15517 a niger atcc 9642 c albicans atcc 10251 e coli 0157h7 atcc 43888 l monocytogenes atcc 13932 s typhimurium atcc14028 s aureus atcc 29213 streptococcus mutans ua159 atcc 700610 penicillium carneum ibt 14042  (ATCC)

Journal: Molecules

Article Title: Bioactive Natural Products for Chemical Control of Microorganisms: Scientific Prospecting (2001–2021) and Systematic Review

doi: 10.3390/molecules27185917

Figure Lengend Snippet: Information extracted from relevant articles on bioactive natural products for microbial control.

Article Snippet: 13 , Propolis , , E , Water Dimethyl sulfoxide Ethanol Propylene glycol , Ultrasonication Percolation , - , - , Ellagic acid Chrysin Myricetin Quercetin , Aspergillus flavus ATCC 15517 A. niger ATCC 9642 C. albicans ATCC 10251 E. coli 0157H7 ATCC 43888 L. monocytogenes ATCC 13932 S. Typhimurium ATCC14028 S. aureus ATCC 29213 Streptococcus mutans UA159 ATCC 700610 Penicillium carneum IBT 14042 , S , [ ] .

Techniques: Inhibition

Journal: Frontiers in Cellular and Infection Microbiology

Article Title: Effect of endocrine disruptors on bacterial virulence

doi: 10.3389/fcimb.2023.1292233

Figure Lengend Snippet: Overview of the effects of endocrine disruptors on bacterial virulence reported in the literature.

Article Snippet: , Streptococcus mutans UA159 ATCC 700610 , TCS- Methacrylate (TM) monomer, which was developed and incorporated into an experimental resin composite (TEGDMA) Cell metabolism–XTT metabolic assay Biofilm characteristic analysis (CLSM) Live/Dead Quantitative virulence gene expression , • Decreased cellular metabolism of S. mutans on the TM-containing composite, compared with the TM-free composite • Decrease in biovolume, average thickness, roughness and surface values of the biofilm formed on the composite containing TM compared to that which does not contain it • the contact time (4 h or 24 h) between TM-composite and S. mutans down-regulated the gbpB and covR and up-regulated the gtfC gene expression , ( ) .

Techniques: Bacteria, Membrane, Permeability, Expressing, Infection, In Vivo, Cell Adhesion Assay, Cell Surface Hydrophobicity, Plasmid Preparation, Transformation Assay, Concentration Assay, Mutagenesis, In Vitro, Mouse Assay, Activity Assay, Staining, Cytometry, Metabolic Assay

Journal: Biomedicines

Article Title: Anti-Microbial Activity of Phytocannabinoids and Endocannabinoids in the Light of Their Physiological and Pathophysiological Roles

doi: 10.3390/biomedicines10030631

Figure Lengend Snippet: Examples of Cannabis sativa constituents that have been documented to possess anti-bacterial, anti-fungal, and/or anti-protozoal activities *.

Article Snippet: Cannabigerol (CBG) , MIC: 0.5 μg/mL against Staphylococcus aureus ATCC 25923 MIC: 1 μg/mL against Staphylococcus aureus SA-1199B (NorA overexpression) MIC: 2 μg/mL against Staphylococcus aureus EMRSA-15 MIC: 1 μg/mL against Staphylococcus aureus EMRSA-16 MIC: 2 μg/mL against MRSA USA300 MIC: 2–4 μg/mL against various MRSA clinical isolates, with some requiring > 8 μg/mL MIC: 4–8 μg/mL against MRSA ATCC 43300 MIC: 2.5 μg/mL against Streptococcus mutans UA159 ATCC 700610 MIC: 1 μg/mL against Streptococcus sanguis ATCC 10556 MIC: 5 μg/mL against Streptococcus sobrinus ATCC 27351 MIC: 5 μg/mL against Streptococcus salivarius ATCC 25975 MIC: 1–2 μg/mL against Neisseria gonorrhoeae ATCC 19424 IC 50 : 15 μg/mL against Mycobacterium intracellulare Anti-biofilm effect : MBIC: 2–4 μg/mL against biofilm formation by MRSA 4 μg/mL eradicated preformed biofilms of MRSA MBIC: 2.5 μg/mL against biofilm formation by Streptococcus mutans UA159 ATCC 70061 Anti-quorum sensing effect 1 μg/mL CBG inhibited quorum sensing in Vibrio harveyi BB120. , [ , , , , , , ] .

Techniques: Activity Assay, Over Expression

Journal: Molecular oral microbiology

Article Title: The S. mutans mntE gene encodes a manganese efflux transporter

doi: 10.1111/omi.12286

Figure Lengend Snippet: Bacterial strains and plasmids used in this study

Article Snippet: Primers were ordered and obtained from Eurofins Genomics. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Description or relevant characteristics Source or reference Strains E. coli DH5α F- supE44 Δ lacU169 Φ80 dlacZ Δ M15 hsdR17 recA1 endA1 gyrA96 thi-1 relA Hanahan (1983 ) S. gordonii DL1 Wild-type H2O2-producing primary colonizer Kreth, Zhang, and Herzberg (2008) S. mutans UA159 Wild-type, serotype c ATCC 700610 S. mutans GMS284 UA159-derived, sloC-deficient, Em r Crepps et al. (2016) S. mutans GMS3000 UA159-derived, SMU_1176- deficient, Em r This study S. mutans GMS3001 GMS3000 containing wild-type SMU_1176 gene in trans on plasmid pJO, Em r , Sp r This study S. mutans GMS584 UA159-derived, sloR-deficient, Em r Rolerson et al. (2006) S. mutans SMCitM UA159-derived, CitM-deficient, Em r Korithoski, Krastel, and Cvitkovitch (2005) Plasmids pDL277 E. coli-streptococcal shuttle vector, Sp r LeBlanc, Lee, and Abu-Al-Jaibat (1992) pJO pDL277 derived, harbors wild-type SMU_1176 gene, Sp r This study Open in a separate window Bacterial strains and plasmids used in this study table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Assay and primer name Nucleotide sequence (5′ to 3′) Annealing temp (°C) Amplicon size (bp) PCR ligation mutagenesis YeaB.P1.F GCTGCAGCTTACAT CATCGC 65 863 YeaB.P2.R GGCGCGCCGACGCCGAGCAAGTTTAAGGT YeaB.P3.F GGCCGGCCGGTCGCTCAAGTGAAGCAAA 64 686 YeaB.P4.R GGCAAAGCTTTAGGTGCTCA Cloning YeaBP-1F.

Techniques: Plasmid Preparation, Derivative Assay

Journal: Molecular oral microbiology

Article Title: The S. mutans mntE gene encodes a manganese efflux transporter

doi: 10.1111/omi.12286

Figure Lengend Snippet: SMU_1176-deficient GMS3000 is sensitive to MnSO4 challenge. Notably, the wild-type UA159 strain, the SloC-deficient GMS284 manganese import mutant, and the SMU_1176-complemented GMS3001 strain show no sensitivity to MnSO4 challenge at any of the test concentrations. In contrast, growth of the GMS3000 SMU_1176 insertion-deletion mutant is compromised in the presence of 125 μM MnSO4, and inhibited at 250 μM, consistent with the sensitivity of this mutant to manganese. All cultures were grown for 16–18 hr in 14 ml of THYE and appropriate antibiotic selection at 37°C with 5% CO2. The cells were pelleted, resuspended, and normalized by adjusting the OD600nm to 0.1A ± 0.005A. The cell suspensions were then supplemented with MnSO4 after which 8 μl of each culture was plated onto the surface of THYE agar and incubated for 16–18 hr at 37°C and 5% CO2

Article Snippet: Primers were ordered and obtained from Eurofins Genomics. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Description or relevant characteristics Source or reference Strains E. coli DH5α F- supE44 Δ lacU169 Φ80 dlacZ Δ M15 hsdR17 recA1 endA1 gyrA96 thi-1 relA Hanahan (1983 ) S. gordonii DL1 Wild-type H2O2-producing primary colonizer Kreth, Zhang, and Herzberg (2008) S. mutans UA159 Wild-type, serotype c ATCC 700610 S. mutans GMS284 UA159-derived, sloC-deficient, Em r Crepps et al. (2016) S. mutans GMS3000 UA159-derived, SMU_1176- deficient, Em r This study S. mutans GMS3001 GMS3000 containing wild-type SMU_1176 gene in trans on plasmid pJO, Em r , Sp r This study S. mutans GMS584 UA159-derived, sloR-deficient, Em r Rolerson et al. (2006) S. mutans SMCitM UA159-derived, CitM-deficient, Em r Korithoski, Krastel, and Cvitkovitch (2005) Plasmids pDL277 E. coli-streptococcal shuttle vector, Sp r LeBlanc, Lee, and Abu-Al-Jaibat (1992) pJO pDL277 derived, harbors wild-type SMU_1176 gene, Sp r This study Open in a separate window Bacterial strains and plasmids used in this study table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Assay and primer name Nucleotide sequence (5′ to 3′) Annealing temp (°C) Amplicon size (bp) PCR ligation mutagenesis YeaB.P1.F GCTGCAGCTTACAT CATCGC 65 863 YeaB.P2.R GGCGCGCCGACGCCGAGCAAGTTTAAGGT YeaB.P3.F GGCCGGCCGGTCGCTCAAGTGAAGCAAA 64 686 YeaB.P4.R GGCAAAGCTTTAGGTGCTCA Cloning YeaBP-1F.

Techniques: Mutagenesis, Selection, Incubation

Journal: Molecular oral microbiology

Article Title: The S. mutans mntE gene encodes a manganese efflux transporter

doi: 10.1111/omi.12286

Figure Lengend Snippet: The results of metal ion sensitivity assays support a role for the SMU_1176 gene product in Mn 2+ homeostasis

Article Snippet: Primers were ordered and obtained from Eurofins Genomics. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Description or relevant characteristics Source or reference Strains E. coli DH5α F- supE44 Δ lacU169 Φ80 dlacZ Δ M15 hsdR17 recA1 endA1 gyrA96 thi-1 relA Hanahan (1983 ) S. gordonii DL1 Wild-type H2O2-producing primary colonizer Kreth, Zhang, and Herzberg (2008) S. mutans UA159 Wild-type, serotype c ATCC 700610 S. mutans GMS284 UA159-derived, sloC-deficient, Em r Crepps et al. (2016) S. mutans GMS3000 UA159-derived, SMU_1176- deficient, Em r This study S. mutans GMS3001 GMS3000 containing wild-type SMU_1176 gene in trans on plasmid pJO, Em r , Sp r This study S. mutans GMS584 UA159-derived, sloR-deficient, Em r Rolerson et al. (2006) S. mutans SMCitM UA159-derived, CitM-deficient, Em r Korithoski, Krastel, and Cvitkovitch (2005) Plasmids pDL277 E. coli-streptococcal shuttle vector, Sp r LeBlanc, Lee, and Abu-Al-Jaibat (1992) pJO pDL277 derived, harbors wild-type SMU_1176 gene, Sp r This study Open in a separate window Bacterial strains and plasmids used in this study table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Assay and primer name Nucleotide sequence (5′ to 3′) Annealing temp (°C) Amplicon size (bp) PCR ligation mutagenesis YeaB.P1.F GCTGCAGCTTACAT CATCGC 65 863 YeaB.P2.R GGCGCGCCGACGCCGAGCAAGTTTAAGGT YeaB.P3.F GGCCGGCCGGTCGCTCAAGTGAAGCAAA 64 686 YeaB.P4.R GGCAAAGCTTTAGGTGCTCA Cloning YeaBP-1F.

Techniques: Inhibition

Journal: Molecular oral microbiology

Article Title: The S. mutans mntE gene encodes a manganese efflux transporter

doi: 10.1111/omi.12286

Figure Lengend Snippet: 54Mn accumulates in S. mutans GMS3000, an SMU_1176 insertion-deletion mutant. Intracellular concentrations of 54Mn were significantly greater in GMS3000 compared to those in UA159, GMS284, and GMS3001, consistent with a role for the SMU_1176 gene product as Mn2+ efflux protein. Overnight cultures of UA159, GMS284, GMS3000, and GMS3001 were normalized to ±0.005A, and grown in the presence of 54Mn (experimental) or 0.5 M HCl (control) for 16–18 hr. The cell pellets and supernatants were separated by centrifugation, and counts per minute (CPM) were determined by liquid scintillation counting. The number of colony forming units (CFUs) was determined by plating serial dilutions of the control cultures in parallel. The CPM of the cell pellets were divided by the CPM of the supernatants, and that value was divided by the number of CFUs to normalize the 54Mn transport data. Error bars denote the standard deviation about the mean. Variation in the experimental design includes some inevitable loss of cell associated 54Mn during the wash steps. Nevertheless, ANOVA analysis with Tukey’s test revealed significant differences between GMS3000 and each of the other three test strains (p < .01). N = 3

Article Snippet: Primers were ordered and obtained from Eurofins Genomics. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Description or relevant characteristics Source or reference Strains E. coli DH5α F- supE44 Δ lacU169 Φ80 dlacZ Δ M15 hsdR17 recA1 endA1 gyrA96 thi-1 relA Hanahan (1983 ) S. gordonii DL1 Wild-type H2O2-producing primary colonizer Kreth, Zhang, and Herzberg (2008) S. mutans UA159 Wild-type, serotype c ATCC 700610 S. mutans GMS284 UA159-derived, sloC-deficient, Em r Crepps et al. (2016) S. mutans GMS3000 UA159-derived, SMU_1176- deficient, Em r This study S. mutans GMS3001 GMS3000 containing wild-type SMU_1176 gene in trans on plasmid pJO, Em r , Sp r This study S. mutans GMS584 UA159-derived, sloR-deficient, Em r Rolerson et al. (2006) S. mutans SMCitM UA159-derived, CitM-deficient, Em r Korithoski, Krastel, and Cvitkovitch (2005) Plasmids pDL277 E. coli-streptococcal shuttle vector, Sp r LeBlanc, Lee, and Abu-Al-Jaibat (1992) pJO pDL277 derived, harbors wild-type SMU_1176 gene, Sp r This study Open in a separate window Bacterial strains and plasmids used in this study table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Assay and primer name Nucleotide sequence (5′ to 3′) Annealing temp (°C) Amplicon size (bp) PCR ligation mutagenesis YeaB.P1.F GCTGCAGCTTACAT CATCGC 65 863 YeaB.P2.R GGCGCGCCGACGCCGAGCAAGTTTAAGGT YeaB.P3.F GGCCGGCCGGTCGCTCAAGTGAAGCAAA 64 686 YeaB.P4.R GGCAAAGCTTTAGGTGCTCA Cloning YeaBP-1F.

Techniques: Mutagenesis, Centrifugation, Standard Deviation

Journal: Molecular oral microbiology

Article Title: The S. mutans mntE gene encodes a manganese efflux transporter

doi: 10.1111/omi.12286

Figure Lengend Snippet: The results of ICP-MS support significantly heightened intracellular Mn2+ concentrations in S. mutans GMS3000 compared to those in the UA159 wild-type progenitor, the GMS3001 complemented strain, and the GMS284 Mn2+ import mutant. These findings further implicate SMU_1176 as a Mn2+ efflux protein. Each strain was grown overnight in THB or THB supplemented with 10 μM MnSO4, pelleted, and washed three times. Pellets were dried overnight in a Vacufuge, and the dry weights were determined for normalization. The pellets were digested in 2.8% Nitric Acid at 98°C with vigorous, intermediate vortexing. Supernatants containing the cytosolic contents were diluted to a total volume of 5 ml using 5% Nitric Acid, and then analyzed on the ICP-MS. The ICP-MS measurements were corrected for machine drift and normalized using the cell pellet weights to generate a ppb/mg value for each strain. Error bars denote standard deviation about the mean. ANOVA analysis with Tukey’s test revealed significant differences between GMS3000 and each of the other three strains in the presence of 10 μM MnSO4 (p < .00001). N = 3

Article Snippet: Primers were ordered and obtained from Eurofins Genomics. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Description or relevant characteristics Source or reference Strains E. coli DH5α F- supE44 Δ lacU169 Φ80 dlacZ Δ M15 hsdR17 recA1 endA1 gyrA96 thi-1 relA Hanahan (1983 ) S. gordonii DL1 Wild-type H2O2-producing primary colonizer Kreth, Zhang, and Herzberg (2008) S. mutans UA159 Wild-type, serotype c ATCC 700610 S. mutans GMS284 UA159-derived, sloC-deficient, Em r Crepps et al. (2016) S. mutans GMS3000 UA159-derived, SMU_1176- deficient, Em r This study S. mutans GMS3001 GMS3000 containing wild-type SMU_1176 gene in trans on plasmid pJO, Em r , Sp r This study S. mutans GMS584 UA159-derived, sloR-deficient, Em r Rolerson et al. (2006) S. mutans SMCitM UA159-derived, CitM-deficient, Em r Korithoski, Krastel, and Cvitkovitch (2005) Plasmids pDL277 E. coli-streptococcal shuttle vector, Sp r LeBlanc, Lee, and Abu-Al-Jaibat (1992) pJO pDL277 derived, harbors wild-type SMU_1176 gene, Sp r This study Open in a separate window Bacterial strains and plasmids used in this study table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Assay and primer name Nucleotide sequence (5′ to 3′) Annealing temp (°C) Amplicon size (bp) PCR ligation mutagenesis YeaB.P1.F GCTGCAGCTTACAT CATCGC 65 863 YeaB.P2.R GGCGCGCCGACGCCGAGCAAGTTTAAGGT YeaB.P3.F GGCCGGCCGGTCGCTCAAGTGAAGCAAA 64 686 YeaB.P4.R GGCAAAGCTTTAGGTGCTCA Cloning YeaBP-1F.

Techniques: Mutagenesis, Standard Deviation

Journal: Molecular oral microbiology

Article Title: The S. mutans mntE gene encodes a manganese efflux transporter

doi: 10.1111/omi.12286

Figure Lengend Snippet: The SMU1176- deficient S. mutans GMS3000 strain is more sensitive to H2O2 challenge than the UA159 wildtype and complemented GMS3001 strains. (a) THYE agar was spot inoculated with 8 μl of a Streptococcus gordonii DL1 overnight culture and then incubated for 16–18 hr. The next day, overnight cultures of S. mutans UA159, GMS284, or GMS3000 were adjusted to ±0.005A, spotted adjacent to the S. gordonii inocula, and incubated for 16–18 hr. S. mutans growth was subsequently observed for inhibition in the zone of H2O2 diffusion. These data are representative of 9 independent experiments. (b) The growth of the S. mutans strains in the presence of S. gordonii was normalized by dividing the vertical diameter of the S. mutans area of growth by the vertical diameter of the S. gordonii area of growth and taking the average across three independent experiments

Article Snippet: Primers were ordered and obtained from Eurofins Genomics. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Description or relevant characteristics Source or reference Strains E. coli DH5α F- supE44 Δ lacU169 Φ80 dlacZ Δ M15 hsdR17 recA1 endA1 gyrA96 thi-1 relA Hanahan (1983 ) S. gordonii DL1 Wild-type H2O2-producing primary colonizer Kreth, Zhang, and Herzberg (2008) S. mutans UA159 Wild-type, serotype c ATCC 700610 S. mutans GMS284 UA159-derived, sloC-deficient, Em r Crepps et al. (2016) S. mutans GMS3000 UA159-derived, SMU_1176- deficient, Em r This study S. mutans GMS3001 GMS3000 containing wild-type SMU_1176 gene in trans on plasmid pJO, Em r , Sp r This study S. mutans GMS584 UA159-derived, sloR-deficient, Em r Rolerson et al. (2006) S. mutans SMCitM UA159-derived, CitM-deficient, Em r Korithoski, Krastel, and Cvitkovitch (2005) Plasmids pDL277 E. coli-streptococcal shuttle vector, Sp r LeBlanc, Lee, and Abu-Al-Jaibat (1992) pJO pDL277 derived, harbors wild-type SMU_1176 gene, Sp r This study Open in a separate window Bacterial strains and plasmids used in this study table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Assay and primer name Nucleotide sequence (5′ to 3′) Annealing temp (°C) Amplicon size (bp) PCR ligation mutagenesis YeaB.P1.F GCTGCAGCTTACAT CATCGC 65 863 YeaB.P2.R GGCGCGCCGACGCCGAGCAAGTTTAAGGT YeaB.P3.F GGCCGGCCGGTCGCTCAAGTGAAGCAAA 64 686 YeaB.P4.R GGCAAAGCTTTAGGTGCTCA Cloning YeaBP-1F.

Techniques: Incubation, Inhibition, Diffusion-based Assay

Journal: Molecular oral microbiology

Article Title: The S. mutans mntE gene encodes a manganese efflux transporter

doi: 10.1111/omi.12286

Figure Lengend Snippet: The results of qRT-PCR experiments reveal increased transcription of the S. mutans SMU_1176 genes in the SloR-deficient GMS584 strain compared to the UA159 wildtype strain, and at high manganese concentration. SMU_1176 expression levels were monitored in the SloRdeficient GMS584 strain and its SloR-proficient UA159 progenitor when grown in a semi-defined medium (SDM). Expression profiles were normalized against the steady state expression of an endogenous 16S control gene, the results of which indicate (via ANOVA analysis with Tukey’s test) significantly heightened SMU_1176 transcription in both S. mutans UA159 and GMS584 when grown in the presence of 500 μM MnSO4 (high) as compared to 5 μM MnSO4 (low) (p < .001). SMU_1176 gene expression was also significantly greater in the SloR-deficient GMS584 strain compared to the wild-type UA159 progenitor for both experimental conditions, but especially at the higher manganese concentration (p < .001). Error bars represent the standard deviation about the mean. N = 3

Article Snippet: Primers were ordered and obtained from Eurofins Genomics. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Description or relevant characteristics Source or reference Strains E. coli DH5α F- supE44 Δ lacU169 Φ80 dlacZ Δ M15 hsdR17 recA1 endA1 gyrA96 thi-1 relA Hanahan (1983 ) S. gordonii DL1 Wild-type H2O2-producing primary colonizer Kreth, Zhang, and Herzberg (2008) S. mutans UA159 Wild-type, serotype c ATCC 700610 S. mutans GMS284 UA159-derived, sloC-deficient, Em r Crepps et al. (2016) S. mutans GMS3000 UA159-derived, SMU_1176- deficient, Em r This study S. mutans GMS3001 GMS3000 containing wild-type SMU_1176 gene in trans on plasmid pJO, Em r , Sp r This study S. mutans GMS584 UA159-derived, sloR-deficient, Em r Rolerson et al. (2006) S. mutans SMCitM UA159-derived, CitM-deficient, Em r Korithoski, Krastel, and Cvitkovitch (2005) Plasmids pDL277 E. coli-streptococcal shuttle vector, Sp r LeBlanc, Lee, and Abu-Al-Jaibat (1992) pJO pDL277 derived, harbors wild-type SMU_1176 gene, Sp r This study Open in a separate window Bacterial strains and plasmids used in this study table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Assay and primer name Nucleotide sequence (5′ to 3′) Annealing temp (°C) Amplicon size (bp) PCR ligation mutagenesis YeaB.P1.F GCTGCAGCTTACAT CATCGC 65 863 YeaB.P2.R GGCGCGCCGACGCCGAGCAAGTTTAAGGT YeaB.P3.F GGCCGGCCGGTCGCTCAAGTGAAGCAAA 64 686 YeaB.P4.R GGCAAAGCTTTAGGTGCTCA Cloning YeaBP-1F.

Techniques: Quantitative RT-PCR, Concentration Assay, Expressing, Standard Deviation

Journal: Microbiology

Article Title: Regulation of cid and lrg expression by CcpA in Streptococcus mutans

doi: 10.1099/mic.0.000744

Figure Lengend Snippet: Bacterial strains and plasmids used in this study

Article Snippet: All constructs were Sanger sequenced to confirm cid and lrg promoter sequence fidelity. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Strain or plasmid Genotypes and/or descriptions Source or reference S. mutans strains UA159 Wild-type ATCC 700610 ΔccpA ΔccpA :: NPEm r [ 34 ] UA159/P lrg - gfp UA159 carrying pDL278 :: P lrg -gfp This study UA159/P cid - gfp UA159 carrying pDL278 :: P cid -gfp This study ΔccpA /P lrg - gfp ΔccpA carrying pDL278 :: P lrg -gfp This study ΔccpA /P cid - gfp ΔccpA carrying pDL278 :: P cid -gfp This study UA159/P cidcre1 - gfp UA159 carrying pDL278 :: cre1 site mutated P cid -gfp This study UA159/P cidcre2 - gfp UA159 carrying pDL278 :: cre2 site mutated P cid -gfp This study UA159/P cidcre12 - gfp UA159 carrying pDL278 :: cre1 and cre2 sites mutated P cid -gfp This study UA159/P lrgcre1 - gfp UA159 carrying pDL278 :: cre1 site mutated P lrg -gfp This study UA159/P lrgcre2 - gfp UA159 carrying pDL278 :: cre2 site mutated P lrg -gfp This study UA159/P lrgcre12 - gfp UA159 carrying pDL278 :: cre1 and cre2 sites mutated P lrg -gfp This study E. coli strains His 6 -CcpA ccpA coding region cloned into pQE30, Km r , Amp r [ 26 ] Plasmid pDL278 E. coli/Streptococcus shuttle vector [ 44 ] Open in a separate window caption a8 Bacterial strains and plasmids used in this study

Techniques: Plasmid Preparation, Clone Assay

Journal: Microbiology

Article Title: Regulation of cid and lrg expression by CcpA in Streptococcus mutans

doi: 10.1099/mic.0.000744

Figure Lengend Snippet: Effect of CcpA on S. mutans lrg and cid promoter activity over the growth in the low- and high-glucose cultures. The Plrg - gfp (a) and Pcid- gfp (b) constructs in pDL278 were created in the S. mutans UA159 (wild-type) and ∆ccpA (ccpA-deficient) strains. The strains were grown in a chemically defined medium (FMC) supplemented by 11 mM (left) or 45 mM (right) glucose. Relative gfp fluorescence intensity (coloured lines; F) and OD600 (black lines; OD) were monitored on a plate reader (see Methods for details). The results are representative of three independent experiments.

Article Snippet: All constructs were Sanger sequenced to confirm cid and lrg promoter sequence fidelity. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Strain or plasmid Genotypes and/or descriptions Source or reference S. mutans strains UA159 Wild-type ATCC 700610 ΔccpA ΔccpA :: NPEm r [ 34 ] UA159/P lrg - gfp UA159 carrying pDL278 :: P lrg -gfp This study UA159/P cid - gfp UA159 carrying pDL278 :: P cid -gfp This study ΔccpA /P lrg - gfp ΔccpA carrying pDL278 :: P lrg -gfp This study ΔccpA /P cid - gfp ΔccpA carrying pDL278 :: P cid -gfp This study UA159/P cidcre1 - gfp UA159 carrying pDL278 :: cre1 site mutated P cid -gfp This study UA159/P cidcre2 - gfp UA159 carrying pDL278 :: cre2 site mutated P cid -gfp This study UA159/P cidcre12 - gfp UA159 carrying pDL278 :: cre1 and cre2 sites mutated P cid -gfp This study UA159/P lrgcre1 - gfp UA159 carrying pDL278 :: cre1 site mutated P lrg -gfp This study UA159/P lrgcre2 - gfp UA159 carrying pDL278 :: cre2 site mutated P lrg -gfp This study UA159/P lrgcre12 - gfp UA159 carrying pDL278 :: cre1 and cre2 sites mutated P lrg -gfp This study E. coli strains His 6 -CcpA ccpA coding region cloned into pQE30, Km r , Amp r [ 26 ] Plasmid pDL278 E. coli/Streptococcus shuttle vector [ 44 ] Open in a separate window caption a8 Bacterial strains and plasmids used in this study

Techniques: Activity Assay, Construct, Fluorescence

Journal: Microbiology

Article Title: Regulation of cid and lrg expression by CcpA in Streptococcus mutans

doi: 10.1099/mic.0.000744

Figure Lengend Snippet: Effects of putative cre site mutations in the cid promoter region. (a–b); EMSA. Underlined letters indicate two putative CcpA-binding (cid-cre1 and cid-cre2) sequences. Italic letters indicate the mutated sequence regions. EMSA was performed with 1 fmol biotinylated cid promoter (Pcid) regions with mutation in the putative cre sequences and various amounts of purified His-CcpA (0, 0.78125 or 1.5625 pmol). The reactions were run on a non-denaturing polyacrylamide gel and the signal observed by chemiluminescence. (a) Lanes 1–3 contain biotinylated Pcid wild-type DNA probes; lanes 4–6 contain biotinylated Pcid-cre1 mutated DNA probes; and lanes 7–9 contain biotinylated Pcid-cre2 mutated DNA probes. (b) Lanes 1–3 contain biotinylated Pcid wild-type DNA probes; lanes 4–6 contain biotinylated Pcid-cre1&2 mutated DNA probes. (c–d); Effects of cre mutations on cid expression over growth. The S. mutans UA159 (wild-type) strains contained pDL278 carrying the gfp gene driven by wild-type and mutated Pcid. The strains were grown in a chemically defined medium (FMC) supplemented by either a low [11 mM, (c)] or high level [45 mM, (d)] of glucose. Relative gfp fluorescence intensity (coloured lines; F) and OD600 (black lines; OD) were monitored on a plate reader (see Methods for details). The results are the average values for at least three biological replicates performed in triplicate.

Article Snippet: All constructs were Sanger sequenced to confirm cid and lrg promoter sequence fidelity. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Strain or plasmid Genotypes and/or descriptions Source or reference S. mutans strains UA159 Wild-type ATCC 700610 ΔccpA ΔccpA :: NPEm r [ 34 ] UA159/P lrg - gfp UA159 carrying pDL278 :: P lrg -gfp This study UA159/P cid - gfp UA159 carrying pDL278 :: P cid -gfp This study ΔccpA /P lrg - gfp ΔccpA carrying pDL278 :: P lrg -gfp This study ΔccpA /P cid - gfp ΔccpA carrying pDL278 :: P cid -gfp This study UA159/P cidcre1 - gfp UA159 carrying pDL278 :: cre1 site mutated P cid -gfp This study UA159/P cidcre2 - gfp UA159 carrying pDL278 :: cre2 site mutated P cid -gfp This study UA159/P cidcre12 - gfp UA159 carrying pDL278 :: cre1 and cre2 sites mutated P cid -gfp This study UA159/P lrgcre1 - gfp UA159 carrying pDL278 :: cre1 site mutated P lrg -gfp This study UA159/P lrgcre2 - gfp UA159 carrying pDL278 :: cre2 site mutated P lrg -gfp This study UA159/P lrgcre12 - gfp UA159 carrying pDL278 :: cre1 and cre2 sites mutated P lrg -gfp This study E. coli strains His 6 -CcpA ccpA coding region cloned into pQE30, Km r , Amp r [ 26 ] Plasmid pDL278 E. coli/Streptococcus shuttle vector [ 44 ] Open in a separate window caption a8 Bacterial strains and plasmids used in this study

Techniques: Binding Assay, Sequencing, Mutagenesis, Purification, Expressing, Fluorescence

Journal: Microbiology

Article Title: Regulation of cid and lrg expression by CcpA in Streptococcus mutans

doi: 10.1099/mic.0.000744

Figure Lengend Snippet: Effects of putative cre site mutations in the lrg promoter region. (a–b); EMSA. Underlined letters indicate two putative CcpA-binding (lrg-cre1 and lrg-cre2) sequences. Italic letters indicate the mutated sequence regions. The EMSA was performed with 1 fmol biotinylated lrg promoter (Plrg) region with mutation in the putative cre sequences and various amounts of purified His-CcpA (0, 0.78125 or 1.5625 pmol). The reactions were run on a non-denaturing polyacrylamide gel and the signal observed by chemiluminescence. (a) Lanes 1–3 contain biotinylated Plrg wild-type DNA probes; lanes 4–6 contain biotinylated Plrg-cre1 mutated DNA probes; and lanes 7–9 contain biotinylated Plrg-cre2 mutated DNA probes. (b) Lanes 1–3 contain biotinylated Plrg wild-type DNA probes; lanes 4–6 contain biotinylated Plrg-cre1&2 mutated DNA probes. (c–d); Effects of cre mutations in the lrg expression over the growth. The S. mutans UA159 (wild-type) strains contain pDL278 carrying the gfp gene driven by wild-type and mutated Plrg. The strains were grown in a chemically defined medium (FMC) supplemented by low [11 mM, (c)] or high levels (45 mM, (d)] of glucose. Relative gfp fluorescence intensity (coloured lines; F) and OD600 (black lines; OD) were monitored on a plate reader (see Methods for details). The results are the average values from at least three biological replicates performed in triplicate.

Article Snippet: All constructs were Sanger sequenced to confirm cid and lrg promoter sequence fidelity. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Strain or plasmid Genotypes and/or descriptions Source or reference S. mutans strains UA159 Wild-type ATCC 700610 ΔccpA ΔccpA :: NPEm r [ 34 ] UA159/P lrg - gfp UA159 carrying pDL278 :: P lrg -gfp This study UA159/P cid - gfp UA159 carrying pDL278 :: P cid -gfp This study ΔccpA /P lrg - gfp ΔccpA carrying pDL278 :: P lrg -gfp This study ΔccpA /P cid - gfp ΔccpA carrying pDL278 :: P cid -gfp This study UA159/P cidcre1 - gfp UA159 carrying pDL278 :: cre1 site mutated P cid -gfp This study UA159/P cidcre2 - gfp UA159 carrying pDL278 :: cre2 site mutated P cid -gfp This study UA159/P cidcre12 - gfp UA159 carrying pDL278 :: cre1 and cre2 sites mutated P cid -gfp This study UA159/P lrgcre1 - gfp UA159 carrying pDL278 :: cre1 site mutated P lrg -gfp This study UA159/P lrgcre2 - gfp UA159 carrying pDL278 :: cre2 site mutated P lrg -gfp This study UA159/P lrgcre12 - gfp UA159 carrying pDL278 :: cre1 and cre2 sites mutated P lrg -gfp This study E. coli strains His 6 -CcpA ccpA coding region cloned into pQE30, Km r , Amp r [ 26 ] Plasmid pDL278 E. coli/Streptococcus shuttle vector [ 44 ] Open in a separate window caption a8 Bacterial strains and plasmids used in this study

Techniques: Binding Assay, Sequencing, Mutagenesis, Purification, Expressing, Fluorescence

Journal: Journal of Bacteriology

Article Title: Autoregulation of the Streptococcus mutans SloR Metalloregulator Is Constitutive and Driven by an Independent Promoter

doi: 10.1128/JB.00214-18

Figure Lengend Snippet: Fold changes in expression for S. mutans sloABCR

Article Snippet: Working stocks of bacterial strains were prepared from overnight cultures and stored in 20% or 50% sterile glycerol at −20°C or −80°C, respectively. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Strain Description or relevant characteristics Source or reference E. coli BL21(DE3) hA2 [ lon ] ompT gal (λ) (DE3) [ dcm ] Δ hsdS Thermo Fisher Scientific S. mutans UA159 Wild type, serotype c; ATCC 700610 ATCC S. mutans GMS602 UA159-derived strain; contains IFDC2 cassette in the sloA promoter region; Em r 4-Cl-Phe s 22 S. mutans GMS611 Contains a markerless T → C mutation within the −35 region of the sloABC promoter This study S. mutans GMS611d Contains a markerless T → C mutation within the −10 region of the sloABC promoter This study Open in a separate window Bacterial strains used in this study The primers used in this study are shown in Table S1 in the supplemental material.

Techniques: Expressing

Journal: Journal of Bacteriology

Article Title: Autoregulation of the Streptococcus mutans SloR Metalloregulator Is Constitutive and Driven by an Independent Promoter

doi: 10.1128/JB.00214-18

Figure Lengend Snippet: The intergenic region between the sloR and sloC genes harbors a recognizable promoter. The nucleotide sequence of this region was aligned with the S. mutans UA159 genome sequence from the NCBI GenBank database (RefSeq accession number NC_004350.2). The +1 transcription start site (designated by an arrow) marks the transcription start site of the sloR gene as defined by 5′ RACE and defines a 19-bp 5′ untranslated region (UTR). Also shown are the predicted −35 and −10 promoter regions, the predicted ribosome binding site (RBS), and the start codon (SC) of the 654-bp sloR gene. A putative extended −10 element is denoted by the dashed line.

Article Snippet: Working stocks of bacterial strains were prepared from overnight cultures and stored in 20% or 50% sterile glycerol at −20°C or −80°C, respectively. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Strain Description or relevant characteristics Source or reference E. coli BL21(DE3) hA2 [ lon ] ompT gal (λ) (DE3) [ dcm ] Δ hsdS Thermo Fisher Scientific S. mutans UA159 Wild type, serotype c; ATCC 700610 ATCC S. mutans GMS602 UA159-derived strain; contains IFDC2 cassette in the sloA promoter region; Em r 4-Cl-Phe s 22 S. mutans GMS611 Contains a markerless T → C mutation within the −35 region of the sloABC promoter This study S. mutans GMS611d Contains a markerless T → C mutation within the −10 region of the sloABC promoter This study Open in a separate window Bacterial strains used in this study The primers used in this study are shown in Table S1 in the supplemental material.

Techniques: Sequencing, Binding Assay

Journal: Journal of Bacteriology

Article Title: Autoregulation of the Streptococcus mutans SloR Metalloregulator Is Constitutive and Driven by an Independent Promoter

doi: 10.1128/JB.00214-18

Figure Lengend Snippet: The S. mutans sloR gene is transcribed even in the absence of a functional sloABC promoter. (a) Map of the sloABCR operon and locations of primer annealing sites. Primer P1 (sloA.RT_PCR.F) anneals within the sloA coding sequence, and primers P2 and P3 (sloR.RT_PCR.F and sloR.RT_PCR.R, respectively) anneal within the sloR coding sequence. (b) Products of reverse transcriptase PCR resolved in a 0.8% agarose gel. Amplification of cDNA with the P1/P3 primer pair generated a 2,745-bp amplicon for UA159 but not for GMS611 or GMS611d, consistent with disruption of the sloABC promoter in the mutant strains. In contrast, cDNA amplification with the P2/P3 primer pair gave rise to a 250-bp amplicon even for the sloABC promoter mutants GMS611 and GMS611d, indicating the presence of a sloR-specific promoter in the 184-bp intergenic region that separates the sloABC operon from the downstream sloR gene. gDNA, genomic DNA; P/O, promoter/operator.

Article Snippet: Working stocks of bacterial strains were prepared from overnight cultures and stored in 20% or 50% sterile glycerol at −20°C or −80°C, respectively. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Strain Description or relevant characteristics Source or reference E. coli BL21(DE3) hA2 [ lon ] ompT gal (λ) (DE3) [ dcm ] Δ hsdS Thermo Fisher Scientific S. mutans UA159 Wild type, serotype c; ATCC 700610 ATCC S. mutans GMS602 UA159-derived strain; contains IFDC2 cassette in the sloA promoter region; Em r 4-Cl-Phe s 22 S. mutans GMS611 Contains a markerless T → C mutation within the −35 region of the sloABC promoter This study S. mutans GMS611d Contains a markerless T → C mutation within the −10 region of the sloABC promoter This study Open in a separate window Bacterial strains used in this study The primers used in this study are shown in Table S1 in the supplemental material.

Techniques: Functional Assay, Reverse Transcription Polymerase Chain Reaction, Sequencing, Agarose Gel Electrophoresis, Amplification, Generated, Mutagenesis

Journal: Journal of Bacteriology

Article Title: Autoregulation of the Streptococcus mutans SloR Metalloregulator Is Constitutive and Driven by an Independent Promoter

doi: 10.1128/JB.00214-18

Figure Lengend Snippet: SloR binds directly to the intergenic region (IGR) between the S. mutans sloC and sloR genes. (a) Results of EMSA, which support direct SloR binding to 204-bp and 155-bp fragments of the sloC-sloR intergenic region at protein concentrations as low as 400 nM. SloR binding to a 95-bp IGR derivative was relatively compromised, however, and was completely absent when a 62-bp deletion derivative was used as the binding template. A 205-bp amplicon that included the sloABC promoter was used as a positive control for SloR binding. EDTA was added to select reaction mixtures in an attempt to abrogate metal ion-dependent binding. Nondenaturing polyacrylamide gels (12%) were subjected to electrophoresis at 300 V for 1.5 h. Film exposure in the presence of an intensifying screen proceeded for 48 h at −80°C before development. (b) SloR binding to serial deletion fragments of the S. mutans IGR. The arrowheads facing inward represent AATTAA hexameric repeats to which SloR putatively binds. The vertical bars denote the positioning of the −10 and −35 promoter sequences of the sloR-specific promoter. Whether or not SloR binds to the IGR fragment is shown with a “+” or “−” designation.

Article Snippet: Working stocks of bacterial strains were prepared from overnight cultures and stored in 20% or 50% sterile glycerol at −20°C or −80°C, respectively. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Strain Description or relevant characteristics Source or reference E. coli BL21(DE3) hA2 [ lon ] ompT gal (λ) (DE3) [ dcm ] Δ hsdS Thermo Fisher Scientific S. mutans UA159 Wild type, serotype c; ATCC 700610 ATCC S. mutans GMS602 UA159-derived strain; contains IFDC2 cassette in the sloA promoter region; Em r 4-Cl-Phe s 22 S. mutans GMS611 Contains a markerless T → C mutation within the −35 region of the sloABC promoter This study S. mutans GMS611d Contains a markerless T → C mutation within the −10 region of the sloABC promoter This study Open in a separate window Bacterial strains used in this study The primers used in this study are shown in Table S1 in the supplemental material.

Techniques: Binding Assay, Amplification, Positive Control, Electrophoresis

Journal: Journal of Bacteriology

Article Title: Autoregulation of the Streptococcus mutans SloR Metalloregulator Is Constitutive and Driven by an Independent Promoter

doi: 10.1128/JB.00214-18

Figure Lengend Snippet: Bacterial strains used in this study

Article Snippet: Working stocks of bacterial strains were prepared from overnight cultures and stored in 20% or 50% sterile glycerol at −20°C or −80°C, respectively. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Strain Description or relevant characteristics Source or reference E. coli BL21(DE3) hA2 [ lon ] ompT gal (λ) (DE3) [ dcm ] Δ hsdS Thermo Fisher Scientific S. mutans UA159 Wild type, serotype c; ATCC 700610 ATCC S. mutans GMS602 UA159-derived strain; contains IFDC2 cassette in the sloA promoter region; Em r 4-Cl-Phe s 22 S. mutans GMS611 Contains a markerless T → C mutation within the −35 region of the sloABC promoter This study S. mutans GMS611d Contains a markerless T → C mutation within the −10 region of the sloABC promoter This study Open in a separate window Bacterial strains used in this study The primers used in this study are shown in Table S1 in the supplemental material.

Techniques: Mutagenesis

Journal: Molecular oral microbiology

Article Title: The SloR Metalloregulator is Involved in the Streptococcus mutans Oxidative Stress Response

doi: 10.1111/omi.12147

Figure Lengend Snippet: Bacterial strains and plasmids used in this study.

Article Snippet: Primers designed using MacVector 7.0 software were purchased from Sigma-Aldrich (St. Louis, MO) and are based on the sequence of the S. mutans UA159 genome. table ft1 table-wrap mode="anchored" t5 caption a7 Strain/Plasmid Genotype or phenotype Source or reference pER7 pDL277-derived, harbors wildtype sloC coding sequence and promoter region, Sp r This study Escherichia coli F- supE44 Δ lacU169 Hanahan (1983) DH5α Φ80 dlacZ Δ M15 hsdR17 recA1 endA1 gyrA96 thi-1 relA Streptococcus mutans UA159 Wild-type, serotype c ATCC 700610 GMS284 UA159-derived, sloC -deficient, Em r This study GMS285 GMS284 containing wildtype sloC gene in trans on plasmid pER7, Em r , Sp r This study GMS584 UA159-derived, sloR -deficient, Em r Rolerson et al . (2006) GMS585 GMS584 containing wildtype sloR gene in trans on plasmid pER4, Em r , Sp r Rolerson et al (2006) SMCitM UA159-derived, citM -deficient, Em r Korithoski et al (2005) Streptococcus gordonii DL1 Wild-type H 2 O 2 -producing primary colonizer Kreth et al . (2008) Streptococcus sanguinis SK36 Wild-type H 2 O 2 -producing primary colonizer Kreth et al . (2008) Open in a separate window Bacterial strains and plasmids used in this study. table ft1 table-wrap mode="anchored" t5 caption a7 Assay and primer name Nucleotide sequence (5’ to 3’) Annealing temp (°C) Amplicon size (bp) cloning fimA.LR.BamH1.F fimA.LR.BamH1.R CG GGATCC CGCAGGATATGGATAA GTGGATTACTGTG CG GGATCC CGGATCTTCTCATCAC GTTCACTGAGTTC 52.5 1664 PCR lig. mut . fimA-SB-pim-P1 CGCTGGGTGTCATTTTGATTG 53 867 fimA-SB-pim-P2 GGCCGGCCCGGTAAACCAAGCATT GCCTCC fimA-SB-pim-P3 GGCGCGCCAAAAGTCGGGTGTCTG CG 53 805 fimA-SB-pim-P4 GCCCTTAGTAGAGAGGTATCGT erm.AscI.F GGCGCGCC CCGGGCCCAAAATTTG TTTGAT 52.3 860 erm.FseI.R ATTCTATGAGTCGCTGCCGACT GGC CGGCC qRT-PCR SC_sod_qRT_F ATTGATGCTGAAACGATGACCC 60 * 209 SC_sod_qRT_R AAGAGTTCCCAGAAAAGAGCGTG SC_tpx_qRT_F AAATACGGTGACACTTGCTGGTAAG 144 SC_tpx_qRT_R TCAATAGATGGCACAACGGTAATC SC_dpr_qRT_F TGGTTCAGGCTTCCTTTATCTGC 266 SC_dpr_qRT_R CTTCCTCATCTGTCACATCAAGACC SC_sloC_qRT_F CGAAGAAGAGGGAACACCAAATC 186 SC_sloC_qRT_R CCAGCCTGTCCTTTTTTAGCAAC Hk11.qPCR.F GCTGGCTAATAATGTCATCAAGC 88 Hk11.qPCR.F CTCAACAGTTACTTCAATCTCCTCC EMSA MP_sloA_F ATCGGTGAATCGCACTGTCG 65 364 MP_sloA_R2 GCCATCAATAAAACTTGTCCCTTC recA.Gel.LN.F CGGTTATCCAAAAGGGCGTATC 67 212 recA.Gel.LN.R CCTGTTCTCCTGAATCTGGTTGTG SC_sod_EMSA_F GGGGATGATTTCTGTCAAAGCAAG 67 291 SC_sod_EMSA_R TGTTTTTCAAGAGCCGCATTAGC SC_dpr_EMSA_F CGCAATGGAATAGGGTAACCG 66 434 SC_dpr_EMSA_R TTTGATAAATCCGCTACAGCCTG SC_tpx_EMSA_F CGTCTGTCAACTATTCGCAATGC 68 388 SC_tpx_EMSA_R TTTCTTACCAGCAAGTGTCACCG JPX_spxA_F GGGGATGATTTCTGTCAAAGCAAG 63 274 JPC_spxA_R TGTTTTTCAAGAGCCGCATTAGC Open in a separate window * The annealing temperature for qRT-PCR primers used in the CFX96 system (Bio-Rad) is 60°C.

Techniques: Sequencing, Plasmid Preparation

Journal: Molecular oral microbiology

Article Title: The SloR Metalloregulator is Involved in the Streptococcus mutans Oxidative Stress Response

doi: 10.1111/omi.12147

Figure Lengend Snippet: The SloR-deficient S. mutans GMS584 strain demonstrates compromised survivorship compared to the UA159 wild-type and GMS585 SloR-proficient strains (normalized ZOI ratios = 1.3, 1.0, and 0.84, respectively) when spot inoculated adjacent to streptococcal H2O2 producers., S. mutans was grown overnight to stationary phase and the bacterial concentration was standardized to OD600 = 0.400 ± 0.05 for subsequent spot inoculation., Streptococcus gordonii or S. sanguinis stationary phase cultures grown to OD ∼0.400 ± 0.05 were serially diluted (in triplicate) by a factor of 10 (N = 5 independent experiments). Shown are representative culture competition assays in which either S. gordonii or S. sanguinis was spot inoculated and grown for 16 hours before inoculating the adjacent S. mutans strains (A and C) or all strains were spot inoculated simultaneously (B and D). The S. mutans GMS584 SloR-deficient strain demonstrated the greatest susceptibility to H2O2 challenge.

Article Snippet: Primers designed using MacVector 7.0 software were purchased from Sigma-Aldrich (St. Louis, MO) and are based on the sequence of the S. mutans UA159 genome. table ft1 table-wrap mode="anchored" t5 caption a7 Strain/Plasmid Genotype or phenotype Source or reference pER7 pDL277-derived, harbors wildtype sloC coding sequence and promoter region, Sp r This study Escherichia coli F- supE44 Δ lacU169 Hanahan (1983) DH5α Φ80 dlacZ Δ M15 hsdR17 recA1 endA1 gyrA96 thi-1 relA Streptococcus mutans UA159 Wild-type, serotype c ATCC 700610 GMS284 UA159-derived, sloC -deficient, Em r This study GMS285 GMS284 containing wildtype sloC gene in trans on plasmid pER7, Em r , Sp r This study GMS584 UA159-derived, sloR -deficient, Em r Rolerson et al . (2006) GMS585 GMS584 containing wildtype sloR gene in trans on plasmid pER4, Em r , Sp r Rolerson et al (2006) SMCitM UA159-derived, citM -deficient, Em r Korithoski et al (2005) Streptococcus gordonii DL1 Wild-type H 2 O 2 -producing primary colonizer Kreth et al . (2008) Streptococcus sanguinis SK36 Wild-type H 2 O 2 -producing primary colonizer Kreth et al . (2008) Open in a separate window Bacterial strains and plasmids used in this study. table ft1 table-wrap mode="anchored" t5 caption a7 Assay and primer name Nucleotide sequence (5’ to 3’) Annealing temp (°C) Amplicon size (bp) cloning fimA.LR.BamH1.F fimA.LR.BamH1.R CG GGATCC CGCAGGATATGGATAA GTGGATTACTGTG CG GGATCC CGGATCTTCTCATCAC GTTCACTGAGTTC 52.5 1664 PCR lig. mut . fimA-SB-pim-P1 CGCTGGGTGTCATTTTGATTG 53 867 fimA-SB-pim-P2 GGCCGGCCCGGTAAACCAAGCATT GCCTCC fimA-SB-pim-P3 GGCGCGCCAAAAGTCGGGTGTCTG CG 53 805 fimA-SB-pim-P4 GCCCTTAGTAGAGAGGTATCGT erm.AscI.F GGCGCGCC CCGGGCCCAAAATTTG TTTGAT 52.3 860 erm.FseI.R ATTCTATGAGTCGCTGCCGACT GGC CGGCC qRT-PCR SC_sod_qRT_F ATTGATGCTGAAACGATGACCC 60 * 209 SC_sod_qRT_R AAGAGTTCCCAGAAAAGAGCGTG SC_tpx_qRT_F AAATACGGTGACACTTGCTGGTAAG 144 SC_tpx_qRT_R TCAATAGATGGCACAACGGTAATC SC_dpr_qRT_F TGGTTCAGGCTTCCTTTATCTGC 266 SC_dpr_qRT_R CTTCCTCATCTGTCACATCAAGACC SC_sloC_qRT_F CGAAGAAGAGGGAACACCAAATC 186 SC_sloC_qRT_R CCAGCCTGTCCTTTTTTAGCAAC Hk11.qPCR.F GCTGGCTAATAATGTCATCAAGC 88 Hk11.qPCR.F CTCAACAGTTACTTCAATCTCCTCC EMSA MP_sloA_F ATCGGTGAATCGCACTGTCG 65 364 MP_sloA_R2 GCCATCAATAAAACTTGTCCCTTC recA.Gel.LN.F CGGTTATCCAAAAGGGCGTATC 67 212 recA.Gel.LN.R CCTGTTCTCCTGAATCTGGTTGTG SC_sod_EMSA_F GGGGATGATTTCTGTCAAAGCAAG 67 291 SC_sod_EMSA_R TGTTTTTCAAGAGCCGCATTAGC SC_dpr_EMSA_F CGCAATGGAATAGGGTAACCG 66 434 SC_dpr_EMSA_R TTTGATAAATCCGCTACAGCCTG SC_tpx_EMSA_F CGTCTGTCAACTATTCGCAATGC 68 388 SC_tpx_EMSA_R TTTCTTACCAGCAAGTGTCACCG JPX_spxA_F GGGGATGATTTCTGTCAAAGCAAG 63 274 JPC_spxA_R TGTTTTTCAAGAGCCGCATTAGC Open in a separate window * The annealing temperature for qRT-PCR primers used in the CFX96 system (Bio-Rad) is 60°C.

Techniques: Concentration Assay

Journal: Molecular oral microbiology

Article Title: The SloR Metalloregulator is Involved in the Streptococcus mutans Oxidative Stress Response

doi: 10.1111/omi.12147

Figure Lengend Snippet: The results of qRT-PCR experiments reveal increased transcription of the S. mutans sod, tpx, and sloC genes in the SloR-deficient GMS584 strain compared to the UA159 wild-type SloR-proficient progenitor strain UA159 under conditions of oxidative stress. Gene expression was normalized against that of an endogenous hk11 control gene. Expression deriving from continuously aerated S. mutans cultures was normalized against that of control cultures of the same strain to allow for expression comparisons between UA159 and GMS584 (N = 3 independent experiments, with each expression level measured in triplicate). An independent samples t-test revealed significant up-regulation of sod gene expression in GMS584 compared to UA159 under conditions of continuous aeration compared to controls (p = 0.050, df = 4). Expression trends for tpx and sloC were similar and remarkable in a Cohen’s d test, demonstrating increased transcription in the SloR-deficient mutant compared to the SloR-proficient wild-type progenitor. Error bars represent the standard error of the mean (SEM) for normalized gene expression.

Article Snippet: Primers designed using MacVector 7.0 software were purchased from Sigma-Aldrich (St. Louis, MO) and are based on the sequence of the S. mutans UA159 genome. table ft1 table-wrap mode="anchored" t5 caption a7 Strain/Plasmid Genotype or phenotype Source or reference pER7 pDL277-derived, harbors wildtype sloC coding sequence and promoter region, Sp r This study Escherichia coli F- supE44 Δ lacU169 Hanahan (1983) DH5α Φ80 dlacZ Δ M15 hsdR17 recA1 endA1 gyrA96 thi-1 relA Streptococcus mutans UA159 Wild-type, serotype c ATCC 700610 GMS284 UA159-derived, sloC -deficient, Em r This study GMS285 GMS284 containing wildtype sloC gene in trans on plasmid pER7, Em r , Sp r This study GMS584 UA159-derived, sloR -deficient, Em r Rolerson et al . (2006) GMS585 GMS584 containing wildtype sloR gene in trans on plasmid pER4, Em r , Sp r Rolerson et al (2006) SMCitM UA159-derived, citM -deficient, Em r Korithoski et al (2005) Streptococcus gordonii DL1 Wild-type H 2 O 2 -producing primary colonizer Kreth et al . (2008) Streptococcus sanguinis SK36 Wild-type H 2 O 2 -producing primary colonizer Kreth et al . (2008) Open in a separate window Bacterial strains and plasmids used in this study. table ft1 table-wrap mode="anchored" t5 caption a7 Assay and primer name Nucleotide sequence (5’ to 3’) Annealing temp (°C) Amplicon size (bp) cloning fimA.LR.BamH1.F fimA.LR.BamH1.R CG GGATCC CGCAGGATATGGATAA GTGGATTACTGTG CG GGATCC CGGATCTTCTCATCAC GTTCACTGAGTTC 52.5 1664 PCR lig. mut . fimA-SB-pim-P1 CGCTGGGTGTCATTTTGATTG 53 867 fimA-SB-pim-P2 GGCCGGCCCGGTAAACCAAGCATT GCCTCC fimA-SB-pim-P3 GGCGCGCCAAAAGTCGGGTGTCTG CG 53 805 fimA-SB-pim-P4 GCCCTTAGTAGAGAGGTATCGT erm.AscI.F GGCGCGCC CCGGGCCCAAAATTTG TTTGAT 52.3 860 erm.FseI.R ATTCTATGAGTCGCTGCCGACT GGC CGGCC qRT-PCR SC_sod_qRT_F ATTGATGCTGAAACGATGACCC 60 * 209 SC_sod_qRT_R AAGAGTTCCCAGAAAAGAGCGTG SC_tpx_qRT_F AAATACGGTGACACTTGCTGGTAAG 144 SC_tpx_qRT_R TCAATAGATGGCACAACGGTAATC SC_dpr_qRT_F TGGTTCAGGCTTCCTTTATCTGC 266 SC_dpr_qRT_R CTTCCTCATCTGTCACATCAAGACC SC_sloC_qRT_F CGAAGAAGAGGGAACACCAAATC 186 SC_sloC_qRT_R CCAGCCTGTCCTTTTTTAGCAAC Hk11.qPCR.F GCTGGCTAATAATGTCATCAAGC 88 Hk11.qPCR.F CTCAACAGTTACTTCAATCTCCTCC EMSA MP_sloA_F ATCGGTGAATCGCACTGTCG 65 364 MP_sloA_R2 GCCATCAATAAAACTTGTCCCTTC recA.Gel.LN.F CGGTTATCCAAAAGGGCGTATC 67 212 recA.Gel.LN.R CCTGTTCTCCTGAATCTGGTTGTG SC_sod_EMSA_F GGGGATGATTTCTGTCAAAGCAAG 67 291 SC_sod_EMSA_R TGTTTTTCAAGAGCCGCATTAGC SC_dpr_EMSA_F CGCAATGGAATAGGGTAACCG 66 434 SC_dpr_EMSA_R TTTGATAAATCCGCTACAGCCTG SC_tpx_EMSA_F CGTCTGTCAACTATTCGCAATGC 68 388 SC_tpx_EMSA_R TTTCTTACCAGCAAGTGTCACCG JPX_spxA_F GGGGATGATTTCTGTCAAAGCAAG 63 274 JPC_spxA_R TGTTTTTCAAGAGCCGCATTAGC Open in a separate window * The annealing temperature for qRT-PCR primers used in the CFX96 system (Bio-Rad) is 60°C.

Techniques: Quantitative RT-PCR, Expressing, Mutagenesis

Journal: Journal of Bacteriology

Article Title: Intercellular Communication via the comX -Inducing Peptide (XIP) of Streptococcus mutans

doi: 10.1128/JB.00404-17

Figure Lengend Snippet: Model of coculture system. (A) To monitor natural ComRS signaling, two strains of S. mutans are grown together in a coculture system. The first strain, the “sender,” contains a plasmid that allows for the overexpression of the XIP peptide precursor comS under the control of the constitutive P23 promoter. The sender strain also contains pDL278 carrying the gene for the dsRed fluorescent protein under the control of the comX promoter. The second strain, the “responder,” harbors the PcomX::gfp reporter plasmid on pDL278, which becomes activated when external XIP is imported into the responder via the oligopeptide permease, Opp. The empty pIB184 vector is also harbored by the responder strain to keep sender and responder strains as genetically similar as possible. (B and C) Relative GFP expression (B) and relative RFP expression (C) (colored lines) with OD600 measurements (black lines) during coculture growth of UA159 and UA159/PcomX::gfp (green), UA159/pIB184comS and UA159/PcomX::gfp (blue), UA159/pIB184comS and PcomX::gfp ΔcomS (orange), and UA159/pIB184comS and PcomX::gfp ΔoppA (red) strains. (D) Relative GFP expression measurements during coculture of UA159 (sender) and UA159/PcomX::gfp (responder) using different concentrations of sXIP in comparison to growth between UA159/pIB184comS and UA159/PcomX::gfp (black; coculture). Each assay was performed with biological triplicates.

Article Snippet: The lyophilized sXIP was reconstituted with 99.7% dimethyl sulfoxide (DMSO) to a final concentration of 2 mM and stored in 100-μl aliquots at −20°C. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Relevant characteristics a Source or reference S. mutans strains UA159 Wild type ATCC 700610 UA159/P comX :: gfp UA159 harboring P comX :: gfp 9 P comX :: gfp Δ comS strain Δ comS , harboring P comX :: gfp 9 P comX :: gfp Δ oppA strain Δ oppA , harboring P comX :: gfp 9 P comX :: gfp /pIB184 strain UA159 harboring P comX :: gfp and pIB184 28 P comX :: gfp /pPMZ strain UA159 harboring P comX :: gfp and pPMZ This study UA159/pIB184 comS UA159 harboring pIB184 comS 28 P comS :: dsRed /pIB184 comS strain UA159 harboring P comS :: dsRed and pIB184 comS This study P comX :: dsRed /pIB184 comS strain UA159 harboring P comX :: dsRed and pIB184 comS This study Δ atlA strain atlA (SMU.704c)::NP Km r 39 pIB184 comS Δ atlA strain Δ atlA , harboring pIB184 comS This study Plasmids pDL278 E. coli - Streptococcus shuttle vector, Sp r 51 pIB184 Shuttle expression plasmid with the constitutive P 23 promoter, Em r 25 pPMZ LacZ fusion integration vector based on pMC195 and pMC340B, Km r 52 Open in a separate window a Em, erythromycin; Km, kanamycin; Sp, spectinomycin.

Techniques: Plasmid Preparation, Over Expression, Expressing

Journal: Journal of Bacteriology

Article Title: Intercellular Communication via the comX -Inducing Peptide (XIP) of Streptococcus mutans

doi: 10.1128/JB.00404-17

Figure Lengend Snippet: XIP signaling is cell-cell contact independent. (A) Relative GFP expression (colored lines) and OD600 measurements (black lines [symbols correspond to the symbols on the colored lines]) of UA159/PcomX::gfp grown in supernatants of either UA159, UA159 supplemented with 50 nM sXIP, or UA159/pIB184comS. Supernatants were taken from overnight cultures of respective strains and filter sterilized, the pH was adjusted to 7.0, and glucose was added to the spent medium in an amount equivalent to a concentration of 20 mM. (B) Model of transwell assay using cocultures of UA159/pIB184comS and UA159/PcomX::gfp. UA159/PcomX::gfp (green) is inoculated first in the bottom well, followed by placement of the 0.4-μm polycarbonate membrane insert. The UA159/pIB184comS strain (red) is then inoculated in the top well above the membrane. (C) Relative GFP expression measurements from transwell experiments. Labeling of x axis denotes values for the strain inoculated in the upper well first followed by the strain inoculated in the lower well. Each assay was performed with biological triplicates. Statistical analysis was performed by Student's t test. N.S., not significant.

Article Snippet: The lyophilized sXIP was reconstituted with 99.7% dimethyl sulfoxide (DMSO) to a final concentration of 2 mM and stored in 100-μl aliquots at −20°C. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Relevant characteristics a Source or reference S. mutans strains UA159 Wild type ATCC 700610 UA159/P comX :: gfp UA159 harboring P comX :: gfp 9 P comX :: gfp Δ comS strain Δ comS , harboring P comX :: gfp 9 P comX :: gfp Δ oppA strain Δ oppA , harboring P comX :: gfp 9 P comX :: gfp /pIB184 strain UA159 harboring P comX :: gfp and pIB184 28 P comX :: gfp /pPMZ strain UA159 harboring P comX :: gfp and pPMZ This study UA159/pIB184 comS UA159 harboring pIB184 comS 28 P comS :: dsRed /pIB184 comS strain UA159 harboring P comS :: dsRed and pIB184 comS This study P comX :: dsRed /pIB184 comS strain UA159 harboring P comX :: dsRed and pIB184 comS This study Δ atlA strain atlA (SMU.704c)::NP Km r 39 pIB184 comS Δ atlA strain Δ atlA , harboring pIB184 comS This study Plasmids pDL278 E. coli - Streptococcus shuttle vector, Sp r 51 pIB184 Shuttle expression plasmid with the constitutive P 23 promoter, Em r 25 pPMZ LacZ fusion integration vector based on pMC195 and pMC340B, Km r 52 Open in a separate window a Em, erythromycin; Km, kanamycin; Sp, spectinomycin.

Techniques: Expressing, Concentration Assay, Transwell Assay, Labeling

Journal: Journal of Bacteriology

Article Title: Intercellular Communication via the comX -Inducing Peptide (XIP) of Streptococcus mutans

doi: 10.1128/JB.00404-17

Figure Lengend Snippet: Single-cell observations of ComRS signaling in cocultures. Cocultures of comS-overexpressing sender (PcomX::dsRed/pIB184comS) and either UA159/PcomX::gfp or PcomX::gfp ΔcomS responder strains in a low-melting-point agarose–FMC gel. After loading the gel into a microfluidic channel, cells were imaged at hourly intervals by phase-contrast and fluorescence microscopy. (A) Fluorescence of PcomX::dsRed/pIB184comS and UA159/PcomX::gfp strain coculture at 2-h and 3-h time points as a single cell scatter plot. (B) PcomX::dsRed/pIB184comS and UA159/PcomX::gfp strain coculture at 2 h and 3 h with 1 μM sXIP injected as control. (C) PcomX::dsRed/pIB184comS and PcomX::gfp ΔcomS strain coculture at 2-h and 3-h time points. (D) PcomS::dsRed/pIB184comS and PcomX::gfp ΔcomS strain coculture at 2-h and 3-h time points with 1 μM sXIP injected as control. (E to H) Representative images of cells used for data in panels A to D in the same order.

Article Snippet: The lyophilized sXIP was reconstituted with 99.7% dimethyl sulfoxide (DMSO) to a final concentration of 2 mM and stored in 100-μl aliquots at −20°C. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Relevant characteristics a Source or reference S. mutans strains UA159 Wild type ATCC 700610 UA159/P comX :: gfp UA159 harboring P comX :: gfp 9 P comX :: gfp Δ comS strain Δ comS , harboring P comX :: gfp 9 P comX :: gfp Δ oppA strain Δ oppA , harboring P comX :: gfp 9 P comX :: gfp /pIB184 strain UA159 harboring P comX :: gfp and pIB184 28 P comX :: gfp /pPMZ strain UA159 harboring P comX :: gfp and pPMZ This study UA159/pIB184 comS UA159 harboring pIB184 comS 28 P comS :: dsRed /pIB184 comS strain UA159 harboring P comS :: dsRed and pIB184 comS This study P comX :: dsRed /pIB184 comS strain UA159 harboring P comX :: dsRed and pIB184 comS This study Δ atlA strain atlA (SMU.704c)::NP Km r 39 pIB184 comS Δ atlA strain Δ atlA , harboring pIB184 comS This study Plasmids pDL278 E. coli - Streptococcus shuttle vector, Sp r 51 pIB184 Shuttle expression plasmid with the constitutive P 23 promoter, Em r 25 pPMZ LacZ fusion integration vector based on pMC195 and pMC340B, Km r 52 Open in a separate window a Em, erythromycin; Km, kanamycin; Sp, spectinomycin.

Techniques: Fluorescence, Microscopy, Injection

Journal: Journal of Bacteriology

Article Title: Intercellular Communication via the comX -Inducing Peptide (XIP) of Streptococcus mutans

doi: 10.1128/JB.00404-17

Figure Lengend Snippet: ComRS signaling in biofilms. Observation of ComRS signaling in 18-h biofilms. (A) Selected maximum intensity z-section confocal microcopy images of coculture biofilms. Images are of 10-μm sections of the fluorescence range within the biofilm, collected at 1-μm intervals using a 63×/1.40 numerical aperture (NA) oil objective lens. Labeling of the panels denotes the order of biofilm inoculation at time 0 h. (B) Quadrant analysis of collected flow cytometry data from similarly grown coculture biofilms shown in panel A. The y axes show dsRed intensity and x axes show GFP intensity. Quadrants are set to UA159 control. Flow cytometry data were collected from three independent experiments with triplicate samples.

Article Snippet: The lyophilized sXIP was reconstituted with 99.7% dimethyl sulfoxide (DMSO) to a final concentration of 2 mM and stored in 100-μl aliquots at −20°C. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Relevant characteristics a Source or reference S. mutans strains UA159 Wild type ATCC 700610 UA159/P comX :: gfp UA159 harboring P comX :: gfp 9 P comX :: gfp Δ comS strain Δ comS , harboring P comX :: gfp 9 P comX :: gfp Δ oppA strain Δ oppA , harboring P comX :: gfp 9 P comX :: gfp /pIB184 strain UA159 harboring P comX :: gfp and pIB184 28 P comX :: gfp /pPMZ strain UA159 harboring P comX :: gfp and pPMZ This study UA159/pIB184 comS UA159 harboring pIB184 comS 28 P comS :: dsRed /pIB184 comS strain UA159 harboring P comS :: dsRed and pIB184 comS This study P comX :: dsRed /pIB184 comS strain UA159 harboring P comX :: dsRed and pIB184 comS This study Δ atlA strain atlA (SMU.704c)::NP Km r 39 pIB184 comS Δ atlA strain Δ atlA , harboring pIB184 comS This study Plasmids pDL278 E. coli - Streptococcus shuttle vector, Sp r 51 pIB184 Shuttle expression plasmid with the constitutive P 23 promoter, Em r 25 pPMZ LacZ fusion integration vector based on pMC195 and pMC340B, Km r 52 Open in a separate window a Em, erythromycin; Km, kanamycin; Sp, spectinomycin.

Techniques: Fluorescence, Labeling, Flow Cytometry

Journal: Journal of Bacteriology

Article Title: Intercellular Communication via the comX -Inducing Peptide (XIP) of Streptococcus mutans

doi: 10.1128/JB.00404-17

Figure Lengend Snippet: Impact of sucrose on ComRS signaling in biofilms. Observation of ComRS signaling in 18-h biofilms grown in different concentrations of sucrose. (A) Selected maximum intensity z-section confocal microcopy images of coculture biofilms. Images are 10-μm sections of the fluorescence range within the biofilm, collected at 1-μm intervals using a 63×/1.40 NA oil objective lens. Labeling of the panels denotes the mount of carbohydrate source used in biofilm growth medium (no sucrose, 20 mM glucose; low sucrose, 15 mM glucose and 2.5 mM sucrose; medium sucrose, 10 mM glucose and 5 mM sucrose; high sucrose, 2 mM glucose and 9 mM sucrose). As sucrose is a disaccharide, carbohydrate concentrations (wt/vol) were the same under each condition. (B) Quadrant analysis of flow cytometry data collected from coculture biofilms similarly grown as shown in panel A. The y axes show dsRed intensity and x axes show GFP intensity. Quadrants are set to UA159 control. Flow cytometry data were collected from three independent experiments with triplicate samples. (C and D) Relative GFP expression (C) and relative RFP expression (D) (colored lines) with OD600 measurements (black lines [symbols correspond to symbols for colored lines]) during coculture growth of UA159/pIB184comS and UA159/PcomX::gfp with either no sucrose, low sucrose, medium sucrose, or high sucrose added to the growth medium as a carbohydrate source. Each assay was performed with biological triplicates.

Article Snippet: The lyophilized sXIP was reconstituted with 99.7% dimethyl sulfoxide (DMSO) to a final concentration of 2 mM and stored in 100-μl aliquots at −20°C. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Relevant characteristics a Source or reference S. mutans strains UA159 Wild type ATCC 700610 UA159/P comX :: gfp UA159 harboring P comX :: gfp 9 P comX :: gfp Δ comS strain Δ comS , harboring P comX :: gfp 9 P comX :: gfp Δ oppA strain Δ oppA , harboring P comX :: gfp 9 P comX :: gfp /pIB184 strain UA159 harboring P comX :: gfp and pIB184 28 P comX :: gfp /pPMZ strain UA159 harboring P comX :: gfp and pPMZ This study UA159/pIB184 comS UA159 harboring pIB184 comS 28 P comS :: dsRed /pIB184 comS strain UA159 harboring P comS :: dsRed and pIB184 comS This study P comX :: dsRed /pIB184 comS strain UA159 harboring P comX :: dsRed and pIB184 comS This study Δ atlA strain atlA (SMU.704c)::NP Km r 39 pIB184 comS Δ atlA strain Δ atlA , harboring pIB184 comS This study Plasmids pDL278 E. coli - Streptococcus shuttle vector, Sp r 51 pIB184 Shuttle expression plasmid with the constitutive P 23 promoter, Em r 25 pPMZ LacZ fusion integration vector based on pMC195 and pMC340B, Km r 52 Open in a separate window a Em, erythromycin; Km, kanamycin; Sp, spectinomycin.

Techniques: Fluorescence, Labeling, Flow Cytometry, Expressing

Journal: Journal of Bacteriology

Article Title: Intercellular Communication via the comX -Inducing Peptide (XIP) of Streptococcus mutans

doi: 10.1128/JB.00404-17

Figure Lengend Snippet: Impact of cell lysis on ComRS signaling. Fluorescence reporter activity in arbitrary fluorescent units (colored lines) and growth curves (black lines) of responder strains grown in supernatants of sender strains. (A) GFP fluorescence reported as arbitrary fluorescent units of UA159/PcomX::gfp reporter cells grown in overnight supernatants (filtrates) of either the UA159/pIB184, pIB184 ΔatlA, UA159/pIB184comS, or pIB184comS ΔatlA strain. Overnight supernatants were pH corrected to 7.0 using 6.25 N NaOH, and glucose was replenished to a concentration equivalent to an additional 20 mM before filtering the supernatant fluids through a 0.22-μM PVDF syringe. (B) GFP fluorescence of ΔcomS strain/PcomX::gfp reporter cells grown in overnight supernatants (filtrates) as in panel A. Each assay was performed with biological triplicates.

Article Snippet: The lyophilized sXIP was reconstituted with 99.7% dimethyl sulfoxide (DMSO) to a final concentration of 2 mM and stored in 100-μl aliquots at −20°C. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Relevant characteristics a Source or reference S. mutans strains UA159 Wild type ATCC 700610 UA159/P comX :: gfp UA159 harboring P comX :: gfp 9 P comX :: gfp Δ comS strain Δ comS , harboring P comX :: gfp 9 P comX :: gfp Δ oppA strain Δ oppA , harboring P comX :: gfp 9 P comX :: gfp /pIB184 strain UA159 harboring P comX :: gfp and pIB184 28 P comX :: gfp /pPMZ strain UA159 harboring P comX :: gfp and pPMZ This study UA159/pIB184 comS UA159 harboring pIB184 comS 28 P comS :: dsRed /pIB184 comS strain UA159 harboring P comS :: dsRed and pIB184 comS This study P comX :: dsRed /pIB184 comS strain UA159 harboring P comX :: dsRed and pIB184 comS This study Δ atlA strain atlA (SMU.704c)::NP Km r 39 pIB184 comS Δ atlA strain Δ atlA , harboring pIB184 comS This study Plasmids pDL278 E. coli - Streptococcus shuttle vector, Sp r 51 pIB184 Shuttle expression plasmid with the constitutive P 23 promoter, Em r 25 pPMZ LacZ fusion integration vector based on pMC195 and pMC340B, Km r 52 Open in a separate window a Em, erythromycin; Km, kanamycin; Sp, spectinomycin.

Techniques: Lysis, Fluorescence, Activity Assay, Concentration Assay

Journal: Journal of Bacteriology

Article Title: Intercellular Communication via the comX -Inducing Peptide (XIP) of Streptococcus mutans

doi: 10.1128/JB.00404-17

Figure Lengend Snippet: List of strains and plasmids

Article Snippet: The lyophilized sXIP was reconstituted with 99.7% dimethyl sulfoxide (DMSO) to a final concentration of 2 mM and stored in 100-μl aliquots at −20°C. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Relevant characteristics a Source or reference S. mutans strains UA159 Wild type ATCC 700610 UA159/P comX :: gfp UA159 harboring P comX :: gfp 9 P comX :: gfp Δ comS strain Δ comS , harboring P comX :: gfp 9 P comX :: gfp Δ oppA strain Δ oppA , harboring P comX :: gfp 9 P comX :: gfp /pIB184 strain UA159 harboring P comX :: gfp and pIB184 28 P comX :: gfp /pPMZ strain UA159 harboring P comX :: gfp and pPMZ This study UA159/pIB184 comS UA159 harboring pIB184 comS 28 P comS :: dsRed /pIB184 comS strain UA159 harboring P comS :: dsRed and pIB184 comS This study P comX :: dsRed /pIB184 comS strain UA159 harboring P comX :: dsRed and pIB184 comS This study Δ atlA strain atlA (SMU.704c)::NP Km r 39 pIB184 comS Δ atlA strain Δ atlA , harboring pIB184 comS This study Plasmids pDL278 E. coli - Streptococcus shuttle vector, Sp r 51 pIB184 Shuttle expression plasmid with the constitutive P 23 promoter, Em r 25 pPMZ LacZ fusion integration vector based on pMC195 and pMC340B, Km r 52 Open in a separate window a Em, erythromycin; Km, kanamycin; Sp, spectinomycin.

Techniques: Plasmid Preparation, Expressing