Structured Review

Meridian Life Science superscript iii reverse transcriptase
P2X receptor expression in LAD2 cells and HLMCs. <t>RT-PCR</t> on total RNA isolated from LAD2 cells and HMLCs. Data for HLMC are representative of similar results obtained from <t>three</t> donors. Both types of human mast cells revealed the presence of P2X1, P2X4
Superscript Iii Reverse Transcriptase, supplied by Meridian Life Science, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/superscript iii reverse transcriptase/product/Meridian Life Science
Average 93 stars, based on 2 article reviews
Price from $9.99 to $1999.99
superscript iii reverse transcriptase - by Bioz Stars, 2020-04
93/100 stars

Images

1) Product Images from "Functional evidence for the expression of P2X1, P2X4 and P2X7 receptors in human lung mast cells"

Article Title: Functional evidence for the expression of P2X1, P2X4 and P2X7 receptors in human lung mast cells

Journal: British Journal of Pharmacology

doi: 10.1111/j.1476-5381.2009.00287.x

P2X receptor expression in LAD2 cells and HLMCs. RT-PCR on total RNA isolated from LAD2 cells and HMLCs. Data for HLMC are representative of similar results obtained from three donors. Both types of human mast cells revealed the presence of P2X1, P2X4
Figure Legend Snippet: P2X receptor expression in LAD2 cells and HLMCs. RT-PCR on total RNA isolated from LAD2 cells and HMLCs. Data for HLMC are representative of similar results obtained from three donors. Both types of human mast cells revealed the presence of P2X1, P2X4

Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Isolation

Related Articles

Negative Control:

Article Title: Functional evidence for the expression of P2X1, P2X4 and P2X7 receptors in human lung mast cells
Article Snippet: .. For negative control, SuperScript™III Reverse Transcriptase was replaced with H2 O. PCR reactions (30 cycles) using BIOTAQ™ DNA Polymerase (1.25 unit·reaction−1 ) were then performed as instructed by the manufacturer (Bioline, London, UK) with 1 µL cDNA or 1 µL negative control. .. The sequence of the primers used for PCR amplifications on LAD2 cDNA were as follows: P2X1 [annealing temperature (AT) 58°C] forward 5′-CGTCATCGGGTGGGTGTTTCTCTA-3′, reverse 5′-AGGGCGCGGGATGTCGTCA-3′; P2X2 (AT 59°C) forward 5′-GGGCCCCGAGAGCTCCATCATC-3′, reverse 5′-GCAGGCAGGTCCAGGTCACAGTCC-3′; P2X3 (58°C)forward 5′-ACTGGCCGCTGCGTGAACTACA-3′, reverse 5′-CACGTCGAAGCGGATGCCAAAAG-3′; P2X4 (58°C) forward 5′-CGGCACCCACAGCAACGGAGTCT-3′, reverse 5′-TGTATCGAGGCGGCGGAAGGAGTA-3′; P2X5 (AT 55°C) forward 5′-GGCCCCAAGAACCACTACTGC-3′, reverse 5′-CCTCGGCCTCCTGGGAACTGTCT-3′; P2X6 (58°C) forward 5′-AGCCCCTACTGTCCCGTGTTCC-3′, reverse 5′-GCCTTGGCCTCCTCATACTTTGTC-3′; P2X7 (55°C) forward 5′-CCGGCCACAACTACACCACGAG-3′, reverse 5′-GGCCAGACCGAAGTAGGAGAGG-3′; human β-actin (57°C) forward 5′-TGGTGGGCATGGGTCAGAAG-3′, reverse 5′-GTCCCGGCCAGCCAGGTCCAG-3′.

Amplification:

Article Title: Alternative Mechanisms for Fast Na+/Ca2+ Signaling in Eukaryotes via a Novel Class of Single-Domain Voltage-Gated Channels
Article Snippet: .. To confirm correct prediction of intron/exon boundaries for this gene model, the predicted ORF of PtEUKCATA1 was amplified from cDNA made from a liquid culture of P. tricornutum CCAP1055/1 (using the primers: Pt43878_F: GCCATCCGATGATGCAAGGAATCGTGGAG and Pt43878_R: AAACATTCTCGGGGACTTCTC). cDNA was synthesized using SuperScript III reverse transcriptase from RNA extracted using ISOLATE II RNA Mini Kit (Bioline) following the manufacturer’s instructions. .. Codon-optimized versions of the transcripts were then synthesized (GenScript, Piscataway, NJ) for characterization in human expression systems, and sub-cloned into pcDNA3.1-C-eGFP using HindIII and BamHI.

Synthesized:

Article Title: Alternative Mechanisms for Fast Na+/Ca2+ Signaling in Eukaryotes via a Novel Class of Single-Domain Voltage-Gated Channels
Article Snippet: .. To confirm correct prediction of intron/exon boundaries for this gene model, the predicted ORF of PtEUKCATA1 was amplified from cDNA made from a liquid culture of P. tricornutum CCAP1055/1 (using the primers: Pt43878_F: GCCATCCGATGATGCAAGGAATCGTGGAG and Pt43878_R: AAACATTCTCGGGGACTTCTC). cDNA was synthesized using SuperScript III reverse transcriptase from RNA extracted using ISOLATE II RNA Mini Kit (Bioline) following the manufacturer’s instructions. .. Codon-optimized versions of the transcripts were then synthesized (GenScript, Piscataway, NJ) for characterization in human expression systems, and sub-cloned into pcDNA3.1-C-eGFP using HindIII and BamHI.

Article Title: A radial axis defined by semaphorin-to-neuropilin signaling controls pancreatic islet morphogenesis
Article Snippet: .. To assess plexin family gene expression by RT-PCR, RNA was isolated from microdissected whole E15.5 wild-type mouse pancreas (CD1 background) using the PicoPure RNA Isolation Kit (Life Technologies). cDNA was synthesized using Superscript III reverse transcriptase, and gene expression was assessed by PCR using BioMix Red (Bioline) and the primer sets indicated in . .. RNA in situ hybridization was performed using the RNAscope system (Advanced Cell Diagnostics, ACD).

Isolation:

Article Title: Functional evidence for the expression of P2X1, P2X4 and P2X7 receptors in human lung mast cells
Article Snippet: Total RNA from LAD2 cells and HLMC from three donors were isolated using QIAshredder and RNeasy kit (Qiagen, Crawley, UK). .. For negative control, SuperScript™III Reverse Transcriptase was replaced with H2 O. PCR reactions (30 cycles) using BIOTAQ™ DNA Polymerase (1.25 unit·reaction−1 ) were then performed as instructed by the manufacturer (Bioline, London, UK) with 1 µL cDNA or 1 µL negative control.

Article Title: A radial axis defined by semaphorin-to-neuropilin signaling controls pancreatic islet morphogenesis
Article Snippet: .. To assess plexin family gene expression by RT-PCR, RNA was isolated from microdissected whole E15.5 wild-type mouse pancreas (CD1 background) using the PicoPure RNA Isolation Kit (Life Technologies). cDNA was synthesized using Superscript III reverse transcriptase, and gene expression was assessed by PCR using BioMix Red (Bioline) and the primer sets indicated in . .. RNA in situ hybridization was performed using the RNAscope system (Advanced Cell Diagnostics, ACD).

RNA Extraction:

Article Title: A radial axis defined by semaphorin-to-neuropilin signaling controls pancreatic islet morphogenesis
Article Snippet: RNA was purified using the PicoPure RNA extraction system (Life Technologies), cDNA was synthesized using Superscript III reverse transcriptase (Life Technologies), and gene expression was measured using qPCR with Taqman probes and an ABI7500 qPCR system (Applied Biosystems). .. To assess plexin family gene expression by RT-PCR, RNA was isolated from microdissected whole E15.5 wild-type mouse pancreas (CD1 background) using the PicoPure RNA Isolation Kit (Life Technologies). cDNA was synthesized using Superscript III reverse transcriptase, and gene expression was assessed by PCR using BioMix Red (Bioline) and the primer sets indicated in .

Quantitative RT-PCR:

Article Title: A radial axis defined by semaphorin-to-neuropilin signaling controls pancreatic islet morphogenesis
Article Snippet: Gene expression analysis using quantitative RT-PCR was performed using the following Taqman probes (Life Technologies): Sema3a , Mm00436469; Sema3d , Mm01224783; Pecam , Mm01242584; S100a4 , Mm00803372; vimentin, Mm01333430; Acta2 , Mm00725412; Syp , Mm00436850; Sox9 , Mm00448840; Ins2 , Mm00731595; Plxna3 , Mm00501170; Plxnb1 , Mm00555359; and Plxnb2 , Mm00507118 . .. To assess plexin family gene expression by RT-PCR, RNA was isolated from microdissected whole E15.5 wild-type mouse pancreas (CD1 background) using the PicoPure RNA Isolation Kit (Life Technologies). cDNA was synthesized using Superscript III reverse transcriptase, and gene expression was assessed by PCR using BioMix Red (Bioline) and the primer sets indicated in .

Article Title: GATA-3 controls T cell maintenance and proliferation downstream of TCR and cytokine signals
Article Snippet: .. Quantitative RT-PCR Total RNA was extracted from T cells using TRIzol reagent (Invitrogen) per manufacturer’s instructions, and was reverse-transcribed into c-DNA with Superscript III reverse transcriptase (Bioline). .. Quantitative PCR was performed on ABI9700 real-time PCR system with primer-probe sets purchased from Applied Biosystems.

Purification:

Article Title: A radial axis defined by semaphorin-to-neuropilin signaling controls pancreatic islet morphogenesis
Article Snippet: RNA was purified using the PicoPure RNA extraction system (Life Technologies), cDNA was synthesized using Superscript III reverse transcriptase (Life Technologies), and gene expression was measured using qPCR with Taqman probes and an ABI7500 qPCR system (Applied Biosystems). .. To assess plexin family gene expression by RT-PCR, RNA was isolated from microdissected whole E15.5 wild-type mouse pancreas (CD1 background) using the PicoPure RNA Isolation Kit (Life Technologies). cDNA was synthesized using Superscript III reverse transcriptase, and gene expression was assessed by PCR using BioMix Red (Bioline) and the primer sets indicated in .

Real-time Polymerase Chain Reaction:

Article Title: A radial axis defined by semaphorin-to-neuropilin signaling controls pancreatic islet morphogenesis
Article Snippet: RNA was purified using the PicoPure RNA extraction system (Life Technologies), cDNA was synthesized using Superscript III reverse transcriptase (Life Technologies), and gene expression was measured using qPCR with Taqman probes and an ABI7500 qPCR system (Applied Biosystems). .. To assess plexin family gene expression by RT-PCR, RNA was isolated from microdissected whole E15.5 wild-type mouse pancreas (CD1 background) using the PicoPure RNA Isolation Kit (Life Technologies). cDNA was synthesized using Superscript III reverse transcriptase, and gene expression was assessed by PCR using BioMix Red (Bioline) and the primer sets indicated in .

Article Title: GATA-3 controls T cell maintenance and proliferation downstream of TCR and cytokine signals
Article Snippet: Quantitative RT-PCR Total RNA was extracted from T cells using TRIzol reagent (Invitrogen) per manufacturer’s instructions, and was reverse-transcribed into c-DNA with Superscript III reverse transcriptase (Bioline). .. Quantitative PCR was performed on ABI9700 real-time PCR system with primer-probe sets purchased from Applied Biosystems.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Functional evidence for the expression of P2X1, P2X4 and P2X7 receptors in human lung mast cells
Article Snippet: Paragraph title: RT-PCR ... For negative control, SuperScript™III Reverse Transcriptase was replaced with H2 O. PCR reactions (30 cycles) using BIOTAQ™ DNA Polymerase (1.25 unit·reaction−1 ) were then performed as instructed by the manufacturer (Bioline, London, UK) with 1 µL cDNA or 1 µL negative control.

Article Title: A radial axis defined by semaphorin-to-neuropilin signaling controls pancreatic islet morphogenesis
Article Snippet: .. To assess plexin family gene expression by RT-PCR, RNA was isolated from microdissected whole E15.5 wild-type mouse pancreas (CD1 background) using the PicoPure RNA Isolation Kit (Life Technologies). cDNA was synthesized using Superscript III reverse transcriptase, and gene expression was assessed by PCR using BioMix Red (Bioline) and the primer sets indicated in . .. RNA in situ hybridization was performed using the RNAscope system (Advanced Cell Diagnostics, ACD).

Polymerase Chain Reaction:

Article Title: Functional evidence for the expression of P2X1, P2X4 and P2X7 receptors in human lung mast cells
Article Snippet: .. For negative control, SuperScript™III Reverse Transcriptase was replaced with H2 O. PCR reactions (30 cycles) using BIOTAQ™ DNA Polymerase (1.25 unit·reaction−1 ) were then performed as instructed by the manufacturer (Bioline, London, UK) with 1 µL cDNA or 1 µL negative control. .. The sequence of the primers used for PCR amplifications on LAD2 cDNA were as follows: P2X1 [annealing temperature (AT) 58°C] forward 5′-CGTCATCGGGTGGGTGTTTCTCTA-3′, reverse 5′-AGGGCGCGGGATGTCGTCA-3′; P2X2 (AT 59°C) forward 5′-GGGCCCCGAGAGCTCCATCATC-3′, reverse 5′-GCAGGCAGGTCCAGGTCACAGTCC-3′; P2X3 (58°C)forward 5′-ACTGGCCGCTGCGTGAACTACA-3′, reverse 5′-CACGTCGAAGCGGATGCCAAAAG-3′; P2X4 (58°C) forward 5′-CGGCACCCACAGCAACGGAGTCT-3′, reverse 5′-TGTATCGAGGCGGCGGAAGGAGTA-3′; P2X5 (AT 55°C) forward 5′-GGCCCCAAGAACCACTACTGC-3′, reverse 5′-CCTCGGCCTCCTGGGAACTGTCT-3′; P2X6 (58°C) forward 5′-AGCCCCTACTGTCCCGTGTTCC-3′, reverse 5′-GCCTTGGCCTCCTCATACTTTGTC-3′; P2X7 (55°C) forward 5′-CCGGCCACAACTACACCACGAG-3′, reverse 5′-GGCCAGACCGAAGTAGGAGAGG-3′; human β-actin (57°C) forward 5′-TGGTGGGCATGGGTCAGAAG-3′, reverse 5′-GTCCCGGCCAGCCAGGTCCAG-3′.

Article Title: A radial axis defined by semaphorin-to-neuropilin signaling controls pancreatic islet morphogenesis
Article Snippet: .. To assess plexin family gene expression by RT-PCR, RNA was isolated from microdissected whole E15.5 wild-type mouse pancreas (CD1 background) using the PicoPure RNA Isolation Kit (Life Technologies). cDNA was synthesized using Superscript III reverse transcriptase, and gene expression was assessed by PCR using BioMix Red (Bioline) and the primer sets indicated in . .. RNA in situ hybridization was performed using the RNAscope system (Advanced Cell Diagnostics, ACD).

Expressing:

Article Title: Alternative Mechanisms for Fast Na+/Ca2+ Signaling in Eukaryotes via a Novel Class of Single-Domain Voltage-Gated Channels
Article Snippet: Paragraph title: Synthesis of heterologous expression plasmids for HEK293 cells ... To confirm correct prediction of intron/exon boundaries for this gene model, the predicted ORF of PtEUKCATA1 was amplified from cDNA made from a liquid culture of P. tricornutum CCAP1055/1 (using the primers: Pt43878_F: GCCATCCGATGATGCAAGGAATCGTGGAG and Pt43878_R: AAACATTCTCGGGGACTTCTC). cDNA was synthesized using SuperScript III reverse transcriptase from RNA extracted using ISOLATE II RNA Mini Kit (Bioline) following the manufacturer’s instructions.

Article Title: A radial axis defined by semaphorin-to-neuropilin signaling controls pancreatic islet morphogenesis
Article Snippet: .. To assess plexin family gene expression by RT-PCR, RNA was isolated from microdissected whole E15.5 wild-type mouse pancreas (CD1 background) using the PicoPure RNA Isolation Kit (Life Technologies). cDNA was synthesized using Superscript III reverse transcriptase, and gene expression was assessed by PCR using BioMix Red (Bioline) and the primer sets indicated in . .. RNA in situ hybridization was performed using the RNAscope system (Advanced Cell Diagnostics, ACD).

Sequencing:

Article Title: Functional evidence for the expression of P2X1, P2X4 and P2X7 receptors in human lung mast cells
Article Snippet: For negative control, SuperScript™III Reverse Transcriptase was replaced with H2 O. PCR reactions (30 cycles) using BIOTAQ™ DNA Polymerase (1.25 unit·reaction−1 ) were then performed as instructed by the manufacturer (Bioline, London, UK) with 1 µL cDNA or 1 µL negative control. .. The sequence of the primers used for PCR amplifications on LAD2 cDNA were as follows: P2X1 [annealing temperature (AT) 58°C] forward 5′-CGTCATCGGGTGGGTGTTTCTCTA-3′, reverse 5′-AGGGCGCGGGATGTCGTCA-3′; P2X2 (AT 59°C) forward 5′-GGGCCCCGAGAGCTCCATCATC-3′, reverse 5′-GCAGGCAGGTCCAGGTCACAGTCC-3′; P2X3 (58°C)forward 5′-ACTGGCCGCTGCGTGAACTACA-3′, reverse 5′-CACGTCGAAGCGGATGCCAAAAG-3′; P2X4 (58°C) forward 5′-CGGCACCCACAGCAACGGAGTCT-3′, reverse 5′-TGTATCGAGGCGGCGGAAGGAGTA-3′; P2X5 (AT 55°C) forward 5′-GGCCCCAAGAACCACTACTGC-3′, reverse 5′-CCTCGGCCTCCTGGGAACTGTCT-3′; P2X6 (58°C) forward 5′-AGCCCCTACTGTCCCGTGTTCC-3′, reverse 5′-GCCTTGGCCTCCTCATACTTTGTC-3′; P2X7 (55°C) forward 5′-CCGGCCACAACTACACCACGAG-3′, reverse 5′-GGCCAGACCGAAGTAGGAGAGG-3′; human β-actin (57°C) forward 5′-TGGTGGGCATGGGTCAGAAG-3′, reverse 5′-GTCCCGGCCAGCCAGGTCCAG-3′.

Article Title: Alternative Mechanisms for Fast Na+/Ca2+ Signaling in Eukaryotes via a Novel Class of Single-Domain Voltage-Gated Channels
Article Snippet: The coding sequence for PtEUKCATA1 (protein id: 43878) was predicted by the JGI genome project for P. tricornutum . .. To confirm correct prediction of intron/exon boundaries for this gene model, the predicted ORF of PtEUKCATA1 was amplified from cDNA made from a liquid culture of P. tricornutum CCAP1055/1 (using the primers: Pt43878_F: GCCATCCGATGATGCAAGGAATCGTGGAG and Pt43878_R: AAACATTCTCGGGGACTTCTC). cDNA was synthesized using SuperScript III reverse transcriptase from RNA extracted using ISOLATE II RNA Mini Kit (Bioline) following the manufacturer’s instructions.

FACS:

Article Title: A radial axis defined by semaphorin-to-neuropilin signaling controls pancreatic islet morphogenesis
Article Snippet: Paragraph title: FACS and gene expression measurement ... To assess plexin family gene expression by RT-PCR, RNA was isolated from microdissected whole E15.5 wild-type mouse pancreas (CD1 background) using the PicoPure RNA Isolation Kit (Life Technologies). cDNA was synthesized using Superscript III reverse transcriptase, and gene expression was assessed by PCR using BioMix Red (Bioline) and the primer sets indicated in .