superscriptiii reverse transcriptase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher superscriptiii reverse transcriptase
    Superscriptiii Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 126 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscriptiii reverse transcriptase/product/Thermo Fisher
    Average 99 stars, based on 126 article reviews
    Price from $9.99 to $1999.99
    superscriptiii reverse transcriptase - by Bioz Stars, 2020-01
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Smarcal1-Mediated Fork Reversal Triggers Mre11-Dependent Degradation of Nascent DNA in the Absence of Brca2 and Stable Rad51 Nucleofilaments
    Article Snippet: Paragraph title: Cloning ... SuperscriptIII reverse transcriptase (Thermo Fisher) and an oligo(dT)20 was used for the first strand DNA synthesis.

    Article Title: Vaccine-elicited receptor-binding site antibodies neutralize two New World hemorrhagic fever arenaviruses
    Article Snippet: Paragraph title: Single B-cell sorting and antibody cloning ... To obtain the IgH and Igκ genes from sorted memory B cells, we performed single-cell cDNA synthesis using SuperScriptIII reverse transcriptase (Invitrogen) followed by nested PCR amplification of the IgH and Igκ variable regions as previously described.

    Article Title: Cancer associated SF3B1 mutants recognize otherwise inaccessible cryptic 3’ splice sites within RNA secondary structures
    Article Snippet: cDNA was prepared from total RNA depleted of genomic DNA (on-column DNAse treatment) and SuperscriptIII reverse transcriptase (Life Technologies) using random hexamers. .. To determine splice isoforms, cDNA was amplified with suitable primers and resolved on 3% Metaphor agarose.

    Centrifugation:

    Article Title: SF3b1 mutations associated with myelodysplastic syndromes alter the fidelity of branchsite selection in yeast
    Article Snippet: Cells (10 OD600 units) were harvested by centrifugation, and total cellular RNA was isolated using a MasterPure Yeast RNA Purification Kit (Epicentre BioTechnologies; Madison, WI) according to the vendor's instructions. .. Primer extensions reactions were performed using SuperScriptIII reverse transcriptase (ThermoFisher Scientific; Waltham, MA) and the primers YAC6 (5΄-GGCACTCATGACCTTC-3΄) and yU6 (5΄-GAACTGCTGATCATCTCTG-3΄) ( ).

    Article Title: Vaccine-elicited receptor-binding site antibodies neutralize two New World hemorrhagic fever arenaviruses
    Article Snippet: We isolated donor PBMCs using Ficoll-Paque centrifugation and stained and sorted cells as previously described using a BD fluorescence-activated cell sorter Aria II, with the exception that we omitted the B-cell enrichment step and used JUNV GP1 Streptavidin-PE (Caltag) and JUNV GP1mut Streptavidin-PerCP (BD Biosciences) as antigens in the experiment. .. To obtain the IgH and Igκ genes from sorted memory B cells, we performed single-cell cDNA synthesis using SuperScriptIII reverse transcriptase (Invitrogen) followed by nested PCR amplification of the IgH and Igκ variable regions as previously described.

    Amplification:

    Article Title: TTC21B contributes both causal and modifying alleles across the ciliopathy spectrum
    Article Snippet: Endogenous ttc21b expression was determined by extracting total RNA from 0.5dpf embryos with Trizol (Invitrogen) according to manufacturer's instructions. .. Oligo-dT-primed total RNA was reverse transcribed using SuperScriptIII reverse transcriptase (Invitrogen) and the resulting cDNA was PCR amplified. .. Anti-TTC21B antibodies were generated against two synthetic peptides in rabbits.

    Article Title: A common allele in RPGRIP1L is a modifier of retinal degeneration in ciliopathies
    Article Snippet: MO efficiency was determined by extracting total RNA from embryos with Trizol (Invitrogen) according to manufacturer's instructions. .. Oligo-dT-primed total RNA was reverse transcribed using SuperScriptIII reverse transcriptase (Invitrogen) and cDNA was subsequently PCR amplified and sequenced using standard procedures. .. We carried out the yeast two-hybrid (Y2H) analysis using the Matchmaker Gal4-two hybrid system (Clontech), according to manufacturer's instructions.

    Article Title: Early Double-Negative Thymocyte Export in Trypanosoma cruzi Infection Is Restricted by Sphingosine Receptors and Associated with Human Chagas Disease
    Article Snippet: First strand cDNA synthesis was prepared with 0.5 µg total RNA, random hexamer primer, and SuperscriptIII reverse transcriptase (Invitrogen, California, USA). .. First strand cDNA synthesis was prepared with 0.5 µg total RNA, random hexamer primer, and SuperscriptIII reverse transcriptase (Invitrogen, California, USA).

    Article Title: Smarcal1-Mediated Fork Reversal Triggers Mre11-Dependent Degradation of Nascent DNA in the Absence of Brca2 and Stable Rad51 Nucleofilaments
    Article Snippet: SuperscriptIII reverse transcriptase (Thermo Fisher) and an oligo(dT)20 was used for the first strand DNA synthesis. .. Xenopus Brca2 cDNA was sequenced and the sequence was deposited in GenBank: KY024483 .

    Article Title: Vaccine-elicited receptor-binding site antibodies neutralize two New World hemorrhagic fever arenaviruses
    Article Snippet: We added antibodies CD19-Pacific-Blue (AbD Serotec/BioRad catalog number MCA1940GA) at a concentration of 40 μg ml−1 , CD27-fluorescein (BD Biosciences catalog number 340424) at a concentration of 30 ng ml−1 , 20 μl of IgM-allophycocyanin (BD Biosciences catalog number 551062) per 1 × 106 cells, CD3-PerCP (BD Biosciences catalog number 340663) at a concentration of 480 ng ml−1 , CD14-PerCP (BD Biosciences catalog number 345786) at a concentration of 0.8 μg ml−1 , 7AAD (BD Biosciences catalog number 559925) at a concentration of 0.8 μg ml−1 , and CD16 PerCP (Biolegend catalog number 302029) at a concentration of 8 μg ml−1 and kept the cells on ice for an additional 30 min. We then washed cells three times in PBS containing 2% (v/v) FBS and passed the cell suspension through a cell strainer prior to sorting. .. To obtain the IgH and Igκ genes from sorted memory B cells, we performed single-cell cDNA synthesis using SuperScriptIII reverse transcriptase (Invitrogen) followed by nested PCR amplification of the IgH and Igκ variable regions as previously described. .. Our low recovery rates for paired re-arranged heavy and light chain segments from single memory B cells (4/25 in experiment 1; 1/10 in experiment 2) could possibly be explained by technical limitations, the possibility that some cells encoded IgA instead of IgG (we only selected for IgM− cells), or false positive events in the flow cytometry.

    Article Title: Cancer associated SF3B1 mutants recognize otherwise inaccessible cryptic 3’ splice sites within RNA secondary structures
    Article Snippet: cDNA was prepared from total RNA depleted of genomic DNA (on-column DNAse treatment) and SuperscriptIII reverse transcriptase (Life Technologies) using random hexamers. .. Real-Time quantitative PCR was performed using paired oligos and Sybr Fast (KAPA Biosystems) 2× mastermix on a Bio-rad CFX96 real time PCR cycler.

    Article Title: A flow cytometry-based screen identifies MBNL1 modulators that rescue splicing defects in myotonic dystrophy type I
    Article Snippet: The first strand cDNAs were synthesized from 1 g total RNA using Oligo(dT)20 primer or random hexamer and SuperScriptIII reverse transcriptase (Invitrogen, 18080-093) following the manufacture’s protocol. .. For alte rnative splicing quantification, 1/20 of cDNA was used as a template for the PCR amplification with Herculase II Fusion DNA Polymerases (Agilent Genomics, 600675) and the following primers: SERCA1 _exon22 forward –5’- GCTCATGGTCCTCAAGATCTCAC and reverse – 5’ AGCTCTGCCTGAAGATGTGTCAC; INSR _exon11 forward -5’ CCAAAGACAGACTCTCAGAT and reverse 5’ AACATCGCCAAGGGACCTGC.

    DNA Synthesis:

    Article Title: Smarcal1-Mediated Fork Reversal Triggers Mre11-Dependent Degradation of Nascent DNA in the Absence of Brca2 and Stable Rad51 Nucleofilaments
    Article Snippet: The cDNA sequences encoding Xenopus laevis Brca2 was obtained by RT-PCR, from RNA derived from Xenopus eggs with Trizol reagent (ThermoFisher). .. SuperscriptIII reverse transcriptase (Thermo Fisher) and an oligo(dT)20 was used for the first strand DNA synthesis. .. The full-length Brca2 sequence was amplified by PCR using a Phusion High-Fidelity DNA Polymerase (New England Biolabs) and Brca2-N1 and Brca2-C2 reverse primers ( ) derived from full-length oocyte cDNA next generation sequence (unpublished data).

    Polyacrylamide Gel Electrophoresis:

    Article Title: SF3b1 mutations associated with myelodysplastic syndromes alter the fidelity of branchsite selection in yeast
    Article Snippet: Primer extensions reactions were performed using SuperScriptIII reverse transcriptase (ThermoFisher Scientific; Waltham, MA) and the primers YAC6 (5΄-GGCACTCATGACCTTC-3΄) and yU6 (5΄-GAACTGCTGATCATCTCTG-3΄) ( ). .. Primer extensions reactions were performed using SuperScriptIII reverse transcriptase (ThermoFisher Scientific; Waltham, MA) and the primers YAC6 (5΄-GGCACTCATGACCTTC-3΄) and yU6 (5΄-GAACTGCTGATCATCTCTG-3΄) ( ).

    Article Title: Phase I clinical trial of idiotypic DNA vaccine administered as a complex with polyethylenimine to patients with B-cell lymphoma
    Article Snippet: One μg of total RNA is used for cDNA synthesis with SuperScriptIII reverse transcriptase (Invitrogen) and Oligo-dT. .. In brief, semi-nested PCR using high-fidelity DNA-polymerase with a set of forward primers and a distal reverse primer is used.

    Synthesized:

    Article Title: Lysine acetylome profiling uncovers novel histone deacetylase substrate proteins in Arabidopsis
    Article Snippet: The quality and quantity of the RNA were confirmed on agarose gels and a UV‐spectrometer. .. Complementary DNA (cDNA) was synthesized from DNase‐treated RNA with SuperScriptIII reverse transcriptase (Invitrogen™) following the manufacturer's instruction and using dT20. .. Real‐time qPCR was carried out in triplicate in an iQ™5 Multicolor Real‐Time PCR Detection System (Bio‐Rad) using iQ™SYBR Green Super Mix (Bio‐Rad) and gene‐specific primers: HDA14‐F 5′‐ATCTGTGGCAGACTCGTTTCG‐3′, HDA14‐R 5′‐TCGCACCTTTCTCATTGGTTC‐3′.

    Article Title: The pharmacological and functional characterization of the serotonergic system in Anopheles gambiae and Aedes aegypti: influences on flight and blood-feeding behavior
    Article Snippet: Total RNA was extracted from the immature larval and pupal stages, adult female and male whole bodies, and adult female head only with TRIzol Reagent (Invitrogen, Waltham, MA). .. Post DNase-treatment of RNA, cDNA was synthesized with SuperScriptIII reverse transcriptase (Invitrogen). .. Quantitative real-time PCR (qRT-PCR) was conducted with an ABI 7900 RT-PCR system, SYBRGreen (Applied Biosystems, Foster City, CA), 100 ng of cDNA, and final primer concentrations of 0.15 M. Housekeeping gene, 40 S ribosomal protein S7 (AAEL0009496, AGAP010592), was utilized as internal controls.

    Article Title: A soma-to-germline transformation in long-lived C. elegans mutants
    Article Snippet: RNA was isolated by Trizol (Invitrogen) and potential DNA contamination removed by TurboDNA-Free (Ambion). .. The purity/stability of the RNA was tested by gel electrophoresis and UV spectroscopy. cDNA was synthesized from 2ug of RNA with SuperscriptIII reverse transcriptase (Invitrogen) and quantitative PCR performed with SYBR Green (BioRad) on a BioRad iCycler. .. Samples were normalized to rpl-32 and/or snb-1 transcript levels.

    Article Title: A flow cytometry-based screen identifies MBNL1 modulators that rescue splicing defects in myotonic dystrophy type I
    Article Snippet: Total RNA was prepared from cells with RNeasy Plus Mini Kit (Qiagen, 74136) as per manufacturer’s instructions. .. The first strand cDNAs were synthesized from 1 g total RNA using Oligo(dT)20 primer or random hexamer and SuperScriptIII reverse transcriptase (Invitrogen, 18080-093) following the manufacture’s protocol. .. For alte rnative splicing quantification, 1/20 of cDNA was used as a template for the PCR amplification with Herculase II Fusion DNA Polymerases (Agilent Genomics, 600675) and the following primers: SERCA1 _exon22 forward –5’- GCTCATGGTCCTCAAGATCTCAC and reverse – 5’ AGCTCTGCCTGAAGATGTGTCAC; INSR _exon11 forward -5’ CCAAAGACAGACTCTCAGAT and reverse 5’ AACATCGCCAAGGGACCTGC.

    Article Title: YAP determines the cell fate of injured mouse hepatocytes in vivo
    Article Snippet: Total RNA was isolated from livers using TRIzol Reagent according to the manufacturer’s protocol (Invitrogen). .. First-strand cDNA was synthesized from 1 μg total RNA using SuperscriptIII reverse transcriptase (Invitrogen) and an oligo-dT primer semiquantitative PCR was performed as below . .. For a 20 μl PCR reaction, cDNA template was mixed with TaKaRa Ex Taq (TaKaTa) plus the appropriate primers to a final concentration of 200 nM each.

    Quantitative RT-PCR:

    Article Title: Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses
    Article Snippet: Paragraph title: Quantitative RT-PCR ... 1 μg of total RNA was reverse-transcribed by oligodT-priming using SuperScriptIII reverse transcriptase (Invitrogen).

    Article Title: A soma-to-germline transformation in long-lived C. elegans mutants
    Article Snippet: Paragraph title: Quantitative RT-PCR ... The purity/stability of the RNA was tested by gel electrophoresis and UV spectroscopy. cDNA was synthesized from 2ug of RNA with SuperscriptIII reverse transcriptase (Invitrogen) and quantitative PCR performed with SYBR Green (BioRad) on a BioRad iCycler.

    Article Title: Essential role for a novel population of binucleated mammary epithelial cells in lactation
    Article Snippet: Paragraph title: RNA preparation and quantitative RT–PCR analysis ... Reverse transcription was carried out using oligo(dT) primer and SuperscriptIII reverse transcriptase (Invitrogen, MA, USA).

    Real-time Polymerase Chain Reaction:

    Article Title: Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses
    Article Snippet: 1 μg of total RNA was reverse-transcribed by oligodT-priming using SuperScriptIII reverse transcriptase (Invitrogen). .. Quantitative real-time PCR was performed on 10 ng of the resulting cDNA using SYBR Green detection (Applied Biosystems).

    Article Title: C/EBPβ regulates delta-secretase expression and mediates pathogenesis in mouse models of Alzheimer’s disease
    Article Snippet: Paragraph title: Real-time PCR ... Reverse transcription was performed with SuperScriptIII reverse transcriptase (Life Technologies).

    Article Title: A soma-to-germline transformation in long-lived C. elegans mutants
    Article Snippet: RNA was isolated by Trizol (Invitrogen) and potential DNA contamination removed by TurboDNA-Free (Ambion). .. The purity/stability of the RNA was tested by gel electrophoresis and UV spectroscopy. cDNA was synthesized from 2ug of RNA with SuperscriptIII reverse transcriptase (Invitrogen) and quantitative PCR performed with SYBR Green (BioRad) on a BioRad iCycler. .. Samples were normalized to rpl-32 and/or snb-1 transcript levels.

    Article Title: A flow cytometry-based screen identifies MBNL1 modulators that rescue splicing defects in myotonic dystrophy type I
    Article Snippet: The first strand cDNAs were synthesized from 1 g total RNA using Oligo(dT)20 primer or random hexamer and SuperScriptIII reverse transcriptase (Invitrogen, 18080-093) following the manufacture’s protocol. .. The PCR products were analyzed by electrophoresis with 2.2% agarose gels and the density of bands was quantified using ImageJ.

    Article Title: Comparison of breast cancer metastasis models reveals a possible mechanism of tumor aggressiveness
    Article Snippet: RNA analysis Total RNA extraction and reverse transcription were performed as previously described . mRNA was reverse transcribed with random primers and SuperScriptIII reverse transcriptase (Thermo Fisher). .. RNA analysis Total RNA extraction and reverse transcription were performed as previously described . mRNA was reverse transcribed with random primers and SuperScriptIII reverse transcriptase (Thermo Fisher).

    Random Hexamer Labeling:

    Article Title: Early Double-Negative Thymocyte Export in Trypanosoma cruzi Infection Is Restricted by Sphingosine Receptors and Associated with Human Chagas Disease
    Article Snippet: For total thymus analysis, RNA was isolated using guanidine thiocyanate kit (Invitrogen, California, USA) per the manufacturer's instructions. .. First strand cDNA synthesis was prepared with 0.5 µg total RNA, random hexamer primer, and SuperscriptIII reverse transcriptase (Invitrogen, California, USA). .. For qPCR we used approximately 60 ng of cDNA for each sample and SYBR Green Master Mix 2 (Applied Biosystems, California, USA). cDNA was amplified using specific murine primer sequences described in .

    Article Title: A flow cytometry-based screen identifies MBNL1 modulators that rescue splicing defects in myotonic dystrophy type I
    Article Snippet: Total RNA was prepared from cells with RNeasy Plus Mini Kit (Qiagen, 74136) as per manufacturer’s instructions. .. The first strand cDNAs were synthesized from 1 g total RNA using Oligo(dT)20 primer or random hexamer and SuperScriptIII reverse transcriptase (Invitrogen, 18080-093) following the manufacture’s protocol. .. For alte rnative splicing quantification, 1/20 of cDNA was used as a template for the PCR amplification with Herculase II Fusion DNA Polymerases (Agilent Genomics, 600675) and the following primers: SERCA1 _exon22 forward –5’- GCTCATGGTCCTCAAGATCTCAC and reverse – 5’ AGCTCTGCCTGAAGATGTGTCAC; INSR _exon11 forward -5’ CCAAAGACAGACTCTCAGAT and reverse 5’ AACATCGCCAAGGGACCTGC.

    Expressing:

    Article Title: TTC21B contributes both causal and modifying alleles across the ciliopathy spectrum
    Article Snippet: Endogenous ttc21b expression was determined by extracting total RNA from 0.5dpf embryos with Trizol (Invitrogen) according to manufacturer's instructions. .. Oligo-dT-primed total RNA was reverse transcribed using SuperScriptIII reverse transcriptase (Invitrogen) and the resulting cDNA was PCR amplified.

    Article Title: Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses
    Article Snippet: For measurements of gene expression in brain tissues, total RNA was isolated using Trizol reagent (Invitrogen) and treated with TURBO DNase (Ambion). .. 1 μg of total RNA was reverse-transcribed by oligodT-priming using SuperScriptIII reverse transcriptase (Invitrogen).

    Article Title: Early Double-Negative Thymocyte Export in Trypanosoma cruzi Infection Is Restricted by Sphingosine Receptors and Associated with Human Chagas Disease
    Article Snippet: First strand cDNA synthesis was prepared with 0.5 µg total RNA, random hexamer primer, and SuperscriptIII reverse transcriptase (Invitrogen, California, USA). .. All reactions were run on an ABI Prism 7700 sequence detection system (Applied Biosystems, Foster City, CA).

    Article Title: Lysine acetylome profiling uncovers novel histone deacetylase substrate proteins in Arabidopsis
    Article Snippet: Complementary DNA (cDNA) was synthesized from DNase‐treated RNA with SuperScriptIII reverse transcriptase (Invitrogen™) following the manufacturer's instruction and using dT20. .. Complementary DNA (cDNA) was synthesized from DNase‐treated RNA with SuperScriptIII reverse transcriptase (Invitrogen™) following the manufacturer's instruction and using dT20.

    Article Title: Phase I clinical trial of idiotypic DNA vaccine administered as a complex with polyethylenimine to patients with B-cell lymphoma
    Article Snippet: Samples containing more than 80% of malignant lymphoma cells with a clear monoclonal population of CD19+ cells expressing one type of heavy and light chain are used for vaccine production. .. One μg of total RNA is used for cDNA synthesis with SuperScriptIII reverse transcriptase (Invitrogen) and Oligo-dT.

    Article Title: Smarcal1-Mediated Fork Reversal Triggers Mre11-Dependent Degradation of Nascent DNA in the Absence of Brca2 and Stable Rad51 Nucleofilaments
    Article Snippet: SuperscriptIII reverse transcriptase (Thermo Fisher) and an oligo(dT)20 was used for the first strand DNA synthesis. .. Xenopus Brca2 cDNA was sequenced and the sequence was deposited in GenBank: KY024483 .

    Article Title: The pharmacological and functional characterization of the serotonergic system in Anopheles gambiae and Aedes aegypti: influences on flight and blood-feeding behavior
    Article Snippet: Paragraph title: Expression profiling ... Post DNase-treatment of RNA, cDNA was synthesized with SuperScriptIII reverse transcriptase (Invitrogen).

    Article Title: C/EBPβ regulates delta-secretase expression and mediates pathogenesis in mouse models of Alzheimer’s disease
    Article Snippet: Reverse transcription was performed with SuperScriptIII reverse transcriptase (Life Technologies). .. All real-time PCR reactions were performed using the ABI 7500-Fast Real-Time PCR System and Taqman Universal Master Mix Kit (Life Technologies).

    Article Title: Vaccine-elicited receptor-binding site antibodies neutralize two New World hemorrhagic fever arenaviruses
    Article Snippet: To obtain the IgH and Igκ genes from sorted memory B cells, we performed single-cell cDNA synthesis using SuperScriptIII reverse transcriptase (Invitrogen) followed by nested PCR amplification of the IgH and Igκ variable regions as previously described. .. After sequencing PCR products, we used IgBLAST ( http://www.ncbi.nlm.nih.gov/igblast ) and IMGT® ( http://www.imgt.org ) to analyze IgG gene usage and the extent of VH /Vκ somatic hypermutation.

    Article Title: A flow cytometry-based screen identifies MBNL1 modulators that rescue splicing defects in myotonic dystrophy type I
    Article Snippet: The first strand cDNAs were synthesized from 1 g total RNA using Oligo(dT)20 primer or random hexamer and SuperScriptIII reverse transcriptase (Invitrogen, 18080-093) following the manufacture’s protocol. .. The PCR products were analyzed by electrophoresis with 2.2% agarose gels and the density of bands was quantified using ImageJ.

    Article Title: Comparison of breast cancer metastasis models reveals a possible mechanism of tumor aggressiveness
    Article Snippet: RNA analysis Total RNA extraction and reverse transcription were performed as previously described . mRNA was reverse transcribed with random primers and SuperScriptIII reverse transcriptase (Thermo Fisher). .. RNA analysis Total RNA extraction and reverse transcription were performed as previously described . mRNA was reverse transcribed with random primers and SuperScriptIII reverse transcriptase (Thermo Fisher).

    Splicing Assay:

    Article Title: Cancer associated SF3B1 mutants recognize otherwise inaccessible cryptic 3’ splice sites within RNA secondary structures
    Article Snippet: Paragraph title: 3. Reverse Transcription, PCR and mini-gene splicing assay ... cDNA was prepared from total RNA depleted of genomic DNA (on-column DNAse treatment) and SuperscriptIII reverse transcriptase (Life Technologies) using random hexamers.

    Derivative Assay:

    Article Title: Smarcal1-Mediated Fork Reversal Triggers Mre11-Dependent Degradation of Nascent DNA in the Absence of Brca2 and Stable Rad51 Nucleofilaments
    Article Snippet: The cDNA sequences encoding Xenopus laevis Brca2 was obtained by RT-PCR, from RNA derived from Xenopus eggs with Trizol reagent (ThermoFisher). .. SuperscriptIII reverse transcriptase (Thermo Fisher) and an oligo(dT)20 was used for the first strand DNA synthesis.

    Article Title: Essential role for a novel population of binucleated mammary epithelial cells in lactation
    Article Snippet: Total RNA was prepared using the RNeasy Micro kit (Qiagen) from FACS-sorted luminal cells isolated from the mammary glands of FVB/N dams at 18.5 dP or 2 days of lactation, or from total mammary tissue derived from AURKA- deficient or control mice at 14 days of lactation. .. Reverse transcription was carried out using oligo(dT) primer and SuperscriptIII reverse transcriptase (Invitrogen, MA, USA).

    Hybridization:

    Article Title: A common allele in RPGRIP1L is a modifier of retinal degeneration in ciliopathies
    Article Snippet: We carried out in situ hybridization on whole embryos fixed with 4% paraformaldehyde with riboprobes against pax2 , krox20 , and myoD using standard protocols. .. Oligo-dT-primed total RNA was reverse transcribed using SuperScriptIII reverse transcriptase (Invitrogen) and cDNA was subsequently PCR amplified and sequenced using standard procedures.

    Infection:

    Article Title: Early Double-Negative Thymocyte Export in Trypanosoma cruzi Infection Is Restricted by Sphingosine Receptors and Associated with Human Chagas Disease
    Article Snippet: CD4− CD8− T lymphocytes were isolated from three pooled thymuses obtained from infected (14 dpi) and uninfected (control) mice by FACS cell sorting using PE-cy7-labeled anti-CD4, APC-labeled anti-CD8. .. First strand cDNA synthesis was prepared with 0.5 µg total RNA, random hexamer primer, and SuperscriptIII reverse transcriptase (Invitrogen, California, USA).

    Polymerase Chain Reaction:

    Article Title: TTC21B contributes both causal and modifying alleles across the ciliopathy spectrum
    Article Snippet: Endogenous ttc21b expression was determined by extracting total RNA from 0.5dpf embryos with Trizol (Invitrogen) according to manufacturer's instructions. .. Oligo-dT-primed total RNA was reverse transcribed using SuperScriptIII reverse transcriptase (Invitrogen) and the resulting cDNA was PCR amplified. .. Anti-TTC21B antibodies were generated against two synthetic peptides in rabbits.

    Article Title: A common allele in RPGRIP1L is a modifier of retinal degeneration in ciliopathies
    Article Snippet: MO efficiency was determined by extracting total RNA from embryos with Trizol (Invitrogen) according to manufacturer's instructions. .. Oligo-dT-primed total RNA was reverse transcribed using SuperScriptIII reverse transcriptase (Invitrogen) and cDNA was subsequently PCR amplified and sequenced using standard procedures. .. We carried out the yeast two-hybrid (Y2H) analysis using the Matchmaker Gal4-two hybrid system (Clontech), according to manufacturer's instructions.

    Article Title: Phase I clinical trial of idiotypic DNA vaccine administered as a complex with polyethylenimine to patients with B-cell lymphoma
    Article Snippet: One μg of total RNA is used for cDNA synthesis with SuperScriptIII reverse transcriptase (Invitrogen) and Oligo-dT. .. Variable region genes of heavy and light Ig chains identified by flow cytometry are amplified as described previously.

    Article Title: Smarcal1-Mediated Fork Reversal Triggers Mre11-Dependent Degradation of Nascent DNA in the Absence of Brca2 and Stable Rad51 Nucleofilaments
    Article Snippet: SuperscriptIII reverse transcriptase (Thermo Fisher) and an oligo(dT)20 was used for the first strand DNA synthesis. .. The full-length Brca2 sequence was amplified by PCR using a Phusion High-Fidelity DNA Polymerase (New England Biolabs) and Brca2-N1 and Brca2-C2 reverse primers ( ) derived from full-length oocyte cDNA next generation sequence (unpublished data).

    Article Title: Vaccine-elicited receptor-binding site antibodies neutralize two New World hemorrhagic fever arenaviruses
    Article Snippet: To obtain the IgH and Igκ genes from sorted memory B cells, we performed single-cell cDNA synthesis using SuperScriptIII reverse transcriptase (Invitrogen) followed by nested PCR amplification of the IgH and Igκ variable regions as previously described. .. Our low recovery rates for paired re-arranged heavy and light chain segments from single memory B cells (4/25 in experiment 1; 1/10 in experiment 2) could possibly be explained by technical limitations, the possibility that some cells encoded IgA instead of IgG (we only selected for IgM− cells), or false positive events in the flow cytometry.

    Article Title: Cancer associated SF3B1 mutants recognize otherwise inaccessible cryptic 3’ splice sites within RNA secondary structures
    Article Snippet: Paragraph title: 3. Reverse Transcription, PCR and mini-gene splicing assay ... cDNA was prepared from total RNA depleted of genomic DNA (on-column DNAse treatment) and SuperscriptIII reverse transcriptase (Life Technologies) using random hexamers.

    Article Title: A flow cytometry-based screen identifies MBNL1 modulators that rescue splicing defects in myotonic dystrophy type I
    Article Snippet: The first strand cDNAs were synthesized from 1 g total RNA using Oligo(dT)20 primer or random hexamer and SuperScriptIII reverse transcriptase (Invitrogen, 18080-093) following the manufacture’s protocol. .. For alte rnative splicing quantification, 1/20 of cDNA was used as a template for the PCR amplification with Herculase II Fusion DNA Polymerases (Agilent Genomics, 600675) and the following primers: SERCA1 _exon22 forward –5’- GCTCATGGTCCTCAAGATCTCAC and reverse – 5’ AGCTCTGCCTGAAGATGTGTCAC; INSR _exon11 forward -5’ CCAAAGACAGACTCTCAGAT and reverse 5’ AACATCGCCAAGGGACCTGC.

    Article Title: YAP determines the cell fate of injured mouse hepatocytes in vivo
    Article Snippet: Total RNA was isolated from livers using TRIzol Reagent according to the manufacturer’s protocol (Invitrogen). .. First-strand cDNA was synthesized from 1 μg total RNA using SuperscriptIII reverse transcriptase (Invitrogen) and an oligo-dT primer semiquantitative PCR was performed as below . .. For a 20 μl PCR reaction, cDNA template was mixed with TaKaRa Ex Taq (TaKaTa) plus the appropriate primers to a final concentration of 200 nM each.

    Article Title: Comparison of breast cancer metastasis models reveals a possible mechanism of tumor aggressiveness
    Article Snippet: RNA analysis Total RNA extraction and reverse transcription were performed as previously described . mRNA was reverse transcribed with random primers and SuperScriptIII reverse transcriptase (Thermo Fisher). .. RNA analysis Total RNA extraction and reverse transcription were performed as previously described . mRNA was reverse transcribed with random primers and SuperScriptIII reverse transcriptase (Thermo Fisher).

    Imaging:

    Article Title: A common allele in RPGRIP1L is a modifier of retinal degeneration in ciliopathies
    Article Snippet: Embryos used for assessment of tail phenotypes at 5dpf were reared in 1-phenyl-2-thiourea (PTU)-treated embryo media, and anesthetized with Tricaine for imaging at 4X magnification. .. Oligo-dT-primed total RNA was reverse transcribed using SuperScriptIII reverse transcriptase (Invitrogen) and cDNA was subsequently PCR amplified and sequenced using standard procedures.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Cytological analysis and structural quantification of FtsZ1-2 and FtsZ2-1 network characteristics in Physcomitrella patens
    Article Snippet: Paragraph title: RNA Isolation and Reverse Transcriptase–Polymerase Chain Reaction (RT-PCR) ... 2 µg of total RNA was used for the first-strand cDNA synthesis using SuperscriptIII reverse transcriptase (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol.

    Article Title: Lysine acetylome profiling uncovers novel histone deacetylase substrate proteins in Arabidopsis
    Article Snippet: Paragraph title: RNA isolation and RT–PCR ... Complementary DNA (cDNA) was synthesized from DNase‐treated RNA with SuperScriptIII reverse transcriptase (Invitrogen™) following the manufacturer's instruction and using dT20.

    Article Title: Smarcal1-Mediated Fork Reversal Triggers Mre11-Dependent Degradation of Nascent DNA in the Absence of Brca2 and Stable Rad51 Nucleofilaments
    Article Snippet: The cDNA sequences encoding Xenopus laevis Brca2 was obtained by RT-PCR, from RNA derived from Xenopus eggs with Trizol reagent (ThermoFisher). .. SuperscriptIII reverse transcriptase (Thermo Fisher) and an oligo(dT)20 was used for the first strand DNA synthesis.

    Article Title: A flow cytometry-based screen identifies MBNL1 modulators that rescue splicing defects in myotonic dystrophy type I
    Article Snippet: Paragraph title: Rt-PCR ... The first strand cDNAs were synthesized from 1 g total RNA using Oligo(dT)20 primer or random hexamer and SuperScriptIII reverse transcriptase (Invitrogen, 18080-093) following the manufacture’s protocol.

    Article Title: YAP determines the cell fate of injured mouse hepatocytes in vivo
    Article Snippet: Paragraph title: Semiquantitative RT–PCR ... First-strand cDNA was synthesized from 1 μg total RNA using SuperscriptIII reverse transcriptase (Invitrogen) and an oligo-dT primer semiquantitative PCR was performed as below .

    Injection:

    Article Title: TTC21B contributes both causal and modifying alleles across the ciliopathy spectrum
    Article Snippet: Paragraph title: Zebrafish embryo manipulation and morpholino injection ... Oligo-dT-primed total RNA was reverse transcribed using SuperScriptIII reverse transcriptase (Invitrogen) and the resulting cDNA was PCR amplified.

    Article Title: A common allele in RPGRIP1L is a modifier of retinal degeneration in ciliopathies
    Article Snippet: Paragraph title: Zebrafish embryo manipulation and morpholino injection ... Oligo-dT-primed total RNA was reverse transcribed using SuperScriptIII reverse transcriptase (Invitrogen) and cDNA was subsequently PCR amplified and sequenced using standard procedures.

    DNA Extraction:

    Article Title: Phase I clinical trial of idiotypic DNA vaccine administered as a complex with polyethylenimine to patients with B-cell lymphoma
    Article Snippet: Aliquots of 5–8×109 cells are lysed for RNA and DNA extraction, the remaining cells are immediately cryopreserved in liquid nitrogen for further immunological testing. .. One μg of total RNA is used for cDNA synthesis with SuperScriptIII reverse transcriptase (Invitrogen) and Oligo-dT.

    Nucleic Acid Electrophoresis:

    Article Title: A soma-to-germline transformation in long-lived C. elegans mutants
    Article Snippet: RNA was isolated by Trizol (Invitrogen) and potential DNA contamination removed by TurboDNA-Free (Ambion). .. The purity/stability of the RNA was tested by gel electrophoresis and UV spectroscopy. cDNA was synthesized from 2ug of RNA with SuperscriptIII reverse transcriptase (Invitrogen) and quantitative PCR performed with SYBR Green (BioRad) on a BioRad iCycler. .. Samples were normalized to rpl-32 and/or snb-1 transcript levels.

    Fluorescence:

    Article Title: Vaccine-elicited receptor-binding site antibodies neutralize two New World hemorrhagic fever arenaviruses
    Article Snippet: We isolated donor PBMCs using Ficoll-Paque centrifugation and stained and sorted cells as previously described using a BD fluorescence-activated cell sorter Aria II, with the exception that we omitted the B-cell enrichment step and used JUNV GP1 Streptavidin-PE (Caltag) and JUNV GP1mut Streptavidin-PerCP (BD Biosciences) as antigens in the experiment. .. To obtain the IgH and Igκ genes from sorted memory B cells, we performed single-cell cDNA synthesis using SuperScriptIII reverse transcriptase (Invitrogen) followed by nested PCR amplification of the IgH and Igκ variable regions as previously described.

    Isolation:

    Article Title: SF3b1 mutations associated with myelodysplastic syndromes alter the fidelity of branchsite selection in yeast
    Article Snippet: Cells (10 OD600 units) were harvested by centrifugation, and total cellular RNA was isolated using a MasterPure Yeast RNA Purification Kit (Epicentre BioTechnologies; Madison, WI) according to the vendor's instructions. .. Primer extensions reactions were performed using SuperScriptIII reverse transcriptase (ThermoFisher Scientific; Waltham, MA) and the primers YAC6 (5΄-GGCACTCATGACCTTC-3΄) and yU6 (5΄-GAACTGCTGATCATCTCTG-3΄) ( ).

    Article Title: Cytological analysis and structural quantification of FtsZ1-2 and FtsZ2-1 network characteristics in Physcomitrella patens
    Article Snippet: Paragraph title: RNA Isolation and Reverse Transcriptase–Polymerase Chain Reaction (RT-PCR) ... 2 µg of total RNA was used for the first-strand cDNA synthesis using SuperscriptIII reverse transcriptase (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol.

    Article Title: Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses
    Article Snippet: For measurements of gene expression in brain tissues, total RNA was isolated using Trizol reagent (Invitrogen) and treated with TURBO DNase (Ambion). .. 1 μg of total RNA was reverse-transcribed by oligodT-priming using SuperScriptIII reverse transcriptase (Invitrogen).

    Article Title: Early Double-Negative Thymocyte Export in Trypanosoma cruzi Infection Is Restricted by Sphingosine Receptors and Associated with Human Chagas Disease
    Article Snippet: Paragraph title: Isolation of thymic CD4− CD8− cells and quantification of mouse mRNA transcripts ... First strand cDNA synthesis was prepared with 0.5 µg total RNA, random hexamer primer, and SuperscriptIII reverse transcriptase (Invitrogen, California, USA).

    Article Title: Lysine acetylome profiling uncovers novel histone deacetylase substrate proteins in Arabidopsis
    Article Snippet: Paragraph title: RNA isolation and RT–PCR ... Complementary DNA (cDNA) was synthesized from DNase‐treated RNA with SuperScriptIII reverse transcriptase (Invitrogen™) following the manufacturer's instruction and using dT20.

    Article Title: Phase I clinical trial of idiotypic DNA vaccine administered as a complex with polyethylenimine to patients with B-cell lymphoma
    Article Snippet: RNA is isolated using TRIreagent (Sigma) according to the manufacturer's instructions, dissolved in sterile water and evaluated by spectrophotometry before immediate storage at −80°C. .. One μg of total RNA is used for cDNA synthesis with SuperScriptIII reverse transcriptase (Invitrogen) and Oligo-dT.

    Article Title: C/EBPβ regulates delta-secretase expression and mediates pathogenesis in mouse models of Alzheimer’s disease
    Article Snippet: RNA was isolated by Trizol (Life Technologies). .. Reverse transcription was performed with SuperScriptIII reverse transcriptase (Life Technologies).

    Article Title: A soma-to-germline transformation in long-lived C. elegans mutants
    Article Snippet: RNA was isolated by Trizol (Invitrogen) and potential DNA contamination removed by TurboDNA-Free (Ambion). .. The purity/stability of the RNA was tested by gel electrophoresis and UV spectroscopy. cDNA was synthesized from 2ug of RNA with SuperscriptIII reverse transcriptase (Invitrogen) and quantitative PCR performed with SYBR Green (BioRad) on a BioRad iCycler.

    Article Title: Vaccine-elicited receptor-binding site antibodies neutralize two New World hemorrhagic fever arenaviruses
    Article Snippet: We isolated donor PBMCs using Ficoll-Paque centrifugation and stained and sorted cells as previously described using a BD fluorescence-activated cell sorter Aria II, with the exception that we omitted the B-cell enrichment step and used JUNV GP1 Streptavidin-PE (Caltag) and JUNV GP1mut Streptavidin-PerCP (BD Biosciences) as antigens in the experiment. .. To obtain the IgH and Igκ genes from sorted memory B cells, we performed single-cell cDNA synthesis using SuperScriptIII reverse transcriptase (Invitrogen) followed by nested PCR amplification of the IgH and Igκ variable regions as previously described.

    Article Title: Essential role for a novel population of binucleated mammary epithelial cells in lactation
    Article Snippet: Total RNA was prepared using the RNeasy Micro kit (Qiagen) from FACS-sorted luminal cells isolated from the mammary glands of FVB/N dams at 18.5 dP or 2 days of lactation, or from total mammary tissue derived from AURKA- deficient or control mice at 14 days of lactation. .. Reverse transcription was carried out using oligo(dT) primer and SuperscriptIII reverse transcriptase (Invitrogen, MA, USA).

    Article Title: YAP determines the cell fate of injured mouse hepatocytes in vivo
    Article Snippet: Total RNA was isolated from livers using TRIzol Reagent according to the manufacturer’s protocol (Invitrogen). .. First-strand cDNA was synthesized from 1 μg total RNA using SuperscriptIII reverse transcriptase (Invitrogen) and an oligo-dT primer semiquantitative PCR was performed as below .

    Mouse Assay:

    Article Title: Early Double-Negative Thymocyte Export in Trypanosoma cruzi Infection Is Restricted by Sphingosine Receptors and Associated with Human Chagas Disease
    Article Snippet: CD4− CD8− T lymphocytes were isolated from three pooled thymuses obtained from infected (14 dpi) and uninfected (control) mice by FACS cell sorting using PE-cy7-labeled anti-CD4, APC-labeled anti-CD8. .. First strand cDNA synthesis was prepared with 0.5 µg total RNA, random hexamer primer, and SuperscriptIII reverse transcriptase (Invitrogen, California, USA).

    Article Title: Essential role for a novel population of binucleated mammary epithelial cells in lactation
    Article Snippet: Total RNA was prepared using the RNeasy Micro kit (Qiagen) from FACS-sorted luminal cells isolated from the mammary glands of FVB/N dams at 18.5 dP or 2 days of lactation, or from total mammary tissue derived from AURKA- deficient or control mice at 14 days of lactation. .. Reverse transcription was carried out using oligo(dT) primer and SuperscriptIII reverse transcriptase (Invitrogen, MA, USA).

    Sequencing:

    Article Title: Early Double-Negative Thymocyte Export in Trypanosoma cruzi Infection Is Restricted by Sphingosine Receptors and Associated with Human Chagas Disease
    Article Snippet: First strand cDNA synthesis was prepared with 0.5 µg total RNA, random hexamer primer, and SuperscriptIII reverse transcriptase (Invitrogen, California, USA). .. For qPCR we used approximately 60 ng of cDNA for each sample and SYBR Green Master Mix 2 (Applied Biosystems, California, USA). cDNA was amplified using specific murine primer sequences described in .

    Article Title: Smarcal1-Mediated Fork Reversal Triggers Mre11-Dependent Degradation of Nascent DNA in the Absence of Brca2 and Stable Rad51 Nucleofilaments
    Article Snippet: SuperscriptIII reverse transcriptase (Thermo Fisher) and an oligo(dT)20 was used for the first strand DNA synthesis. .. SuperscriptIII reverse transcriptase (Thermo Fisher) and an oligo(dT)20 was used for the first strand DNA synthesis.

    Article Title: Vaccine-elicited receptor-binding site antibodies neutralize two New World hemorrhagic fever arenaviruses
    Article Snippet: To obtain the IgH and Igκ genes from sorted memory B cells, we performed single-cell cDNA synthesis using SuperScriptIII reverse transcriptase (Invitrogen) followed by nested PCR amplification of the IgH and Igκ variable regions as previously described. .. Our low recovery rates for paired re-arranged heavy and light chain segments from single memory B cells (4/25 in experiment 1; 1/10 in experiment 2) could possibly be explained by technical limitations, the possibility that some cells encoded IgA instead of IgG (we only selected for IgM− cells), or false positive events in the flow cytometry.

    Construct:

    Article Title: Vaccine-elicited receptor-binding site antibodies neutralize two New World hemorrhagic fever arenaviruses
    Article Snippet: To obtain the IgH and Igκ genes from sorted memory B cells, we performed single-cell cDNA synthesis using SuperScriptIII reverse transcriptase (Invitrogen) followed by nested PCR amplification of the IgH and Igκ variable regions as previously described. .. After sequencing PCR products, we used IgBLAST ( http://www.ncbi.nlm.nih.gov/igblast ) and IMGT® ( http://www.imgt.org ) to analyze IgG gene usage and the extent of VH /Vκ somatic hypermutation.

    Article Title: Cancer associated SF3B1 mutants recognize otherwise inaccessible cryptic 3’ splice sites within RNA secondary structures
    Article Snippet: cDNA was prepared from total RNA depleted of genomic DNA (on-column DNAse treatment) and SuperscriptIII reverse transcriptase (Life Technologies) using random hexamers. .. To determine splice isoforms, cDNA was amplified with suitable primers and resolved on 3% Metaphor agarose.

    Spectroscopy:

    Article Title: A soma-to-germline transformation in long-lived C. elegans mutants
    Article Snippet: RNA was isolated by Trizol (Invitrogen) and potential DNA contamination removed by TurboDNA-Free (Ambion). .. The purity/stability of the RNA was tested by gel electrophoresis and UV spectroscopy. cDNA was synthesized from 2ug of RNA with SuperscriptIII reverse transcriptase (Invitrogen) and quantitative PCR performed with SYBR Green (BioRad) on a BioRad iCycler. .. Samples were normalized to rpl-32 and/or snb-1 transcript levels.

    Staining:

    Article Title: TTC21B contributes both causal and modifying alleles across the ciliopathy spectrum
    Article Snippet: Images were captured at 8× magnification and measurements were taken of the width spanning the 5th somites from the anterior end, and the length of the notochord as defined by myoD staining of adaxial cells. .. Oligo-dT-primed total RNA was reverse transcribed using SuperScriptIII reverse transcriptase (Invitrogen) and the resulting cDNA was PCR amplified.

    Article Title: A common allele in RPGRIP1L is a modifier of retinal degeneration in ciliopathies
    Article Snippet: Images were captured at 10X magnification and measurements were taken of the width spanning the 5th somites from the anterior end, and the length of the notochord as defined by myoD staining of adaxial cells. .. Oligo-dT-primed total RNA was reverse transcribed using SuperScriptIII reverse transcriptase (Invitrogen) and cDNA was subsequently PCR amplified and sequenced using standard procedures.

    Article Title: Vaccine-elicited receptor-binding site antibodies neutralize two New World hemorrhagic fever arenaviruses
    Article Snippet: We isolated donor PBMCs using Ficoll-Paque centrifugation and stained and sorted cells as previously described using a BD fluorescence-activated cell sorter Aria II, with the exception that we omitted the B-cell enrichment step and used JUNV GP1 Streptavidin-PE (Caltag) and JUNV GP1mut Streptavidin-PerCP (BD Biosciences) as antigens in the experiment. .. To obtain the IgH and Igκ genes from sorted memory B cells, we performed single-cell cDNA synthesis using SuperScriptIII reverse transcriptase (Invitrogen) followed by nested PCR amplification of the IgH and Igκ variable regions as previously described.

    Nested PCR:

    Article Title: Vaccine-elicited receptor-binding site antibodies neutralize two New World hemorrhagic fever arenaviruses
    Article Snippet: We added antibodies CD19-Pacific-Blue (AbD Serotec/BioRad catalog number MCA1940GA) at a concentration of 40 μg ml−1 , CD27-fluorescein (BD Biosciences catalog number 340424) at a concentration of 30 ng ml−1 , 20 μl of IgM-allophycocyanin (BD Biosciences catalog number 551062) per 1 × 106 cells, CD3-PerCP (BD Biosciences catalog number 340663) at a concentration of 480 ng ml−1 , CD14-PerCP (BD Biosciences catalog number 345786) at a concentration of 0.8 μg ml−1 , 7AAD (BD Biosciences catalog number 559925) at a concentration of 0.8 μg ml−1 , and CD16 PerCP (Biolegend catalog number 302029) at a concentration of 8 μg ml−1 and kept the cells on ice for an additional 30 min. We then washed cells three times in PBS containing 2% (v/v) FBS and passed the cell suspension through a cell strainer prior to sorting. .. To obtain the IgH and Igκ genes from sorted memory B cells, we performed single-cell cDNA synthesis using SuperScriptIII reverse transcriptase (Invitrogen) followed by nested PCR amplification of the IgH and Igκ variable regions as previously described. .. Our low recovery rates for paired re-arranged heavy and light chain segments from single memory B cells (4/25 in experiment 1; 1/10 in experiment 2) could possibly be explained by technical limitations, the possibility that some cells encoded IgA instead of IgG (we only selected for IgM− cells), or false positive events in the flow cytometry.

    Purification:

    Article Title: SF3b1 mutations associated with myelodysplastic syndromes alter the fidelity of branchsite selection in yeast
    Article Snippet: Cells (10 OD600 units) were harvested by centrifugation, and total cellular RNA was isolated using a MasterPure Yeast RNA Purification Kit (Epicentre BioTechnologies; Madison, WI) according to the vendor's instructions. .. Primer extensions reactions were performed using SuperScriptIII reverse transcriptase (ThermoFisher Scientific; Waltham, MA) and the primers YAC6 (5΄-GGCACTCATGACCTTC-3΄) and yU6 (5΄-GAACTGCTGATCATCTCTG-3΄) ( ).

    In Situ Hybridization:

    Article Title: TTC21B contributes both causal and modifying alleles across the ciliopathy spectrum
    Article Snippet: We carried out in situ hybridization on whole embryos fixed with 4% paraformaldehyde with riboprobes against pax2, krox20 , and myoD using standard protocols. .. Oligo-dT-primed total RNA was reverse transcribed using SuperScriptIII reverse transcriptase (Invitrogen) and the resulting cDNA was PCR amplified.

    Plasmid Preparation:

    Article Title: TTC21B contributes both causal and modifying alleles across the ciliopathy spectrum
    Article Snippet: To rescue morphant phenotypes, we transcribed mRNA from linearized pCS2+-TTC21B vector with the SP6 mMessage mMachine kit (Ambion). .. Oligo-dT-primed total RNA was reverse transcribed using SuperScriptIII reverse transcriptase (Invitrogen) and the resulting cDNA was PCR amplified.

    Article Title: A common allele in RPGRIP1L is a modifier of retinal degeneration in ciliopathies
    Article Snippet: To rescue the MO phenotype, we transcribed mRNA from linearized pCS2+-RPGRIP1L vector with the SP6 mMessage machine kit (Ambion). .. Oligo-dT-primed total RNA was reverse transcribed using SuperScriptIII reverse transcriptase (Invitrogen) and cDNA was subsequently PCR amplified and sequenced using standard procedures.

    Article Title: Smarcal1-Mediated Fork Reversal Triggers Mre11-Dependent Degradation of Nascent DNA in the Absence of Brca2 and Stable Rad51 Nucleofilaments
    Article Snippet: SuperscriptIII reverse transcriptase (Thermo Fisher) and an oligo(dT)20 was used for the first strand DNA synthesis. .. SuperscriptIII reverse transcriptase (Thermo Fisher) and an oligo(dT)20 was used for the first strand DNA synthesis.

    Article Title: Vaccine-elicited receptor-binding site antibodies neutralize two New World hemorrhagic fever arenaviruses
    Article Snippet: To obtain the IgH and Igκ genes from sorted memory B cells, we performed single-cell cDNA synthesis using SuperScriptIII reverse transcriptase (Invitrogen) followed by nested PCR amplification of the IgH and Igκ variable regions as previously described. .. After sequencing PCR products, we used IgBLAST ( http://www.ncbi.nlm.nih.gov/igblast ) and IMGT® ( http://www.imgt.org ) to analyze IgG gene usage and the extent of VH /Vκ somatic hypermutation.

    Article Title: Cancer associated SF3B1 mutants recognize otherwise inaccessible cryptic 3’ splice sites within RNA secondary structures
    Article Snippet: cDNA was prepared from total RNA depleted of genomic DNA (on-column DNAse treatment) and SuperscriptIII reverse transcriptase (Life Technologies) using random hexamers. .. To determine splice isoforms, cDNA was amplified with suitable primers and resolved on 3% Metaphor agarose.

    Software:

    Article Title: SF3b1 mutations associated with myelodysplastic syndromes alter the fidelity of branchsite selection in yeast
    Article Snippet: Primer extensions reactions were performed using SuperScriptIII reverse transcriptase (ThermoFisher Scientific; Waltham, MA) and the primers YAC6 (5΄-GGCACTCATGACCTTC-3΄) and yU6 (5΄-GAACTGCTGATCATCTCTG-3΄) ( ). .. Primer extensions reactions were performed using SuperScriptIII reverse transcriptase (ThermoFisher Scientific; Waltham, MA) and the primers YAC6 (5΄-GGCACTCATGACCTTC-3΄) and yU6 (5΄-GAACTGCTGATCATCTCTG-3΄) ( ).

    SYBR Green Assay:

    Article Title: A soma-to-germline transformation in long-lived C. elegans mutants
    Article Snippet: RNA was isolated by Trizol (Invitrogen) and potential DNA contamination removed by TurboDNA-Free (Ambion). .. The purity/stability of the RNA was tested by gel electrophoresis and UV spectroscopy. cDNA was synthesized from 2ug of RNA with SuperscriptIII reverse transcriptase (Invitrogen) and quantitative PCR performed with SYBR Green (BioRad) on a BioRad iCycler. .. Samples were normalized to rpl-32 and/or snb-1 transcript levels.

    Article Title: Comparison of breast cancer metastasis models reveals a possible mechanism of tumor aggressiveness
    Article Snippet: RNA analysis Total RNA extraction and reverse transcription were performed as previously described . mRNA was reverse transcribed with random primers and SuperScriptIII reverse transcriptase (Thermo Fisher). .. RNA analysis Total RNA extraction and reverse transcription were performed as previously described . mRNA was reverse transcribed with random primers and SuperScriptIII reverse transcriptase (Thermo Fisher).

    RNA Extraction:

    Article Title: Comparison of breast cancer metastasis models reveals a possible mechanism of tumor aggressiveness
    Article Snippet: Short interfering RNAs (siRNAs) against ABCE1 and scrambled (control) were purchased from Integrated DNA Technologies. .. RNA analysis Total RNA extraction and reverse transcription were performed as previously described . mRNA was reverse transcribed with random primers and SuperScriptIII reverse transcriptase (Thermo Fisher). .. Reverse transcription for specific miRNAs was performed with TaqMan miRNA Assays (Thermo Fisher).

    In Situ:

    Article Title: A common allele in RPGRIP1L is a modifier of retinal degeneration in ciliopathies
    Article Snippet: We carried out in situ hybridization on whole embryos fixed with 4% paraformaldehyde with riboprobes against pax2 , krox20 , and myoD using standard protocols. .. Oligo-dT-primed total RNA was reverse transcribed using SuperScriptIII reverse transcriptase (Invitrogen) and cDNA was subsequently PCR amplified and sequenced using standard procedures.

    Electrophoresis:

    Article Title: A flow cytometry-based screen identifies MBNL1 modulators that rescue splicing defects in myotonic dystrophy type I
    Article Snippet: The first strand cDNAs were synthesized from 1 g total RNA using Oligo(dT)20 primer or random hexamer and SuperScriptIII reverse transcriptase (Invitrogen, 18080-093) following the manufacture’s protocol. .. PCR amplification was performed as follows: 95 °C for 1 min; followed by 30 cycles of 95 °C for 20 s, 55 °C for 20 s, 68 °C for 1 min and final extension at 68 °C for 4 min.

    Incubation:

    Article Title: SF3b1 mutations associated with myelodysplastic syndromes alter the fidelity of branchsite selection in yeast
    Article Snippet: Primer extensions reactions were performed using SuperScriptIII reverse transcriptase (ThermoFisher Scientific; Waltham, MA) and the primers YAC6 (5΄-GGCACTCATGACCTTC-3΄) and yU6 (5΄-GAACTGCTGATCATCTCTG-3΄) ( ). .. Primer extensions reactions were performed using SuperScriptIII reverse transcriptase (ThermoFisher Scientific; Waltham, MA) and the primers YAC6 (5΄-GGCACTCATGACCTTC-3΄) and yU6 (5΄-GAACTGCTGATCATCTCTG-3΄) ( ).

    Article Title: Vaccine-elicited receptor-binding site antibodies neutralize two New World hemorrhagic fever arenaviruses
    Article Snippet: We adjusted cells to a density of 5 × 106 cells in 100 µl and incubated them with antigen tetramers at a concentration of 0.10 μg ml−1 on ice for 30 min with intermittent gentle vortexing. .. To obtain the IgH and Igκ genes from sorted memory B cells, we performed single-cell cDNA synthesis using SuperScriptIII reverse transcriptase (Invitrogen) followed by nested PCR amplification of the IgH and Igκ variable regions as previously described.

    Article Title: YAP determines the cell fate of injured mouse hepatocytes in vivo
    Article Snippet: First-strand cDNA was synthesized from 1 μg total RNA using SuperscriptIII reverse transcriptase (Invitrogen) and an oligo-dT primer semiquantitative PCR was performed as below . .. For a 20 μl PCR reaction, cDNA template was mixed with TaKaRa Ex Taq (TaKaTa) plus the appropriate primers to a final concentration of 200 nM each.

    Spectrophotometry:

    Article Title: Phase I clinical trial of idiotypic DNA vaccine administered as a complex with polyethylenimine to patients with B-cell lymphoma
    Article Snippet: RNA is isolated using TRIreagent (Sigma) according to the manufacturer's instructions, dissolved in sterile water and evaluated by spectrophotometry before immediate storage at −80°C. .. One μg of total RNA is used for cDNA synthesis with SuperScriptIII reverse transcriptase (Invitrogen) and Oligo-dT.

    Concentration Assay:

    Article Title: Vaccine-elicited receptor-binding site antibodies neutralize two New World hemorrhagic fever arenaviruses
    Article Snippet: We added antibodies CD19-Pacific-Blue (AbD Serotec/BioRad catalog number MCA1940GA) at a concentration of 40 μg ml−1 , CD27-fluorescein (BD Biosciences catalog number 340424) at a concentration of 30 ng ml−1 , 20 μl of IgM-allophycocyanin (BD Biosciences catalog number 551062) per 1 × 106 cells, CD3-PerCP (BD Biosciences catalog number 340663) at a concentration of 480 ng ml−1 , CD14-PerCP (BD Biosciences catalog number 345786) at a concentration of 0.8 μg ml−1 , 7AAD (BD Biosciences catalog number 559925) at a concentration of 0.8 μg ml−1 , and CD16 PerCP (Biolegend catalog number 302029) at a concentration of 8 μg ml−1 and kept the cells on ice for an additional 30 min. We then washed cells three times in PBS containing 2% (v/v) FBS and passed the cell suspension through a cell strainer prior to sorting. .. To obtain the IgH and Igκ genes from sorted memory B cells, we performed single-cell cDNA synthesis using SuperScriptIII reverse transcriptase (Invitrogen) followed by nested PCR amplification of the IgH and Igκ variable regions as previously described.

    FACS:

    Article Title: Early Double-Negative Thymocyte Export in Trypanosoma cruzi Infection Is Restricted by Sphingosine Receptors and Associated with Human Chagas Disease
    Article Snippet: CD4− CD8− T lymphocytes were isolated from three pooled thymuses obtained from infected (14 dpi) and uninfected (control) mice by FACS cell sorting using PE-cy7-labeled anti-CD4, APC-labeled anti-CD8. .. First strand cDNA synthesis was prepared with 0.5 µg total RNA, random hexamer primer, and SuperscriptIII reverse transcriptase (Invitrogen, California, USA).

    Article Title: Essential role for a novel population of binucleated mammary epithelial cells in lactation
    Article Snippet: Total RNA was prepared using the RNeasy Micro kit (Qiagen) from FACS-sorted luminal cells isolated from the mammary glands of FVB/N dams at 18.5 dP or 2 days of lactation, or from total mammary tissue derived from AURKA- deficient or control mice at 14 days of lactation. .. Reverse transcription was carried out using oligo(dT) primer and SuperscriptIII reverse transcriptase (Invitrogen, MA, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher superscriptiii reverse transcriptase
    Superscriptiii Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 126 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscriptiii reverse transcriptase/product/Thermo Fisher
    Average 99 stars, based on 126 article reviews
    Price from $9.99 to $1999.99
    superscriptiii reverse transcriptase - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher superscriptii reverse transcriptase
    Superscriptii Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 90 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscriptii reverse transcriptase/product/Thermo Fisher
    Average 99 stars, based on 90 article reviews
    Price from $9.99 to $1999.99
    superscriptii reverse transcriptase - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    Image Search Results