by 15 minutes at 70°C. .. After the addition of Primer 2, the qPCR was started (2 minutes 95°C; 40 cycles of 15 seconds at 95°C, 1 minute at 60°C).

    Article Title: Regulated motion of glycoproteins revealed by direct visualization of a single cargo in the endoplasmic reticulum
    Article Snippet: RNA was extracted using RNAiso (Takara Bio) from cells transfected with Stealth siRNA (Invitrogen) at 24 h after transfection. cDNA was synthesized from the total RNA using SuperscriptIII (Invitrogen) with an oligo(dT) primer. .. For real-time PCR, the prepared cDNA wasanalyzed in triplicate with the SYBR PremixEX Taq (Takara Bio) in a LightCycler (Roche).

    Article Title: The Star-Nosed Mole Reveals Clues to the Molecular Basis of Mammalian Touch
    Article Snippet: .. Total RNA was either DNAsed, re-purified (RNAeasy, Quiagen) and reverse transcribed (SuperScriptIII, Invitrogen) for qPCR or RT-PCR, or further purified with two rounds of poly-A selection (Dynabeads mRNA purification Kit, Invitrogen) for sequencing. .. Illumina Sequencing Poly-A selected mRNA from trigeminal ganglia and dorsal root ganglia were fragmented using Fragmentation Reagents (Applied Biosystems).

    Article Title: Discovery of a Novel Compound with Anti-Venezuelan Equine Encephalitis Virus Activity That Targets the Nonstructural Protein 2
    Article Snippet: Ten microliter of RNA samples were subjected to a cDNA synthesis with SuperScriptIII (Life Technologies) and random hexamers by following the manufacturer's protocol. .. To quantitate the relative viral RNA, we used a method of real-time PCR with 2(−Delta C(T)) method in conjunction with TaqMan chemistry.

    Multiplex Assay:

    Article Title: Discovery of a Novel Compound with Anti-Venezuelan Equine Encephalitis Virus Activity That Targets the Nonstructural Protein 2
    Article Snippet: Ten microliter of RNA samples were subjected to a cDNA synthesis with SuperScriptIII (Life Technologies) and random hexamers by following the manufacturer's protocol. .. The real-time PCR was done in a total of twenty microliters per well with 2 µL of 10-fold diluted cDNA mixture in a multiplex mode using ABI 9700HT genetic analyzer.

    Selection:

    Article Title: The tumour antigen PRAME is a subunit of a Cul2 ubiquitin ligase and associates with active NFY promoters
    Article Snippet: In all, 100 μg of total RNA were subjected to two rounds of poly(A) selection using the Oligotex mRNA Mini Kit (Qiagen) and the concentration of poly(A)+ RNA was measured with a Qubit fluorometer (Invitrogen). .. Double-stranded cDNA was synthesized from the fragmented RNA with SuperscriptIII (Invitrogen) using random hexamers, and then used for Illumina sample prepping and sequencing (see below).

    Article Title: The Star-Nosed Mole Reveals Clues to the Molecular Basis of Mammalian Touch
    Article Snippet: .. Total RNA was either DNAsed, re-purified (RNAeasy, Quiagen) and reverse transcribed (SuperScriptIII, Invitrogen) for qPCR or RT-PCR, or further purified with two rounds of poly-A selection (Dynabeads mRNA purification Kit, Invitrogen) for sequencing. .. Illumina Sequencing Poly-A selected mRNA from trigeminal ganglia and dorsal root ganglia were fragmented using Fragmentation Reagents (Applied Biosystems).

    Homogenization:

    Article Title: Conserved Gene Microsynteny Unveils Functional Interaction Between Protein Disulfide Isomerase and Rho Guanine-Dissociation Inhibitor Families
    Article Snippet: The RNA from the remaining left over tissue was also extracted after homogenization in QIAzol. .. Total RNA of each sample was reverse transcribed into cDNA using SuperScriptIII and random primers (Invitrogen).

    Feeding Assay:

    Article Title: Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria
    Article Snippet: .. Cloning, RNAi screening, and feeding assay Primers with overhangs homologous to pPR-T4P vector (J Rink) were used for PCR amplification from a cDNA library generated with SuperScriptIII (Life Technologies). .. PCR products were treated with T4 polymerase, mixed with linearized vector (digested with SmaI and treated with T4 polymerase) and incubated for 15 min at room temperature.

    Incubation:

    Article Title: The tumour antigen PRAME is a subunit of a Cul2 ubiquitin ligase and associates with active NFY promoters
    Article Snippet: In all, 200 ng of purified poly(A)+ RNA were diluted in 160 μl RNAse-free water and fragmented by addition of 40 μl 5 × fragmentation buffer (200 mM Tris acetate pH 8.2, 500 mM potassium acetate and 150 mM magnesium acetate) and incubation at 94°C for 120 s. After purification with RNeasy Minelute Kit (Qiagen), the quality of fragmented RNA was analysed on an Experion (Bio-Rad). .. Double-stranded cDNA was synthesized from the fragmented RNA with SuperscriptIII (Invitrogen) using random hexamers, and then used for Illumina sample prepping and sequencing (see below).

    Article Title: A protein complex required for polymerase V transcripts and RNA-directed DNA methylation in plants
    Article Snippet: .. 14μl of a mix containing 2.5μl Platinum Taq buffer (minus MgCl2 ), 2μl 50 mM MgCl2 , 1μl 0.1 M DTT, 0.3μl RNaseOUT, 0.3μl Platinum Taq (Invitrogen), 0.3μl SuperScriptIII (Invitrogen) and 0.25μl 10 μM Taqman probe was added to each sample and incubation continued for 30 minutes at 55°C, followed by 15 minutes at 70°C. .. After the addition of Primer 2, the qPCR was started (2 minutes 95°C; 40 cycles of 15 seconds at 95°C, 1 minute at 60°C).

    Article Title: Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria
    Article Snippet: Cloning, RNAi screening, and feeding assay Primers with overhangs homologous to pPR-T4P vector (J Rink) were used for PCR amplification from a cDNA library generated with SuperScriptIII (Life Technologies). .. PCR products were treated with T4 polymerase, mixed with linearized vector (digested with SmaI and treated with T4 polymerase) and incubated for 15 min at room temperature.

    Concentration Assay:

    Article Title: The tumour antigen PRAME is a subunit of a Cul2 ubiquitin ligase and associates with active NFY promoters
    Article Snippet: In all, 100 μg of total RNA were subjected to two rounds of poly(A) selection using the Oligotex mRNA Mini Kit (Qiagen) and the concentration of poly(A)+ RNA was measured with a Qubit fluorometer (Invitrogen). .. Double-stranded cDNA was synthesized from the fragmented RNA with SuperscriptIII (Invitrogen) using random hexamers, and then used for Illumina sample prepping and sequencing (see below).

    Article Title: Regulated motion of glycoproteins revealed by direct visualization of a single cargo in the endoplasmic reticulum
    Article Snippet: Knockdown in COS7 cells was performed in one well of an eight-well Labtech chamber (Thermo Fisher Scientific) at an siRNA concentration of 12.5 nM. .. RNA was extracted using RNAiso (Takara Bio) from cells transfected with Stealth siRNA (Invitrogen) at 24 h after transfection. cDNA was synthesized from the total RNA using SuperscriptIII (Invitrogen) with an oligo(dT) primer.

    Rapid Amplification of cDNA Ends:

    Article Title: The peach (Prunus persica L. Batsch) genome harbours 10 KNOX genes, which are differentially expressed in stem development, and the class 1 KNOPE1 regulates elongation and lignification during primary growth
    Article Snippet: Isolation and sequence analysis of KNOPE genes in ‘Chiripa’ The KNOPE2 , KNOPE6 , STMlike1 , STMlike2, and KNOPE4 genes ( ; Supplementary Table S1 at JXB online) were cloned through degenerate primer strategies to amplify sequences in the MEINOX and HD of class 1 and 2 genes, followed by 5′ and 3′ rapid amplification of cDNA ends (RACEs) to produce full-length genes, and further checked by whole gene sequencing. .. The herbaceous stem RNA was isolated (Giannino et al. , 2000), DNase treated (RQ1, Promega), and 1 µg was reverse-transcribed at 55 °C by SuperscriptIII (Life Technologies).

    Lysis:

    Article Title: Conserved Gene Microsynteny Unveils Functional Interaction Between Protein Disulfide Isomerase and Rho Guanine-Dissociation Inhibitor Families
    Article Snippet: Briefly, LCA and RCA were quickly flushed with 150 μl of QIAzol lysis reagent (QIAGEN) using 29 G insulin syringe into a microfuge tube. .. Total RNA of each sample was reverse transcribed into cDNA using SuperScriptIII and random primers (Invitrogen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Thermo Fisher superscriptiii qrt pcr kit
    Superscriptiii Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscriptiii qrt pcr kit/product/Thermo Fisher
    Average 94 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    superscriptiii qrt pcr kit - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    93
    Thermo Fisher superscriptiii platinum taq
    Superscriptiii Platinum Taq, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscriptiii platinum taq/product/Thermo Fisher
    Average 93 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    superscriptiii platinum taq - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    97
    Thermo Fisher superscriptii
    Superscriptii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscriptii/product/Thermo Fisher
    Average 97 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    superscriptii - by Bioz Stars, 2020-04
    97/100 stars
      Buy from Supplier

    94
    Thermo Fisher superscriptiii
    Superscriptiii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscriptiii/product/Thermo Fisher
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    superscriptiii - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results