superscript iii rnase h reverse transcription  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    SuperScript III Reverse Transcriptase
    Description:
    Invitrogen SuperScript III Reverse Transcriptase is a genetically engineered MMLV reverse transcriptase RT that was created by introduction of several mutations for reduced RNase H activity increased half life and improved thermal stability SuperScript III RT offers higher cDNA yields improved cDNA lengths improved efficiency on GC rich target RNAs and overall better performance than wild type MMLV and MMLV RNase H minus enzymes SuperScript RTs are the most highly trusted and widely used RTs with over 50 000 citations reviews and publications to date Note The latest member of the SuperScript RT family SuperScript IV Reverse Transcriptase features enhanced thermostability processivity yields and performance with any RNA samples including those of suboptimal purity or integrity
    Catalog Number:
    18080044
    Price:
    None
    Applications:
    PCR & Real-Time PCR|Reverse Transcription
    Category:
    Proteins Enzymes Peptides
    Buy from Supplier


    Structured Review

    Thermo Fisher superscript iii rnase h reverse transcription
    Invitrogen SuperScript III Reverse Transcriptase is a genetically engineered MMLV reverse transcriptase RT that was created by introduction of several mutations for reduced RNase H activity increased half life and improved thermal stability SuperScript III RT offers higher cDNA yields improved cDNA lengths improved efficiency on GC rich target RNAs and overall better performance than wild type MMLV and MMLV RNase H minus enzymes SuperScript RTs are the most highly trusted and widely used RTs with over 50 000 citations reviews and publications to date Note The latest member of the SuperScript RT family SuperScript IV Reverse Transcriptase features enhanced thermostability processivity yields and performance with any RNA samples including those of suboptimal purity or integrity
    https://www.bioz.com/result/superscript iii rnase h reverse transcription/product/Thermo Fisher
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    superscript iii rnase h reverse transcription - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Genomic positional conservation identifies topological anchor point RNAs linked to developmental loci
    Article Snippet: Paragraph title: pcRNA cloning ... Briefly, 2 μg total RNA from HepG2 cells were reverse transcribed in 20 μl reaction using Superscript III Reverse Transcriptase (Invitrogen, catalogue number 18080044).

    Article Title: Identification of a Peptide Inhibitor of the RPM-1·FSN-1 Ubiquitin Ligase Complex *
    Article Snippet: Paragraph title: Cloning ... The 9 domains (D1–9) and subdomains (D5a, -b, and -c) of RPM-1 were amplified by RT-PCR from C. elegans total RNA using Superscript III reverse transcriptase (Invitrogen). cDNAs were inserted into pCR8 Topo GY and sequenced to ensure they were mutation-free.

    Amplification:

    Article Title: Direct differentiation of hepatic stem-like WB cells into insulin-producing cells using small molecules
    Article Snippet: Semi-quantitative and quantitative RT-PCR Total RNA was extracted by TRI Reagent (Fermentas, Burlington, ON, Canada) and reverse-transcribed using SuperScript III RT-PCR system (Invitrogen) according to the manufacturer's protocol . .. 1 μl of cDNA sample was used for PCR amplification.

    Article Title: Selective termination of lnc RNA transcription promotes heterochromatin silencing and cell differentiation
    Article Snippet: After incubation overnight at 20°C, ligated RNA was purified (Absolutely RNA kit, Stratagene) and reverse‐transcribed (Superscript III Reverse Transcriptase, Invitrogen). .. PCR amplification of the cDNA library was performed using Phusion polymerase (NEB).

    Article Title: Histone H3 Lys79 methylation is required for efficient nucleotide excision repair in a silenced locus of Saccharomyces cerevisiae
    Article Snippet: Total RNA was isolated from each sample as described previously , and 5 μg of RNA was reverse transcribed using Superscript III RT enzyme (Invitrogen), as per manufacturer's instructions. .. The resultant cDNA was PCR amplified for 30 cycle using primers specific for the HML α1, RPB2 , GAL10 gene and the NER genes listed in Supplementary Table 1 .

    Article Title: Homeostatic regulation of zinc transporters in the human small intestine by dietary zinc supplementation
    Article Snippet: Reverse transcription of poly-A+ RNA (1 μg) or DNAse treated RNA (1 μg) was carried out using Superscript III reverse transcriptase (Invitrogen). .. Samples were then amplified by PCR using Thermo-Start DNA polymerases (Abgene Ltd, Epsom, Surrey, UK).

    Article Title: The Unstructured Paramyxovirus Nucleocapsid Protein Tail Domain Modulates Viral Pathogenesis through Regulation of Transcriptase Activity
    Article Snippet: .. Briefly, 20 μl of extracted RNA was reverse transcribed using SuperScript III reverse transcriptase (Thermo), and second-strand synthesis was performed using Sequenase v2.0 (Agilent). cDNA was purified using DNA Clean and Concentrator-5 (Zymo) and subjected to Nextera XT tagmentation (Illumina) followed by 19 cycles of PCR amplification and a 0.8× Ampure XP cleanup (Beckman Coulter). .. Libraries were sequenced on a 2 × 300-bp run on an Illumina MiSeq.

    Article Title: Identification of a Peptide Inhibitor of the RPM-1·FSN-1 Ubiquitin Ligase Complex *
    Article Snippet: .. The 9 domains (D1–9) and subdomains (D5a, -b, and -c) of RPM-1 were amplified by RT-PCR from C. elegans total RNA using Superscript III reverse transcriptase (Invitrogen). cDNAs were inserted into pCR8 Topo GY and sequenced to ensure they were mutation-free. .. Clones in pCR8 Topo GY were recombined using LR recombinase with pBG-GY14 to create pBG-GY189 (GFP-D1), pBG-GY190 (GFP-D2), pBG-GY191 (GFP-D3), pBG-GY192 (GFP-D4), pBG-GY193 (GFP-D5), pBG-GY194 (GFP-D6), pBG-GY195 (GFP-D7), pBG-GY196 (GFP-D8), pBG-GY197 (GFP-D9), pBG-GY389 (GFP-D5a), pBG-GY412 (GFP-D5b), and pBG-GY384 (GFP-D5c).

    Article Title: Brain-Derived Neurotrophic Factor Induces Matrix Metalloproteinase 9 Expression in Neurons via the Serum Response Factor/c-Fos Pathway
    Article Snippet: RNA was reverse transcribed with the SuperScript III reverse transcriptase (Invitrogen) according to the manufacturer's instructions. .. The cDNA was amplified using a set of custom sequence-specific primers and TaqMan minor groove binder (MGB) probes.

    Synthesized:

    Article Title: Transcriptome analysis reveals a comprehensive insect resistance response mechanism in cotton to infestation by the phloem feeding insect Bemisia tabaci (whitefly)
    Article Snippet: .. First‐strand cDNA was synthesized from 3 μg of total RNA using SuperScript III Reverse Transcriptase (Invitrogen) in accordance with the manufacturer's instructions and reverse transcribed into cDNA followed by 50× dilution. .. The RT‐PCR program was as follows: one cycle of 5 min at 95 °C as an initial denaturation step followed by denaturation for 30 s at 95 °C, annealing for 30 s at 60 °C, extension for 30 s at 72 °C for 35 cycles and a final step at 72 °C for 10 min in a 20 μL volume. qRT‐PCR was performed in a 20 μL reaction volume containing 9.6 μL of 10× diluted cDNA as the template, 0.2 μL of each 10 μm forward and reverse gene‐specific primer, and 10 μL of SsoFast EvaGreen Supermix With Low ROX (Bio‐Rad, Hercules, CA).

    Quantitative RT-PCR:

    Article Title: Transcriptome analysis reveals a comprehensive insect resistance response mechanism in cotton to infestation by the phloem feeding insect Bemisia tabaci (whitefly)
    Article Snippet: Paragraph title: RT‐PCR and qRT‐PCR ... First‐strand cDNA was synthesized from 3 μg of total RNA using SuperScript III Reverse Transcriptase (Invitrogen) in accordance with the manufacturer's instructions and reverse transcribed into cDNA followed by 50× dilution.

    Article Title: Direct differentiation of hepatic stem-like WB cells into insulin-producing cells using small molecules
    Article Snippet: .. Semi-quantitative and quantitative RT-PCR Total RNA was extracted by TRI Reagent (Fermentas, Burlington, ON, Canada) and reverse-transcribed using SuperScript III RT-PCR system (Invitrogen) according to the manufacturer's protocol . .. 1 μl of cDNA sample was used for PCR amplification.

    Article Title: Telomeres in ICF syndrome cells are vulnerable to DNA damage due to elevated DNA:RNA hybrids
    Article Snippet: .. Total RNA was reverse transcribed at 55 °C with SuperScript III reverse transcriptase (Invitrogen) using a β-actin-specific primer (5′-AGTCCGCCTAGAAGCATTTG-3′) and a TERRA-specific primer composed from five telomere-hexameric repeat ((CCCTAA)5 ) . cDNAs were then analysed with the same primers used for DRIP ( ). qRT-PCR was carried out on an Applied Biosystems StepOnePlus Real-Time PCR system with Fast SYBR Green Master Mix (AB-4385612, Applied Biosystems). ..

    Article Title: Microarray expression profile analysis of circular RNAs in pancreatic cancer
    Article Snippet: Paragraph title: Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) validation assay for circRNAs ... The cDNA synthesis of RNA was performed using SuperScript™ III Reverse Transcriptase (Invitrogen).

    SYBR Green Assay:

    Article Title: Direct differentiation of hepatic stem-like WB cells into insulin-producing cells using small molecules
    Article Snippet: Semi-quantitative and quantitative RT-PCR Total RNA was extracted by TRI Reagent (Fermentas, Burlington, ON, Canada) and reverse-transcribed using SuperScript III RT-PCR system (Invitrogen) according to the manufacturer's protocol . .. Quantitative RT-PCR was performed using QuantiFast SYBR Green PCR Kit (Qiagen) and analyzed with DNA engine Opticon2 (MJ Research).

    Article Title: Telomeres in ICF syndrome cells are vulnerable to DNA damage due to elevated DNA:RNA hybrids
    Article Snippet: .. Total RNA was reverse transcribed at 55 °C with SuperScript III reverse transcriptase (Invitrogen) using a β-actin-specific primer (5′-AGTCCGCCTAGAAGCATTTG-3′) and a TERRA-specific primer composed from five telomere-hexameric repeat ((CCCTAA)5 ) . cDNAs were then analysed with the same primers used for DRIP ( ). qRT-PCR was carried out on an Applied Biosystems StepOnePlus Real-Time PCR system with Fast SYBR Green Master Mix (AB-4385612, Applied Biosystems). ..

    Incubation:

    Article Title: Selective termination of lnc RNA transcription promotes heterochromatin silencing and cell differentiation
    Article Snippet: .. After incubation overnight at 20°C, ligated RNA was purified (Absolutely RNA kit, Stratagene) and reverse‐transcribed (Superscript III Reverse Transcriptase, Invitrogen). .. PCR amplification of the cDNA library was performed using Phusion polymerase (NEB).

    Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
    Article Snippet: After 8 h incubation, cells were harvested and lysed, followed by the addition of precleared Protein G agarose beads for 1 h. The supernatants were mixed with agarose beads conjugated to anti-HA tag-antibody or control rabbit IgG for 4 h at 4 °C. .. To detect bound MajSAT RNA, 1 μg of precipitated RNA and 5% input were reverse transcribed to cDNA using SuperScript III Reverse Transcriptase (Invitrogen), and semi-quantitative RT-PCR was performed using Mighty Amp DNA polymerase (TaKaRa).

    Article Title: Homeostatic regulation of zinc transporters in the human small intestine by dietary zinc supplementation
    Article Snippet: DNAse I was inactivated by addition of EDTA to 2.5 mM, followed by a 10 minute incubation at 65°C. .. Reverse transcription of poly-A+ RNA (1 μg) or DNAse treated RNA (1 μg) was carried out using Superscript III reverse transcriptase (Invitrogen).

    Expressing:

    Article Title: Telomeres in ICF syndrome cells are vulnerable to DNA damage due to elevated DNA:RNA hybrids
    Article Snippet: RNA extraction and qRT-PCR ICF LCLs, whose growth is considerably attenuated, required sorting of approximately 40 million cells in order to obtain a sufficient number of cells from S and G2 phases for expression analysis. .. Total RNA was reverse transcribed at 55 °C with SuperScript III reverse transcriptase (Invitrogen) using a β-actin-specific primer (5′-AGTCCGCCTAGAAGCATTTG-3′) and a TERRA-specific primer composed from five telomere-hexameric repeat ((CCCTAA)5 ) . cDNAs were then analysed with the same primers used for DRIP ( ). qRT-PCR was carried out on an Applied Biosystems StepOnePlus Real-Time PCR system with Fast SYBR Green Master Mix (AB-4385612, Applied Biosystems).

    Article Title: Imaging cellulose synthase motility during primary cell wall synthesis in the grass Brachypodium distachyon
    Article Snippet: Construction of mEGFP-BdCESA transgenic lines Total RNA was extracted from B. distachyon tissue (7-day-old whole seedlings) and reverse transcribed into cDNA with Invitrogen SuperScript III Reverse Transcriptase. .. A multi-site Gateway reaction united the mEGFP and the CESA coding sequences in the plant expression vector pIPKb002 , in which expression of the tagged CESA genes is driven by a ubiquitin promoter from Zea mays .

    Article Title: Identification of a Peptide Inhibitor of the RPM-1·FSN-1 Ubiquitin Ligase Complex *
    Article Snippet: The 9 domains (D1–9) and subdomains (D5a, -b, and -c) of RPM-1 were amplified by RT-PCR from C. elegans total RNA using Superscript III reverse transcriptase (Invitrogen). cDNAs were inserted into pCR8 Topo GY and sequenced to ensure they were mutation-free. .. For transgenic expression of RIP (D5c) in C. elegans , pBG-GY134 (Prgef-1 FLAG GY) was recombined with pBG-GY349 (pCR8 Topo GY RIP (D5c)) to generate pBG-GY440 (Prgef-1 FLAG::RIP (D5c)). pCZ161 encoding full-length RPM-1::GFP driven by its native promoter was engineered to contain a point mutation D2214A (pBG-190).

    Article Title: Brain-Derived Neurotrophic Factor Induces Matrix Metalloproteinase 9 Expression in Neurons via the Serum Response Factor/c-Fos Pathway
    Article Snippet: RNA was reverse transcribed with the SuperScript III reverse transcriptase (Invitrogen) according to the manufacturer's instructions. .. The following TaqMan Gene Expression Assays (Applied Biosystems) were used: Rn00579162_m1 for MMP-9 and Rn01775763_g1 for glyceraldehyde-3-phosphate dehydrogenase (GAPDH; endogenous control).

    Touchdown PCR:

    Article Title: Genomic positional conservation identifies topological anchor point RNAs linked to developmental loci
    Article Snippet: Briefly, 2 μg total RNA from HepG2 cells were reverse transcribed in 20 μl reaction using Superscript III Reverse Transcriptase (Invitrogen, catalogue number 18080044). .. Touchdown-PCR was performed using 2 μl of the cDNA, mixed with 38.75 μl water, 1 μl of each primer (10 μM) (Additional file : Table S8), 1.25 μl dNTP (10 mM), 5 μl 10× Pfu Ultra reaction buffer and 1 μl Pfu Polymerase (Stratagene, catalogue number 600380).

    Western Blot:

    Article Title: Histone H3 Lys79 methylation is required for efficient nucleotide excision repair in a silenced locus of Saccharomyces cerevisiae
    Article Snippet: Paragraph title: RT–PCR and western blot ... Total RNA was isolated from each sample as described previously , and 5 μg of RNA was reverse transcribed using Superscript III RT enzyme (Invitrogen), as per manufacturer's instructions.

    Transfection:

    Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
    Article Snippet: Briefly, 6 × 106 K512-HAYBX1 cells were seeded on a 10 cm dish, and 8 μg of BrU-labelled MajSAT-Fw RNA was transfected into the cells using TransMessenger reagent (Qiagen). .. To detect bound MajSAT RNA, 1 μg of precipitated RNA and 5% input were reverse transcribed to cDNA using SuperScript III Reverse Transcriptase (Invitrogen), and semi-quantitative RT-PCR was performed using Mighty Amp DNA polymerase (TaKaRa).

    Article Title: Importance of the 1+7 configuration of ribonucleoprotein complexes for influenza A virus genome packaging
    Article Snippet: The extracted vRNAs were digested using an RNase-free DNase Set (Qiagen) according to the manufacturer′s instructions to eliminate any residual transfected plasmid DNA. .. Each vRNA was reverse-transcribed using SuperScript III Reverse Transcriptase (Invitrogen, Eugene, OR) with a universal primer (a mixture of two primers, AGCAAAAGCAGG and AGCGAAAGCAGG) for all vRNA segments and then PCR-amplified using GoTaq Green Master Mix (Promega, Madison, WI) with strand-specific primers for either the HA (forward primer, AGCAAAAGCAGGGGAAAATAAAAAC; reverse primer, AGTAGAAACAAGGGTGTTTTTCCTT) or NP vRNA segment (forward primer, AGCAAAAGCAGGGTAGATAATCACTC; reverse primer, AGTAGAAACAAGGGTATTTTTCTTT).

    Immunoprecipitation:

    Article Title: Selective termination of lnc RNA transcription promotes heterochromatin silencing and cell differentiation
    Article Snippet: Immunoprecipitated RNA was fragmented 200–300nt long using RNA Fragmentation Reagent Kit from (Ambion). .. After incubation overnight at 20°C, ligated RNA was purified (Absolutely RNA kit, Stratagene) and reverse‐transcribed (Superscript III Reverse Transcriptase, Invitrogen).

    Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
    Article Snippet: Paragraph title: RNA immunoprecipitation ... To detect bound MajSAT RNA, 1 μg of precipitated RNA and 5% input were reverse transcribed to cDNA using SuperScript III Reverse Transcriptase (Invitrogen), and semi-quantitative RT-PCR was performed using Mighty Amp DNA polymerase (TaKaRa).

    Infection:

    Article Title: The Unstructured Paramyxovirus Nucleocapsid Protein Tail Domain Modulates Viral Pathogenesis through Regulation of Transcriptase Activity
    Article Snippet: RNA was extracted from infected cells using the ZR viral RNA kit (Zymo Research) according to the manufacturer's instructions. .. Briefly, 20 μl of extracted RNA was reverse transcribed using SuperScript III reverse transcriptase (Thermo), and second-strand synthesis was performed using Sequenase v2.0 (Agilent). cDNA was purified using DNA Clean and Concentrator-5 (Zymo) and subjected to Nextera XT tagmentation (Illumina) followed by 19 cycles of PCR amplification and a 0.8× Ampure XP cleanup (Beckman Coulter).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Transcriptome analysis reveals a comprehensive insect resistance response mechanism in cotton to infestation by the phloem feeding insect Bemisia tabaci (whitefly)
    Article Snippet: Paragraph title: RT‐PCR and qRT‐PCR ... First‐strand cDNA was synthesized from 3 μg of total RNA using SuperScript III Reverse Transcriptase (Invitrogen) in accordance with the manufacturer's instructions and reverse transcribed into cDNA followed by 50× dilution.

    Article Title: Direct differentiation of hepatic stem-like WB cells into insulin-producing cells using small molecules
    Article Snippet: .. Semi-quantitative and quantitative RT-PCR Total RNA was extracted by TRI Reagent (Fermentas, Burlington, ON, Canada) and reverse-transcribed using SuperScript III RT-PCR system (Invitrogen) according to the manufacturer's protocol . .. 1 μl of cDNA sample was used for PCR amplification.

    Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
    Article Snippet: .. To detect bound MajSAT RNA, 1 μg of precipitated RNA and 5% input were reverse transcribed to cDNA using SuperScript III Reverse Transcriptase (Invitrogen), and semi-quantitative RT-PCR was performed using Mighty Amp DNA polymerase (TaKaRa). ..

    Article Title: Histone H3 Lys79 methylation is required for efficient nucleotide excision repair in a silenced locus of Saccharomyces cerevisiae
    Article Snippet: Paragraph title: RT–PCR and western blot ... Total RNA was isolated from each sample as described previously , and 5 μg of RNA was reverse transcribed using Superscript III RT enzyme (Invitrogen), as per manufacturer's instructions.

    Article Title: Homeostatic regulation of zinc transporters in the human small intestine by dietary zinc supplementation
    Article Snippet: Paragraph title: Reverse transcription-polymerase chain reaction (RT-PCR) ... Reverse transcription of poly-A+ RNA (1 μg) or DNAse treated RNA (1 μg) was carried out using Superscript III reverse transcriptase (Invitrogen).

    Article Title: Identification of a Peptide Inhibitor of the RPM-1·FSN-1 Ubiquitin Ligase Complex *
    Article Snippet: .. The 9 domains (D1–9) and subdomains (D5a, -b, and -c) of RPM-1 were amplified by RT-PCR from C. elegans total RNA using Superscript III reverse transcriptase (Invitrogen). cDNAs were inserted into pCR8 Topo GY and sequenced to ensure they were mutation-free. .. Clones in pCR8 Topo GY were recombined using LR recombinase with pBG-GY14 to create pBG-GY189 (GFP-D1), pBG-GY190 (GFP-D2), pBG-GY191 (GFP-D3), pBG-GY192 (GFP-D4), pBG-GY193 (GFP-D5), pBG-GY194 (GFP-D6), pBG-GY195 (GFP-D7), pBG-GY196 (GFP-D8), pBG-GY197 (GFP-D9), pBG-GY389 (GFP-D5a), pBG-GY412 (GFP-D5b), and pBG-GY384 (GFP-D5c).

    Article Title: Importance of the 1+7 configuration of ribonucleoprotein complexes for influenza A virus genome packaging
    Article Snippet: Paragraph title: RT-PCR ... Each vRNA was reverse-transcribed using SuperScript III Reverse Transcriptase (Invitrogen, Eugene, OR) with a universal primer (a mixture of two primers, AGCAAAAGCAGG and AGCGAAAGCAGG) for all vRNA segments and then PCR-amplified using GoTaq Green Master Mix (Promega, Madison, WI) with strand-specific primers for either the HA (forward primer, AGCAAAAGCAGGGGAAAATAAAAAC; reverse primer, AGTAGAAACAAGGGTGTTTTTCCTT) or NP vRNA segment (forward primer, AGCAAAAGCAGGGTAGATAATCACTC; reverse primer, AGTAGAAACAAGGGTATTTTTCTTT).

    Generated:

    Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
    Article Snippet: The generated peak list files were used to query either the MSDB database or NCBI using the MASCOT programme ( http://www.matrixscience.com ). .. To detect bound MajSAT RNA, 1 μg of precipitated RNA and 5% input were reverse transcribed to cDNA using SuperScript III Reverse Transcriptase (Invitrogen), and semi-quantitative RT-PCR was performed using Mighty Amp DNA polymerase (TaKaRa).

    Sequencing:

    Article Title: Selective termination of lnc RNA transcription promotes heterochromatin silencing and cell differentiation
    Article Snippet: RNA‐IP experiments coupled to high‐throughput sequencing were conducted in duplicates. .. After incubation overnight at 20°C, ligated RNA was purified (Absolutely RNA kit, Stratagene) and reverse‐transcribed (Superscript III Reverse Transcriptase, Invitrogen).

    Article Title: The Unstructured Paramyxovirus Nucleocapsid Protein Tail Domain Modulates Viral Pathogenesis through Regulation of Transcriptase Activity
    Article Snippet: Paragraph title: Deep sequencing of viral genomes. ... Briefly, 20 μl of extracted RNA was reverse transcribed using SuperScript III reverse transcriptase (Thermo), and second-strand synthesis was performed using Sequenase v2.0 (Agilent). cDNA was purified using DNA Clean and Concentrator-5 (Zymo) and subjected to Nextera XT tagmentation (Illumina) followed by 19 cycles of PCR amplification and a 0.8× Ampure XP cleanup (Beckman Coulter).

    Article Title: Brain-Derived Neurotrophic Factor Induces Matrix Metalloproteinase 9 Expression in Neurons via the Serum Response Factor/c-Fos Pathway
    Article Snippet: RNA was reverse transcribed with the SuperScript III reverse transcriptase (Invitrogen) according to the manufacturer's instructions. .. The cDNA was amplified using a set of custom sequence-specific primers and TaqMan minor groove binder (MGB) probes.

    Binding Assay:

    Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
    Article Snippet: To examine the endogenous binding of YBX1 protein to MajSAT RNA, the RIP assay microRNA kit (MBL) was used according to the manufacturer's protocol. .. To detect bound MajSAT RNA, 1 μg of precipitated RNA and 5% input were reverse transcribed to cDNA using SuperScript III Reverse Transcriptase (Invitrogen), and semi-quantitative RT-PCR was performed using Mighty Amp DNA polymerase (TaKaRa).

    Mutagenesis:

    Article Title: Identification of a Peptide Inhibitor of the RPM-1·FSN-1 Ubiquitin Ligase Complex *
    Article Snippet: .. The 9 domains (D1–9) and subdomains (D5a, -b, and -c) of RPM-1 were amplified by RT-PCR from C. elegans total RNA using Superscript III reverse transcriptase (Invitrogen). cDNAs were inserted into pCR8 Topo GY and sequenced to ensure they were mutation-free. .. Clones in pCR8 Topo GY were recombined using LR recombinase with pBG-GY14 to create pBG-GY189 (GFP-D1), pBG-GY190 (GFP-D2), pBG-GY191 (GFP-D3), pBG-GY192 (GFP-D4), pBG-GY193 (GFP-D5), pBG-GY194 (GFP-D6), pBG-GY195 (GFP-D7), pBG-GY196 (GFP-D8), pBG-GY197 (GFP-D9), pBG-GY389 (GFP-D5a), pBG-GY412 (GFP-D5b), and pBG-GY384 (GFP-D5c).

    Isolation:

    Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
    Article Snippet: The pellets were washed four times, and bound RNA was isolated by ethanol precipitation. .. To detect bound MajSAT RNA, 1 μg of precipitated RNA and 5% input were reverse transcribed to cDNA using SuperScript III Reverse Transcriptase (Invitrogen), and semi-quantitative RT-PCR was performed using Mighty Amp DNA polymerase (TaKaRa).

    Article Title: Microarray expression profile analysis of circular RNAs in pancreatic cancer
    Article Snippet: Total RNA from 10 pairs human pancreatic cancer tissue and corresponding paracancerous tissue was isolated using TRIzol reagent (Invitrogen). .. The cDNA synthesis of RNA was performed using SuperScript™ III Reverse Transcriptase (Invitrogen).

    Article Title: Histone H3 Lys79 methylation is required for efficient nucleotide excision repair in a silenced locus of Saccharomyces cerevisiae
    Article Snippet: .. Total RNA was isolated from each sample as described previously , and 5 μg of RNA was reverse transcribed using Superscript III RT enzyme (Invitrogen), as per manufacturer's instructions. .. The resultant cDNA was PCR amplified for 30 cycle using primers specific for the HML α1, RPB2 , GAL10 gene and the NER genes listed in Supplementary Table 1 .

    Article Title: Brain-Derived Neurotrophic Factor Induces Matrix Metalloproteinase 9 Expression in Neurons via the Serum Response Factor/c-Fos Pathway
    Article Snippet: Total RNA was isolated from 1 × 106 cells using RNeasy Mini kit (Qiagen) as described by the manufacturer. .. RNA was reverse transcribed with the SuperScript III reverse transcriptase (Invitrogen) according to the manufacturer's instructions.

    Size-exclusion Chromatography:

    Article Title: Microarray expression profile analysis of circular RNAs in pancreatic cancer
    Article Snippet: The cDNA synthesis of RNA was performed using SuperScript™ III Reverse Transcriptase (Invitrogen). .. The reaction condition was as follows: 95°C for 10 min, 40 cycles of 95°C for 10 sec, 60°C for 60 sec, 95°C for 15 sec.

    Purification:

    Article Title: Selective termination of lnc RNA transcription promotes heterochromatin silencing and cell differentiation
    Article Snippet: .. After incubation overnight at 20°C, ligated RNA was purified (Absolutely RNA kit, Stratagene) and reverse‐transcribed (Superscript III Reverse Transcriptase, Invitrogen). .. PCR amplification of the cDNA library was performed using Phusion polymerase (NEB).

    Article Title: The Unstructured Paramyxovirus Nucleocapsid Protein Tail Domain Modulates Viral Pathogenesis through Regulation of Transcriptase Activity
    Article Snippet: .. Briefly, 20 μl of extracted RNA was reverse transcribed using SuperScript III reverse transcriptase (Thermo), and second-strand synthesis was performed using Sequenase v2.0 (Agilent). cDNA was purified using DNA Clean and Concentrator-5 (Zymo) and subjected to Nextera XT tagmentation (Illumina) followed by 19 cycles of PCR amplification and a 0.8× Ampure XP cleanup (Beckman Coulter). .. Libraries were sequenced on a 2 × 300-bp run on an Illumina MiSeq.

    Polymerase Chain Reaction:

    Article Title: Direct differentiation of hepatic stem-like WB cells into insulin-producing cells using small molecules
    Article Snippet: Semi-quantitative and quantitative RT-PCR Total RNA was extracted by TRI Reagent (Fermentas, Burlington, ON, Canada) and reverse-transcribed using SuperScript III RT-PCR system (Invitrogen) according to the manufacturer's protocol . .. 1 μl of cDNA sample was used for PCR amplification.

    Article Title: Selective termination of lnc RNA transcription promotes heterochromatin silencing and cell differentiation
    Article Snippet: ChIP and RNA‐IP coupled to PCR analysis were performed as described previously (Hiriart et al , ). .. After incubation overnight at 20°C, ligated RNA was purified (Absolutely RNA kit, Stratagene) and reverse‐transcribed (Superscript III Reverse Transcriptase, Invitrogen).

    Article Title: Microarray expression profile analysis of circular RNAs in pancreatic cancer
    Article Snippet: Paragraph title: Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) validation assay for circRNAs ... The cDNA synthesis of RNA was performed using SuperScript™ III Reverse Transcriptase (Invitrogen).

    Article Title: Histone H3 Lys79 methylation is required for efficient nucleotide excision repair in a silenced locus of Saccharomyces cerevisiae
    Article Snippet: Total RNA was isolated from each sample as described previously , and 5 μg of RNA was reverse transcribed using Superscript III RT enzyme (Invitrogen), as per manufacturer's instructions. .. The resultant cDNA was PCR amplified for 30 cycle using primers specific for the HML α1, RPB2 , GAL10 gene and the NER genes listed in Supplementary Table 1 .

    Article Title: Homeostatic regulation of zinc transporters in the human small intestine by dietary zinc supplementation
    Article Snippet: Reverse transcription of poly-A+ RNA (1 μg) or DNAse treated RNA (1 μg) was carried out using Superscript III reverse transcriptase (Invitrogen). .. Samples were then amplified by PCR using Thermo-Start DNA polymerases (Abgene Ltd, Epsom, Surrey, UK).

    Article Title: The Unstructured Paramyxovirus Nucleocapsid Protein Tail Domain Modulates Viral Pathogenesis through Regulation of Transcriptase Activity
    Article Snippet: .. Briefly, 20 μl of extracted RNA was reverse transcribed using SuperScript III reverse transcriptase (Thermo), and second-strand synthesis was performed using Sequenase v2.0 (Agilent). cDNA was purified using DNA Clean and Concentrator-5 (Zymo) and subjected to Nextera XT tagmentation (Illumina) followed by 19 cycles of PCR amplification and a 0.8× Ampure XP cleanup (Beckman Coulter). .. Libraries were sequenced on a 2 × 300-bp run on an Illumina MiSeq.

    Article Title: Identification of a Peptide Inhibitor of the RPM-1·FSN-1 Ubiquitin Ligase Complex *
    Article Snippet: The 9 domains (D1–9) and subdomains (D5a, -b, and -c) of RPM-1 were amplified by RT-PCR from C. elegans total RNA using Superscript III reverse transcriptase (Invitrogen). cDNAs were inserted into pCR8 Topo GY and sequenced to ensure they were mutation-free. .. For point mutagenesis, an HpaI-SpeI fragment of RPM-1 was amplified by PCR using pCZ161 as a template and inserted into pCR2.1.

    Article Title: Brain-Derived Neurotrophic Factor Induces Matrix Metalloproteinase 9 Expression in Neurons via the Serum Response Factor/c-Fos Pathway
    Article Snippet: RNA was reverse transcribed with the SuperScript III reverse transcriptase (Invitrogen) according to the manufacturer's instructions. .. Quantitative real-time PCRs were performed using TaqMan Fast Advanced PCR Master Mix (Applied Biosystems) in an Applied Biosystems 7900HT fast real-time PCR system using the following cycling conditions: 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Additionally exemplary products were also visualized on agarose gel.

    Article Title: Importance of the 1+7 configuration of ribonucleoprotein complexes for influenza A virus genome packaging
    Article Snippet: .. Each vRNA was reverse-transcribed using SuperScript III Reverse Transcriptase (Invitrogen, Eugene, OR) with a universal primer (a mixture of two primers, AGCAAAAGCAGG and AGCGAAAGCAGG) for all vRNA segments and then PCR-amplified using GoTaq Green Master Mix (Promega, Madison, WI) with strand-specific primers for either the HA (forward primer, AGCAAAAGCAGGGGAAAATAAAAAC; reverse primer, AGTAGAAACAAGGGTGTTTTTCCTT) or NP vRNA segment (forward primer, AGCAAAAGCAGGGTAGATAATCACTC; reverse primer, AGTAGAAACAAGGGTATTTTTCTTT). .. Viral growth kinetics HA-MDCK cells cultured in 12-well plates were infected with each virus at an MOI of 0.01 and incubated in MEM containing 0.3% bovine serum albumin at 37 °C.

    Construct:

    Article Title: The Unstructured Paramyxovirus Nucleocapsid Protein Tail Domain Modulates Viral Pathogenesis through Regulation of Transcriptase Activity
    Article Snippet: Metagenomic next-generation sequencing libraries were constructed as described previously ( ). .. Briefly, 20 μl of extracted RNA was reverse transcribed using SuperScript III reverse transcriptase (Thermo), and second-strand synthesis was performed using Sequenase v2.0 (Agilent). cDNA was purified using DNA Clean and Concentrator-5 (Zymo) and subjected to Nextera XT tagmentation (Illumina) followed by 19 cycles of PCR amplification and a 0.8× Ampure XP cleanup (Beckman Coulter).

    cDNA Library Assay:

    Article Title: Selective termination of lnc RNA transcription promotes heterochromatin silencing and cell differentiation
    Article Snippet: After incubation overnight at 20°C, ligated RNA was purified (Absolutely RNA kit, Stratagene) and reverse‐transcribed (Superscript III Reverse Transcriptase, Invitrogen). .. PCR amplification of the cDNA library was performed using Phusion polymerase (NEB).

    Chromatin Immunoprecipitation:

    Article Title: Selective termination of lnc RNA transcription promotes heterochromatin silencing and cell differentiation
    Article Snippet: Paragraph title: RNA‐IP and chromatin‐IP ... After incubation overnight at 20°C, ligated RNA was purified (Absolutely RNA kit, Stratagene) and reverse‐transcribed (Superscript III Reverse Transcriptase, Invitrogen).

    Plasmid Preparation:

    Article Title: Imaging cellulose synthase motility during primary cell wall synthesis in the grass Brachypodium distachyon
    Article Snippet: Construction of mEGFP-BdCESA transgenic lines Total RNA was extracted from B. distachyon tissue (7-day-old whole seedlings) and reverse transcribed into cDNA with Invitrogen SuperScript III Reverse Transcriptase. .. A multi-site Gateway reaction united the mEGFP and the CESA coding sequences in the plant expression vector pIPKb002 , in which expression of the tagged CESA genes is driven by a ubiquitin promoter from Zea mays .

    Article Title: Importance of the 1+7 configuration of ribonucleoprotein complexes for influenza A virus genome packaging
    Article Snippet: The extracted vRNAs were digested using an RNase-free DNase Set (Qiagen) according to the manufacturer′s instructions to eliminate any residual transfected plasmid DNA. .. Each vRNA was reverse-transcribed using SuperScript III Reverse Transcriptase (Invitrogen, Eugene, OR) with a universal primer (a mixture of two primers, AGCAAAAGCAGG and AGCGAAAGCAGG) for all vRNA segments and then PCR-amplified using GoTaq Green Master Mix (Promega, Madison, WI) with strand-specific primers for either the HA (forward primer, AGCAAAAGCAGGGGAAAATAAAAAC; reverse primer, AGTAGAAACAAGGGTGTTTTTCCTT) or NP vRNA segment (forward primer, AGCAAAAGCAGGGTAGATAATCACTC; reverse primer, AGTAGAAACAAGGGTATTTTTCTTT).

    Real-time Polymerase Chain Reaction:

    Article Title: Transcriptome analysis reveals a comprehensive insect resistance response mechanism in cotton to infestation by the phloem feeding insect Bemisia tabaci (whitefly)
    Article Snippet: First‐strand cDNA was synthesized from 3 μg of total RNA using SuperScript III Reverse Transcriptase (Invitrogen) in accordance with the manufacturer's instructions and reverse transcribed into cDNA followed by 50× dilution. .. The qRT‐PCR reactions were performed on an Applied Biosystem 7500 real‐time PCR system (Applied Biosystem, Foster City, CA) for 2 min at 95 °C, followed by 40 cycles for 5 s at 95 °C and 35 s at 60 °C.

    Article Title: Telomeres in ICF syndrome cells are vulnerable to DNA damage due to elevated DNA:RNA hybrids
    Article Snippet: .. Total RNA was reverse transcribed at 55 °C with SuperScript III reverse transcriptase (Invitrogen) using a β-actin-specific primer (5′-AGTCCGCCTAGAAGCATTTG-3′) and a TERRA-specific primer composed from five telomere-hexameric repeat ((CCCTAA)5 ) . cDNAs were then analysed with the same primers used for DRIP ( ). qRT-PCR was carried out on an Applied Biosystems StepOnePlus Real-Time PCR system with Fast SYBR Green Master Mix (AB-4385612, Applied Biosystems). ..

    Article Title: Ultrasensitive Response of Developing Myxococcus xanthus to the Addition of Nutrient Medium Correlates with the Level of MrpC
    Article Snippet: Total RNA (1 μg) was used to synthesize cDNA with Superscript III reverse transcriptase (Lifetech) and random primers (Promega), according to the manufacturer's instructions. .. Quantitative PCR (qPCR) was performed as described previously ( ).

    Article Title: Brain-Derived Neurotrophic Factor Induces Matrix Metalloproteinase 9 Expression in Neurons via the Serum Response Factor/c-Fos Pathway
    Article Snippet: Paragraph title: RNA preparation and quantitative real-time PCR. ... RNA was reverse transcribed with the SuperScript III reverse transcriptase (Invitrogen) according to the manufacturer's instructions.

    RNA Extraction:

    Article Title: Telomeres in ICF syndrome cells are vulnerable to DNA damage due to elevated DNA:RNA hybrids
    Article Snippet: Paragraph title: RNA extraction and qRT-PCR ... Total RNA was reverse transcribed at 55 °C with SuperScript III reverse transcriptase (Invitrogen) using a β-actin-specific primer (5′-AGTCCGCCTAGAAGCATTTG-3′) and a TERRA-specific primer composed from five telomere-hexameric repeat ((CCCTAA)5 ) . cDNAs were then analysed with the same primers used for DRIP ( ). qRT-PCR was carried out on an Applied Biosystems StepOnePlus Real-Time PCR system with Fast SYBR Green Master Mix (AB-4385612, Applied Biosystems).

    Article Title: Ultrasensitive Response of Developing Myxococcus xanthus to the Addition of Nutrient Medium Correlates with the Level of MrpC
    Article Snippet: Paragraph title: RNA extraction and analysis. ... Total RNA (1 μg) was used to synthesize cDNA with Superscript III reverse transcriptase (Lifetech) and random primers (Promega), according to the manufacturer's instructions.

    Agarose Gel Electrophoresis:

    Article Title: Brain-Derived Neurotrophic Factor Induces Matrix Metalloproteinase 9 Expression in Neurons via the Serum Response Factor/c-Fos Pathway
    Article Snippet: RNA was reverse transcribed with the SuperScript III reverse transcriptase (Invitrogen) according to the manufacturer's instructions. .. Quantitative real-time PCRs were performed using TaqMan Fast Advanced PCR Master Mix (Applied Biosystems) in an Applied Biosystems 7900HT fast real-time PCR system using the following cycling conditions: 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Additionally exemplary products were also visualized on agarose gel.

    Transgenic Assay:

    Article Title: Imaging cellulose synthase motility during primary cell wall synthesis in the grass Brachypodium distachyon
    Article Snippet: .. Construction of mEGFP-BdCESA transgenic lines Total RNA was extracted from B. distachyon tissue (7-day-old whole seedlings) and reverse transcribed into cDNA with Invitrogen SuperScript III Reverse Transcriptase. ..

    Article Title: Identification of a Peptide Inhibitor of the RPM-1·FSN-1 Ubiquitin Ligase Complex *
    Article Snippet: The 9 domains (D1–9) and subdomains (D5a, -b, and -c) of RPM-1 were amplified by RT-PCR from C. elegans total RNA using Superscript III reverse transcriptase (Invitrogen). cDNAs were inserted into pCR8 Topo GY and sequenced to ensure they were mutation-free. .. For transgenic expression of RIP (D5c) in C. elegans , pBG-GY134 (Prgef-1 FLAG GY) was recombined with pBG-GY349 (pCR8 Topo GY RIP (D5c)) to generate pBG-GY440 (Prgef-1 FLAG::RIP (D5c)). pCZ161 encoding full-length RPM-1::GFP driven by its native promoter was engineered to contain a point mutation D2214A (pBG-190).

    Ethanol Precipitation:

    Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
    Article Snippet: The pellets were washed four times, and bound RNA was isolated by ethanol precipitation. .. To detect bound MajSAT RNA, 1 μg of precipitated RNA and 5% input were reverse transcribed to cDNA using SuperScript III Reverse Transcriptase (Invitrogen), and semi-quantitative RT-PCR was performed using Mighty Amp DNA polymerase (TaKaRa).

    Next-Generation Sequencing:

    Article Title: The Unstructured Paramyxovirus Nucleocapsid Protein Tail Domain Modulates Viral Pathogenesis through Regulation of Transcriptase Activity
    Article Snippet: Metagenomic next-generation sequencing libraries were constructed as described previously ( ). .. Briefly, 20 μl of extracted RNA was reverse transcribed using SuperScript III reverse transcriptase (Thermo), and second-strand synthesis was performed using Sequenase v2.0 (Agilent). cDNA was purified using DNA Clean and Concentrator-5 (Zymo) and subjected to Nextera XT tagmentation (Illumina) followed by 19 cycles of PCR amplification and a 0.8× Ampure XP cleanup (Beckman Coulter).

    Quantitation Assay:

    Article Title: Telomeres in ICF syndrome cells are vulnerable to DNA damage due to elevated DNA:RNA hybrids
    Article Snippet: RNA concentrations were determined by Qubit fluorometric quantitation. .. Total RNA was reverse transcribed at 55 °C with SuperScript III reverse transcriptase (Invitrogen) using a β-actin-specific primer (5′-AGTCCGCCTAGAAGCATTTG-3′) and a TERRA-specific primer composed from five telomere-hexameric repeat ((CCCTAA)5 ) . cDNAs were then analysed with the same primers used for DRIP ( ). qRT-PCR was carried out on an Applied Biosystems StepOnePlus Real-Time PCR system with Fast SYBR Green Master Mix (AB-4385612, Applied Biosystems).

    Concentration Assay:

    Article Title: Brain-Derived Neurotrophic Factor Induces Matrix Metalloproteinase 9 Expression in Neurons via the Serum Response Factor/c-Fos Pathway
    Article Snippet: RNA concentration was calculated from the absorbance at 260 nm, and the purity of the RNA was determined by the 260/280-nm absorbance ratio. .. RNA was reverse transcribed with the SuperScript III reverse transcriptase (Invitrogen) according to the manufacturer's instructions.

    High Throughput Screening Assay:

    Article Title: Selective termination of lnc RNA transcription promotes heterochromatin silencing and cell differentiation
    Article Snippet: RNA‐IP experiments coupled to high‐throughput sequencing were conducted in duplicates. .. After incubation overnight at 20°C, ligated RNA was purified (Absolutely RNA kit, Stratagene) and reverse‐transcribed (Superscript III Reverse Transcriptase, Invitrogen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher superscript iii rnase h reverse transcription
    Superscript Iii Rnase H Reverse Transcription, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii rnase h reverse transcription/product/Thermo Fisher
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    superscript iii rnase h reverse transcription - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results