superscrip moloney murine leukemia virus reverse transcriptase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85

    Structured Review

    Thermo Fisher superscrip moloney murine leukemia virus reverse transcriptase
    Superscrip Moloney Murine Leukemia Virus Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscrip moloney murine leukemia virus reverse transcriptase/product/Thermo Fisher
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    superscrip moloney murine leukemia virus reverse transcriptase - by Bioz Stars, 2020-05
    85/100 stars

    Images

    Related Articles

    Isolation:

    Article Title: In-vitro activation of cytotoxic T lymphocytes by fusion of mouse hepatocellular carcinoma cells and lymphotactin gene-modified dendritic cells
    Article Snippet: .. Total cellular RNA was isolated from cells using the TRIzol reagent (Life Technologies) according to the manufacturer’s instructions. cDNA was prepared from total RNA using a hexanucleotide random primer and SuperScrip Moloney murine leukemia virus reverse transcriptase (Life Technologies). .. PCR primers for the amplification of mouse lymphotactin and beta-actin used are as follows (lymphotactin forward primer: 5'TGGGGACTGAAGTCCTAGAAG3'; reverse primer: 5'TTACCCAGTCAGGGTTACTGCTGCTGTG3', with the product size of 300 bp.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher superscript ii reverse transcriptase
    Superscript Ii Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 572 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript ii reverse transcriptase/product/Thermo Fisher
    Average 99 stars, based on 572 article reviews
    Price from $9.99 to $1999.99
    superscript ii reverse transcriptase - by Bioz Stars, 2020-05
    99/100 stars
      Buy from Supplier

    Image Search Results