streptavidin hrp conjugate  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Streptavidin horseradish peroxidase conjugate
    Description:
    The streptavidin horseradish peroxidase HRP conjugate can be used to detect biotin in a signal amplification scheme in conjunction with chromogenic substrates or fluorogenic HRP substrates such as the tyramide signal amplification TSA technology
    Catalog Number:
    s911
    Price:
    None
    Applications:
    Antibodies and Secondary Detection|Cell Analysis
    Category:
    Antibodies Secondary Detection Reagents
    Buy from Supplier


    Structured Review

    Thermo Fisher streptavidin hrp conjugate
    Target-selective protein labelling with LDNASA chemistry. a Western blotting analysis of FKBP12 labelling in cell lysates. HeLa cell lysate was mixed with recombinant FKBP12 (1 µM) and incubated with reagent in 50 mM HEPES buffer, pH 7.2, 37 °C, 1 h. <t>SAv-HRP,</t> <t>streptavidin–horseradish</t> peroxidase conjugate; CBB, Coomassie brilliant blue staining. The high background (smear) signals of lane 6 and 7 may suggest unspecific labelling due to a high concentration of reagent (20 µM), whereas such background signals were less in lanes 1–5 (1–5 µM of reagent). b Western blotting analysis of endogenous FKBP12 labelling in live C2C12 cells. The cells were treated with 1 or 5 (1 µM) for 0–120 min at 37 °C in medium. c Time course plot of the endogenous FKBP12 labelling with 1 . d Molecular structures of LDNASA 9 and LDAI 10 for FR labelling. e In-gel fluorescence and western blotting analysis of endogenous FR labelling in KB cells. The cells were treated with 9 or 10 (1 µM) for 0–60 min at 37 °C in medium. FA, Folic acid (competitive inhibitor). f Time profile of the endogenous FR labelling with 9 . I and I 30 min are band intensities of Oregon Green-labelled FR at the indicated time point and at 30 min, respectively. Error bars represent s.d., n = 3
    The streptavidin horseradish peroxidase HRP conjugate can be used to detect biotin in a signal amplification scheme in conjunction with chromogenic substrates or fluorogenic HRP substrates such as the tyramide signal amplification TSA technology
    https://www.bioz.com/result/streptavidin hrp conjugate/product/Thermo Fisher
    Average 99 stars, based on 3885 article reviews
    Price from $9.99 to $1999.99
    streptavidin hrp conjugate - by Bioz Stars, 2020-03
    99/100 stars

    Images

    1) Product Images from "Rapid labelling and covalent inhibition of intracellular native proteins using ligand-directed N-acyl-N-alkyl sulfonamide"

    Article Title: Rapid labelling and covalent inhibition of intracellular native proteins using ligand-directed N-acyl-N-alkyl sulfonamide

    Journal: Nature Communications

    doi: 10.1038/s41467-018-04343-0

    Target-selective protein labelling with LDNASA chemistry. a Western blotting analysis of FKBP12 labelling in cell lysates. HeLa cell lysate was mixed with recombinant FKBP12 (1 µM) and incubated with reagent in 50 mM HEPES buffer, pH 7.2, 37 °C, 1 h. SAv-HRP, streptavidin–horseradish peroxidase conjugate; CBB, Coomassie brilliant blue staining. The high background (smear) signals of lane 6 and 7 may suggest unspecific labelling due to a high concentration of reagent (20 µM), whereas such background signals were less in lanes 1–5 (1–5 µM of reagent). b Western blotting analysis of endogenous FKBP12 labelling in live C2C12 cells. The cells were treated with 1 or 5 (1 µM) for 0–120 min at 37 °C in medium. c Time course plot of the endogenous FKBP12 labelling with 1 . d Molecular structures of LDNASA 9 and LDAI 10 for FR labelling. e In-gel fluorescence and western blotting analysis of endogenous FR labelling in KB cells. The cells were treated with 9 or 10 (1 µM) for 0–60 min at 37 °C in medium. FA, Folic acid (competitive inhibitor). f Time profile of the endogenous FR labelling with 9 . I and I 30 min are band intensities of Oregon Green-labelled FR at the indicated time point and at 30 min, respectively. Error bars represent s.d., n = 3
    Figure Legend Snippet: Target-selective protein labelling with LDNASA chemistry. a Western blotting analysis of FKBP12 labelling in cell lysates. HeLa cell lysate was mixed with recombinant FKBP12 (1 µM) and incubated with reagent in 50 mM HEPES buffer, pH 7.2, 37 °C, 1 h. SAv-HRP, streptavidin–horseradish peroxidase conjugate; CBB, Coomassie brilliant blue staining. The high background (smear) signals of lane 6 and 7 may suggest unspecific labelling due to a high concentration of reagent (20 µM), whereas such background signals were less in lanes 1–5 (1–5 µM of reagent). b Western blotting analysis of endogenous FKBP12 labelling in live C2C12 cells. The cells were treated with 1 or 5 (1 µM) for 0–120 min at 37 °C in medium. c Time course plot of the endogenous FKBP12 labelling with 1 . d Molecular structures of LDNASA 9 and LDAI 10 for FR labelling. e In-gel fluorescence and western blotting analysis of endogenous FR labelling in KB cells. The cells were treated with 9 or 10 (1 µM) for 0–60 min at 37 °C in medium. FA, Folic acid (competitive inhibitor). f Time profile of the endogenous FR labelling with 9 . I and I 30 min are band intensities of Oregon Green-labelled FR at the indicated time point and at 30 min, respectively. Error bars represent s.d., n = 3

    Techniques Used: Western Blot, Recombinant, Incubation, Staining, Concentration Assay, Fluorescence

    2) Product Images from "Embryonic Stem Cell-Like Population in Dupuytren’s Disease Expresses Components of the Renin-Angiotensin System"

    Article Title: Embryonic Stem Cell-Like Population in Dupuytren’s Disease Expresses Components of the Renin-Angiotensin System

    Journal: Plastic and Reconstructive Surgery Global Open

    doi: 10.1097/GOX.0000000000001422

    IF IHC-stained slides of representative DD nodule samples showing coexpression of the endothelial marker CD34 (A, green) and PRR (A, red). PRR (A, red) was also expressed on the surrounding pericyte layer. Expression of ACE (B, green) and ATIIR1 (C, green) on the ERG+ endothelium (B and C, red) was also demonstrated. ATIIR2 (D, red) was also expressed on the endothelium expressing CD34 (D, green). Nuclei were counter-stained with 4’6-diamino-2-phenylindole (A–D, blue). Scale bars: 20 μm.
    Figure Legend Snippet: IF IHC-stained slides of representative DD nodule samples showing coexpression of the endothelial marker CD34 (A, green) and PRR (A, red). PRR (A, red) was also expressed on the surrounding pericyte layer. Expression of ACE (B, green) and ATIIR1 (C, green) on the ERG+ endothelium (B and C, red) was also demonstrated. ATIIR2 (D, red) was also expressed on the endothelium expressing CD34 (D, green). Nuclei were counter-stained with 4’6-diamino-2-phenylindole (A–D, blue). Scale bars: 20 μm.

    Techniques Used: Immunohistochemistry, Staining, Marker, Expressing

    DAB IHC-stained slides of representative DD cord (A, C, E, and G) and DD nodule (B, D, F, and H) samples showing the expression of PRR (A and B, brown), ACE (C and D, brown), ATIIR1 (E and F, brown), and ATIIR2 (G and H, brown) on the microvessels surrounding DD tissue. Expression of PRR, ACE, ATIIR1, and ATIIR2 was localized to the endothelium of these microvessels. PRR was also expressed on the surrounding pericyte layer (A and B). Nuclei were counter-stained with hematoxylin (A-H, blue). Original magnification: 400×.
    Figure Legend Snippet: DAB IHC-stained slides of representative DD cord (A, C, E, and G) and DD nodule (B, D, F, and H) samples showing the expression of PRR (A and B, brown), ACE (C and D, brown), ATIIR1 (E and F, brown), and ATIIR2 (G and H, brown) on the microvessels surrounding DD tissue. Expression of PRR, ACE, ATIIR1, and ATIIR2 was localized to the endothelium of these microvessels. PRR was also expressed on the surrounding pericyte layer (A and B). Nuclei were counter-stained with hematoxylin (A-H, blue). Original magnification: 400×.

    Techniques Used: Immunohistochemistry, Staining, Expressing

    Relative expression of RAS-related mRNA transcripts in DD cords (n = 5) and nodules (n = 5) depicted in RUs as a ratio over the GUSB housekeeper. ATIIR2 was below the detection level. RU, relative unit.
    Figure Legend Snippet: Relative expression of RAS-related mRNA transcripts in DD cords (n = 5) and nodules (n = 5) depicted in RUs as a ratio over the GUSB housekeeper. ATIIR2 was below the detection level. RU, relative unit.

    Techniques Used: Expressing

    Representative WB images of total protein extracted from 3 DD cord and 3 DD nodule tissues from 3 patients demonstrated the presence of PRR (A), ACE (B), and ATIIR2 (C). β-actin confirmed approximately equivalent protein load between samples (A–C).
    Figure Legend Snippet: Representative WB images of total protein extracted from 3 DD cord and 3 DD nodule tissues from 3 patients demonstrated the presence of PRR (A), ACE (B), and ATIIR2 (C). β-actin confirmed approximately equivalent protein load between samples (A–C).

    Techniques Used: Western Blot

    3) Product Images from "Rapid labelling and covalent inhibition of intracellular native proteins using ligand-directed N-acyl-N-alkyl sulfonamide"

    Article Title: Rapid labelling and covalent inhibition of intracellular native proteins using ligand-directed N-acyl-N-alkyl sulfonamide

    Journal: Nature Communications

    doi: 10.1038/s41467-018-04343-0

    Target-selective protein labelling with LDNASA chemistry. a Western blotting analysis of FKBP12 labelling in cell lysates. HeLa cell lysate was mixed with recombinant FKBP12 (1 µM) and incubated with reagent in 50 mM HEPES buffer, pH 7.2, 37 °C, 1 h. SAv-HRP, streptavidin–horseradish peroxidase conjugate; CBB, Coomassie brilliant blue staining. The high background (smear) signals of lane 6 and 7 may suggest unspecific labelling due to a high concentration of reagent (20 µM), whereas such background signals were less in lanes 1–5 (1–5 µM of reagent). b Western blotting analysis of endogenous FKBP12 labelling in live C2C12 cells. The cells were treated with 1 or 5 (1 µM) for 0–120 min at 37 °C in medium. c Time course plot of the endogenous FKBP12 labelling with 1 . d Molecular structures of LDNASA 9 and LDAI 10 for FR labelling. e In-gel fluorescence and western blotting analysis of endogenous FR labelling in KB cells. The cells were treated with 9 or 10 (1 µM) for 0–60 min at 37 °C in medium. FA, Folic acid (competitive inhibitor). f Time profile of the endogenous FR labelling with 9 . I and I 30 min are band intensities of Oregon Green-labelled FR at the indicated time point and at 30 min, respectively. Error bars represent s.d., n = 3
    Figure Legend Snippet: Target-selective protein labelling with LDNASA chemistry. a Western blotting analysis of FKBP12 labelling in cell lysates. HeLa cell lysate was mixed with recombinant FKBP12 (1 µM) and incubated with reagent in 50 mM HEPES buffer, pH 7.2, 37 °C, 1 h. SAv-HRP, streptavidin–horseradish peroxidase conjugate; CBB, Coomassie brilliant blue staining. The high background (smear) signals of lane 6 and 7 may suggest unspecific labelling due to a high concentration of reagent (20 µM), whereas such background signals were less in lanes 1–5 (1–5 µM of reagent). b Western blotting analysis of endogenous FKBP12 labelling in live C2C12 cells. The cells were treated with 1 or 5 (1 µM) for 0–120 min at 37 °C in medium. c Time course plot of the endogenous FKBP12 labelling with 1 . d Molecular structures of LDNASA 9 and LDAI 10 for FR labelling. e In-gel fluorescence and western blotting analysis of endogenous FR labelling in KB cells. The cells were treated with 9 or 10 (1 µM) for 0–60 min at 37 °C in medium. FA, Folic acid (competitive inhibitor). f Time profile of the endogenous FR labelling with 9 . I and I 30 min are band intensities of Oregon Green-labelled FR at the indicated time point and at 30 min, respectively. Error bars represent s.d., n = 3

    Techniques Used: Western Blot, Recombinant, Incubation, Staining, Concentration Assay, Fluorescence

    4) Product Images from "Embryonic Stem Cell-Like Population in Dupuytren’s Disease Expresses Components of the Renin-Angiotensin System"

    Article Title: Embryonic Stem Cell-Like Population in Dupuytren’s Disease Expresses Components of the Renin-Angiotensin System

    Journal: Plastic and Reconstructive Surgery Global Open

    doi: 10.1097/GOX.0000000000001422

    IF IHC-stained slides of representative DD nodule samples showing coexpression of the endothelial marker CD34 (A, green) and PRR (A, red). PRR (A, red) was also expressed on the surrounding pericyte layer. Expression of ACE (B, green) and ATIIR1 (C, green) on the ERG+ endothelium (B and C, red) was also demonstrated. ATIIR2 (D, red) was also expressed on the endothelium expressing CD34 (D, green). Nuclei were counter-stained with 4’6-diamino-2-phenylindole (A–D, blue). Scale bars: 20 μm.
    Figure Legend Snippet: IF IHC-stained slides of representative DD nodule samples showing coexpression of the endothelial marker CD34 (A, green) and PRR (A, red). PRR (A, red) was also expressed on the surrounding pericyte layer. Expression of ACE (B, green) and ATIIR1 (C, green) on the ERG+ endothelium (B and C, red) was also demonstrated. ATIIR2 (D, red) was also expressed on the endothelium expressing CD34 (D, green). Nuclei were counter-stained with 4’6-diamino-2-phenylindole (A–D, blue). Scale bars: 20 μm.

    Techniques Used: Immunohistochemistry, Staining, Marker, Expressing

    DAB IHC-stained slides of representative DD cord (A, C, E, and G) and DD nodule (B, D, F, and H) samples showing the expression of PRR (A and B, brown), ACE (C and D, brown), ATIIR1 (E and F, brown), and ATIIR2 (G and H, brown) on the microvessels surrounding DD tissue. Expression of PRR, ACE, ATIIR1, and ATIIR2 was localized to the endothelium of these microvessels. PRR was also expressed on the surrounding pericyte layer (A and B). Nuclei were counter-stained with hematoxylin (A-H, blue). Original magnification: 400×.
    Figure Legend Snippet: DAB IHC-stained slides of representative DD cord (A, C, E, and G) and DD nodule (B, D, F, and H) samples showing the expression of PRR (A and B, brown), ACE (C and D, brown), ATIIR1 (E and F, brown), and ATIIR2 (G and H, brown) on the microvessels surrounding DD tissue. Expression of PRR, ACE, ATIIR1, and ATIIR2 was localized to the endothelium of these microvessels. PRR was also expressed on the surrounding pericyte layer (A and B). Nuclei were counter-stained with hematoxylin (A-H, blue). Original magnification: 400×.

    Techniques Used: Immunohistochemistry, Staining, Expressing

    5) Product Images from "Effect of LKB1 deficiency on mitochondrial content, fiber type, and muscle performance in the mouse diaphragm"

    Article Title: Effect of LKB1 deficiency on mitochondrial content, fiber type, and muscle performance in the mouse diaphragm

    Journal: Acta physiologica (Oxford, England)

    doi: 10.1111/j.1748-1716.2010.02226.x

    Protein content of peroxisome proliferator-activated receptor-γ coactivator-1α(PGC-1) and mitochondrial proteins in LKB1-deficient mouse diaphragms Western blots showing protein levels of PGC-1, Complex II, Complex 3 Core 2 (Core 2), Cytochrome C, Cytochrome Oxidase I (COX1), ATP Synthase α-subunit (ATP Synthase), Long Chain Acyl Dehydrogenase (LCAD). Values are means ± SE (n = 13–15). *Significantly different from control mice ( P
    Figure Legend Snippet: Protein content of peroxisome proliferator-activated receptor-γ coactivator-1α(PGC-1) and mitochondrial proteins in LKB1-deficient mouse diaphragms Western blots showing protein levels of PGC-1, Complex II, Complex 3 Core 2 (Core 2), Cytochrome C, Cytochrome Oxidase I (COX1), ATP Synthase α-subunit (ATP Synthase), Long Chain Acyl Dehydrogenase (LCAD). Values are means ± SE (n = 13–15). *Significantly different from control mice ( P

    Techniques Used: Western Blot, Pyrolysis Gas Chromatography, Mouse Assay

    6) Product Images from "AKAP95 interacts with nucleoporin TPR in mitosis and is important for the spindle assembly checkpoint"

    Article Title: AKAP95 interacts with nucleoporin TPR in mitosis and is important for the spindle assembly checkpoint

    Journal: Cell Cycle

    doi: 10.1080/15384101.2017.1310350

    Identification of in vivo binding partners of AKAP95. (A) Schematic representation of Myc-BirA*-AKAP95. (B) Western blot analysis using anti-myc antibody and HRP-labeled streptavidin of lysates from Myc-BirA*-AKAP95 expressing- and control U2OS cells cultured as indicated. (C) Immunolocalization of Myc-BirA*-AKAP95 (anti-myc; red) and protein biotinylation (FITC-labeled streptavidin; green) in stable Myc-BirA*–AKAP95 U2OS cells cultured as indicated. Immunolocalization of AKAP95 in U2OS cells (bottom). Scale bar, 5 μm. (D) Gene ontology analysis and nuclear component classification of proteins identified by AKAP95 BioID. (E) Western blot analysis using indicated antibodies of the samples from Myc-BirA*-AKAP95-expressing and control U2OS cells that were subjected to BioID.
    Figure Legend Snippet: Identification of in vivo binding partners of AKAP95. (A) Schematic representation of Myc-BirA*-AKAP95. (B) Western blot analysis using anti-myc antibody and HRP-labeled streptavidin of lysates from Myc-BirA*-AKAP95 expressing- and control U2OS cells cultured as indicated. (C) Immunolocalization of Myc-BirA*-AKAP95 (anti-myc; red) and protein biotinylation (FITC-labeled streptavidin; green) in stable Myc-BirA*–AKAP95 U2OS cells cultured as indicated. Immunolocalization of AKAP95 in U2OS cells (bottom). Scale bar, 5 μm. (D) Gene ontology analysis and nuclear component classification of proteins identified by AKAP95 BioID. (E) Western blot analysis using indicated antibodies of the samples from Myc-BirA*-AKAP95-expressing and control U2OS cells that were subjected to BioID.

    Techniques Used: In Vivo, Binding Assay, Western Blot, Labeling, Expressing, Cell Culture

    7) Product Images from "Embryonic Stem Cell-Like Population in Dupuytren’s Disease Expresses Components of the Renin-Angiotensin System"

    Article Title: Embryonic Stem Cell-Like Population in Dupuytren’s Disease Expresses Components of the Renin-Angiotensin System

    Journal: Plastic and Reconstructive Surgery Global Open

    doi: 10.1097/GOX.0000000000001422

    Representative WB images of total protein extracted from 3 DD cord and 3 DD nodule tissues from 3 patients demonstrated the presence of PRR (A), ACE (B), and ATIIR2 (C). β-actin confirmed approximately equivalent protein load between samples (A–C).
    Figure Legend Snippet: Representative WB images of total protein extracted from 3 DD cord and 3 DD nodule tissues from 3 patients demonstrated the presence of PRR (A), ACE (B), and ATIIR2 (C). β-actin confirmed approximately equivalent protein load between samples (A–C).

    Techniques Used: Western Blot

    Related Articles

    Immunocytochemistry:

    Article Title: Neuronal Expression and Subcellular Localization of Cholesterol 24-Hydroxylase in the Mouse Brain
    Article Snippet: The sections were blocked for at least 1 hour with NGS blocking solution as described above for immunocytochemistry. .. The slides were washed three times for 10 minutes in PBS-T. Streptavidin-horseradish peroxidase conjugate (S911; Invitrogen) was diluted 1:4,000 in 0.5× NGS blocking and incubated for 20 minutes at room temperature.

    Positive Control:

    Article Title: B7 Costimulation Molecules Expressed from the Herpes Simplex Virus 2 Genome Rescue Immune Induction in B7-Deficient Mice ▿
    Article Snippet: BALB/c mice immunized with 5BlacZ were used as a positive control. .. Anti-mouse IgG-biotin (R & D Systems) was used as secondary antibody, and streptavidin-horseradish peroxidase (Pierce) was used as a detection reagent.

    Blocking Assay:

    Article Title: Neuronal Expression and Subcellular Localization of Cholesterol 24-Hydroxylase in the Mouse Brain
    Article Snippet: .. The slides were washed three times for 10 minutes in PBS-T. Streptavidin-horseradish peroxidase conjugate (S911; Invitrogen) was diluted 1:4,000 in 0.5× NGS blocking and incubated for 20 minutes at room temperature. .. The slides were washed three times for 10 minutes in PBS-T. A fresh mixture (1:10) of metal-enhanced diaminobenzidine (DAB) and stable peroxide buffer (34065; Pierce Biotechnology) was prepared and incubated on the slides for 3–5 minutes.

    Article Title: Characterization and Diagnostic Application of Trypanosoma cruzi Trypomastigote Excreted-Secreted Antigens Shed in Extracellular Vesicles Released from Infected Mammalian Cells
    Article Snippet: Western blot analysis of trypomastigote lysates (1 × 105 parasites/lane) or EVs (2 μg/lane) was performed by resolving proteins on a 6% or 8% SDS-PAGE gel, transferring proteins to polyvinylidene difluoride (PVDF) membranes (Bio-Rad, Mississauga, ON, Canada), and blocking with 2% milk powder in PBS containing 0.05% Tween 20 (PBST). .. Bound antibodies were detected using a streptavidin-horseradish peroxidase conjugate (Invitrogen).

    Article Title: Three assays show differences in binding of wild-type and mutant p53 to unique gene sequences
    Article Snippet: .. This membrane was incubated after blocking in a solution containing 1:100,000 dilution of streptavidin horseradish peroxidase (Pierce, Rockford, IL) and visualized using a chemiluminescent substrate (SuperSignal West Pico Chemiluminescent Substrate; Pierce). ..

    Article Title: The Promyelocytic Leukemia Zinc Finger Transcription Factor Is Critical for Human Endometrial Stromal Cell Decidualization
    Article Snippet: After blocking, sections were incubated overnight at 4°C with a rabbit polyclonal anti-human PLZF (H-300) antibody (1:150 dilution; sc-22839, Santa Cruz Biotechnology Inc., Dallas, TX) or anti-human EGR1 (#15F7) antibody (1:150 dilution; Cell Signaling, Danvers, MA). .. After incubation with the primary antibodies, sections were incubated with the goat anti-rabbit IgG secondary antibody (Vector Laboratories, Inc.), followed by incubation with ZyMax streptavidin-horseradish peroxidase conjugate (Invitrogen Corporation, Carlsbad, CA).

    Article Title: Enzyme-Linked Aptamer Assay (ELAA) for Detection of Toxoplasma ROP18 Protein in Human Serum
    Article Snippet: Then, three different conditions were included for the blocking step: 1% BSA (AMRESCO) diluted in PBS-T (Luo et al., ), 5% skimmed milk (Rotherham et al., ) in PBS-T and no blocking, as reported in other studies (Martin et al., ; García-Recio et al., ). .. Then, 5 washes were performed and 100 μL of streptavidin-horseradish peroxidase conjugate (Thermo-Fisher) was added, evaluating three previously reported dilutions, 1:10,000 (Murphy et al., ), 1:15,000 (Rotherham et al., ), and 1:20,000 (Balogh et al., ) diluted in PBS and 1% BSA for 1 h at 37°C.

    Article Title: Design, Synthesis, and Biological Evaluation of N-Carboxyphenylpyrrole Derivatives as Potent HIV Fusion Inhibitors Targeting gp41
    Article Snippet: Briefly, wells of polystyrene plates (Immulon 1B, Dynex Technology, Chantilly, VA) were coated with HIV immunoglobulin (HIVIG), which was prepared from plasma of HIV-seropositive donors with high neutralizing titers against HIV-1IIIB , in 0.085 M carbonate-bicarbonate buffer (pH 9.6) at 4 °C overnight, followed by washes with washing buffer (0.01M PBS containing 0.05% Tween-20) and blocking with PBS containing 1% dry fat-free milk (Bio-Rad, Inc., Hercules, CA). .. Virus lysates were added to the wells and incubated at 37 °C for 1 h. After extensive washes, anti-p24 mAb (183-12H-5C), biotin-labeled anti-mouse IgG1 (Santa Cruz Biotech., Santa Cruz, CA), streptavidin-labeled horseradish peroxidase (Zymed, S. San Francisco, CA), and the substrate 3,3′,5,5′-tetramethylbenzidine (Sigma Chemical Co., St. Louis, MO) were added sequentially.

    Enzyme-linked Immunosorbent Assay:

    Article Title: Pyrrothiogatain acts as an inhibitor of GATA family proteins and inhibits Th2 cell differentiation in vitro
    Article Snippet: .. The amount of cytokines in the recovered supernatants was determined with ELISA using the following antibodies and reagents: anti-IL-4 mAb (Cat#554387, BD Biosciences), biotin-anti-IL-4 mAb (Cat#554390, BD Biosciences), anti-IL-5 mAb (Cat#554393, BD Biosciences), biotin-anti-IL-5 mAb (Cat#554397, BD Biosciences), anti-IFN-γ mAb (Cat#551216, BD Biosciences), biotin-anti-IFN-γ mAb (Cat#554410, BD Biosciences), anti-IL-2 mAb (Cat#554424, BD Biosciences), biotin-anti-IL-2 mAb (Cat#554426, BD Biosciences), streptavidin horseradish peroxidase (Cat#434323, Invitrogen), and TMB peroxidase EIA substrate kit (Cat#1721066, BioRad). .. For IL-13, the mouse IL-13 Duoset ELISA (Cat#DY413, R & D systems) was used for detecting the levels of the IL-13 cytokine.

    Article Title: B7 Costimulation Molecules Expressed from the Herpes Simplex Virus 2 Genome Rescue Immune Induction in B7-Deficient Mice ▿
    Article Snippet: Serum was prepared by clot retraction and analyzed by enzyme-linked immunosorbent assay (ELISA) as previously described ( ). .. Anti-mouse IgG-biotin (R & D Systems) was used as secondary antibody, and streptavidin-horseradish peroxidase (Pierce) was used as a detection reagent.

    Article Title: Design, Synthesis, and Biological Evaluation of N-Carboxyphenylpyrrole Derivatives as Potent HIV Fusion Inhibitors Targeting gp41
    Article Snippet: On the fourth day post-infection, 100 μL of culture supernatants were collected from each well, mixed with equal volumes of 5% Triton X-100 and assayed for p24 antigen, which was quantitated by ELISA. .. Virus lysates were added to the wells and incubated at 37 °C for 1 h. After extensive washes, anti-p24 mAb (183-12H-5C), biotin-labeled anti-mouse IgG1 (Santa Cruz Biotech., Santa Cruz, CA), streptavidin-labeled horseradish peroxidase (Zymed, S. San Francisco, CA), and the substrate 3,3′,5,5′-tetramethylbenzidine (Sigma Chemical Co., St. Louis, MO) were added sequentially.

    Quantitation Assay:

    Article Title: B7 Costimulation Molecules Expressed from the Herpes Simplex Virus 2 Genome Rescue Immune Induction in B7-Deficient Mice ▿
    Article Snippet: Paragraph title: Quantitation of serum antibodies. ... Anti-mouse IgG-biotin (R & D Systems) was used as secondary antibody, and streptavidin-horseradish peroxidase (Pierce) was used as a detection reagent.

    Activity Assay:

    Article Title: Enzyme-Linked Aptamer Assay (ELAA) for Detection of Toxoplasma ROP18 Protein in Human Serum
    Article Snippet: Then, 5 washes were performed and 100 μL of streptavidin-horseradish peroxidase conjugate (Thermo-Fisher) was added, evaluating three previously reported dilutions, 1:10,000 (Murphy et al., ), 1:15,000 (Rotherham et al., ), and 1:20,000 (Balogh et al., ) diluted in PBS and 1% BSA for 1 h at 37°C. .. Finally, after five washes, horseradish peroxidase activity was detected by using TMB for 15 min at room temperature and stopped by adding a 5% of sulfuric acid (H2 SO4 ).

    Article Title: Design, Synthesis, and Biological Evaluation of N-Carboxyphenylpyrrole Derivatives as Potent HIV Fusion Inhibitors Targeting gp41
    Article Snippet: Paragraph title: Determination of the inhibitory activity of the compounds on HIV-1 replication ... Virus lysates were added to the wells and incubated at 37 °C for 1 h. After extensive washes, anti-p24 mAb (183-12H-5C), biotin-labeled anti-mouse IgG1 (Santa Cruz Biotech., Santa Cruz, CA), streptavidin-labeled horseradish peroxidase (Zymed, S. San Francisco, CA), and the substrate 3,3′,5,5′-tetramethylbenzidine (Sigma Chemical Co., St. Louis, MO) were added sequentially.

    Infection:

    Article Title: Design, Synthesis, and Biological Evaluation of N-Carboxyphenylpyrrole Derivatives as Potent HIV Fusion Inhibitors Targeting gp41
    Article Snippet: In brief, 1 × 104 MT-2 cells were infected with an HIV-1 strain (100 TCID50 ) in 200 μL RPMI 1640 medium containing 10% FBS in the presence or absence of a test compound at graded concentrations overnight. .. Virus lysates were added to the wells and incubated at 37 °C for 1 h. After extensive washes, anti-p24 mAb (183-12H-5C), biotin-labeled anti-mouse IgG1 (Santa Cruz Biotech., Santa Cruz, CA), streptavidin-labeled horseradish peroxidase (Zymed, S. San Francisco, CA), and the substrate 3,3′,5,5′-tetramethylbenzidine (Sigma Chemical Co., St. Louis, MO) were added sequentially.

    Expressing:

    Article Title: EphB Receptors Regulate Stem/Progenitor Cell Proliferation, Migration, and Polarity during Hippocampal Neurogenesis
    Article Snippet: To carry out double labeling for calretinin and ephrin-B3 expression, brains from 4% PFA perfused ephrin-B3 lacZ/lacZ animals were vibratome sectioned, washed, and processed overnight in X-gal for detection of the ephrin-B3-β-gal fusion protein. .. After subsequent washing to remove excess X-gal, sections were postfixed in 4% PFA for 15 min, washed, and processed for immunohistochemistry using rabbit anti-calretinin antibodies (Millipore), biotinylated donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA), and streptavidin-horseradish peroxidase (Pierce, Rockford, IL) with the DAB-Plus kit (Zymed, South San Francisco, CA) to label calretinin-positive mossy cells in the DG.

    Western Blot:

    Article Title: Characterization and Diagnostic Application of Trypanosoma cruzi Trypomastigote Excreted-Secreted Antigens Shed in Extracellular Vesicles Released from Infected Mammalian Cells
    Article Snippet: Paragraph title: Western blotting. ... Bound antibodies were detected using a streptavidin-horseradish peroxidase conjugate (Invitrogen).

    Article Title: Rapid labelling and covalent inhibition of intracellular native proteins using ligand-directed N-acyl-N-alkyl sulfonamide
    Article Snippet: .. The samples were analysed by western blotting using Streptavidin-HRP conjugate (SAv-HRP, Thermo, S911, 1:5000) and Coomassie Brilliant Blue (CBB) stain. .. Mouse myoblast C2C12 cells (ATCC) (2.0 × 105 cells) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% foetal bovine serum (FBS, Gibco), penicillin (100 units/ml), streptomycin (100 mg/ml), and amphotericin B (250 ng/ml), and incubated in a 5% CO2 humidified chamber at 37 °C.

    Article Title: Chemical labelling for visualizing native AMPA receptors in live neurons
    Article Snippet: The labelled GluA2 was analyzed using an anti-fluorescein antibody for OG -AMPAR and Fl -AMPAR (abcam, ab19491, × 1,000), anti-Alexa488 antibody for Ax488 -AMPAR (Invitrogen, A11094, × 1,000) or avidin-HRP conjugate for Bt -AMPAR (Invitrogen, S911, × 3,000). .. For western blot analysis of glutamate receptors, a rabbit anti-GluA2 antibody (abcam, ab20673, × 1,000), a mouse anti-GluN1 antibody (BD Pharmingen, 556308, × 1,000), a rabbit anti-GluN2 antibody (Cell Signaling, D15B3, × 1,000), a rabbit anti-GluK2/3 (Millipore, 04-921, × 1,000), and a rabbit anti-GluK5 (Millipore, 06-315, × 1,000) were utilized.

    Immunohistochemistry:

    Article Title: Neuronal Expression and Subcellular Localization of Cholesterol 24-Hydroxylase in the Mouse Brain
    Article Snippet: Paragraph title: Immunohistochemistry ... The slides were washed three times for 10 minutes in PBS-T. Streptavidin-horseradish peroxidase conjugate (S911; Invitrogen) was diluted 1:4,000 in 0.5× NGS blocking and incubated for 20 minutes at room temperature.

    Article Title: EphB Receptors Regulate Stem/Progenitor Cell Proliferation, Migration, and Polarity during Hippocampal Neurogenesis
    Article Snippet: .. After subsequent washing to remove excess X-gal, sections were postfixed in 4% PFA for 15 min, washed, and processed for immunohistochemistry using rabbit anti-calretinin antibodies (Millipore), biotinylated donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA), and streptavidin-horseradish peroxidase (Pierce, Rockford, IL) with the DAB-Plus kit (Zymed, South San Francisco, CA) to label calretinin-positive mossy cells in the DG. .. Alternatively, perfused, vibratome-sectioned brains were processed for immunofluorescence using anti-β-gal and anti-calretinin antibodies as described above.

    Article Title: The Promyelocytic Leukemia Zinc Finger Transcription Factor Is Critical for Human Endometrial Stromal Cell Decidualization
    Article Snippet: For immunohistochemical analyses, sections were deparaffinized before being rehydrated and boiled in a citric acid-based antigen unmasking solution (Vector Laboratories, Inc., Burlingame, CA). .. After incubation with the primary antibodies, sections were incubated with the goat anti-rabbit IgG secondary antibody (Vector Laboratories, Inc.), followed by incubation with ZyMax streptavidin-horseradish peroxidase conjugate (Invitrogen Corporation, Carlsbad, CA).

    Concentration Assay:

    Article Title: Rapid labelling and covalent inhibition of intracellular native proteins using ligand-directed N-acyl-N-alkyl sulfonamide
    Article Snippet: This solution was incubated with recombinant FKBP12 (final concentration 1 µM) and 1 (1 µM) or 8 (1–20 µM) in the absence or presence of Rapamycin (10 or 20 µM) for 1 h at 37 °C. .. The samples were analysed by western blotting using Streptavidin-HRP conjugate (SAv-HRP, Thermo, S911, 1:5000) and Coomassie Brilliant Blue (CBB) stain.

    Protease Inhibitor:

    Article Title: Rapid labelling and covalent inhibition of intracellular native proteins using ligand-directed N-acyl-N-alkyl sulfonamide
    Article Snippet: HeLa cells (kindly gifted from Prof. Yoshiki Katayama) (1×107 cells) were suspended in HEPES buffer (50 mM, pH 7.2) containing 1% protease inhibitor cocktail set III (Calbiochem) and lysed by Potter-Elvehjem homogeniser at 4 °C. .. The samples were analysed by western blotting using Streptavidin-HRP conjugate (SAv-HRP, Thermo, S911, 1:5000) and Coomassie Brilliant Blue (CBB) stain.

    Article Title: Chemical labelling for visualizing native AMPA receptors in live neurons
    Article Snippet: Then, the dishes were washed with ice-cold HBS three times and lysed with RIPA buffer containing 1% protease inhibitor cocktail set III. .. The labelled GluA2 was analyzed using an anti-fluorescein antibody for OG -AMPAR and Fl -AMPAR (abcam, ab19491, × 1,000), anti-Alexa488 antibody for Ax488 -AMPAR (Invitrogen, A11094, × 1,000) or avidin-HRP conjugate for Bt -AMPAR (Invitrogen, S911, × 3,000).

    Transferring:

    Article Title: Characterization and Diagnostic Application of Trypanosoma cruzi Trypomastigote Excreted-Secreted Antigens Shed in Extracellular Vesicles Released from Infected Mammalian Cells
    Article Snippet: Western blot analysis of trypomastigote lysates (1 × 105 parasites/lane) or EVs (2 μg/lane) was performed by resolving proteins on a 6% or 8% SDS-PAGE gel, transferring proteins to polyvinylidene difluoride (PVDF) membranes (Bio-Rad, Mississauga, ON, Canada), and blocking with 2% milk powder in PBS containing 0.05% Tween 20 (PBST). .. Bound antibodies were detected using a streptavidin-horseradish peroxidase conjugate (Invitrogen).

    Cell Culture:

    Article Title: Pyrrothiogatain acts as an inhibitor of GATA family proteins and inhibits Th2 cell differentiation in vitro
    Article Snippet: ELISA assay The CD4+ T cells cultured for five days were stimulated using an immobilized anti-TCR-β mAb (3 µg/mL, H57–597, BioLegend) for 16 h, and the culture supernatants were recovered. .. The amount of cytokines in the recovered supernatants was determined with ELISA using the following antibodies and reagents: anti-IL-4 mAb (Cat#554387, BD Biosciences), biotin-anti-IL-4 mAb (Cat#554390, BD Biosciences), anti-IL-5 mAb (Cat#554393, BD Biosciences), biotin-anti-IL-5 mAb (Cat#554397, BD Biosciences), anti-IFN-γ mAb (Cat#551216, BD Biosciences), biotin-anti-IFN-γ mAb (Cat#554410, BD Biosciences), anti-IL-2 mAb (Cat#554424, BD Biosciences), biotin-anti-IL-2 mAb (Cat#554426, BD Biosciences), streptavidin horseradish peroxidase (Cat#434323, Invitrogen), and TMB peroxidase EIA substrate kit (Cat#1721066, BioRad).

    Article Title: Chemical labelling for visualizing native AMPA receptors in live neurons
    Article Snippet: Chemical labelling of endogenous AMPARs in cortical neurons The cultured cortical neurons were washed with serum free Neurobasal medium (10 mM HEPES), treated with 1 μM labelling reagents ( CAM2(OG) , CAM2(Fl) , CAM2(Ax488) or CAM2(Bt) ) in serum free serum free Neurobasal medium (10 mM HEPES) and incubated at 17 °C for 4 h to suppress internalization of AMPARs . .. The labelled GluA2 was analyzed using an anti-fluorescein antibody for OG -AMPAR and Fl -AMPAR (abcam, ab19491, × 1,000), anti-Alexa488 antibody for Ax488 -AMPAR (Invitrogen, A11094, × 1,000) or avidin-HRP conjugate for Bt -AMPAR (Invitrogen, S911, × 3,000).

    Light Microscopy:

    Article Title: The RNA-binding Protein Fragile X-related 1 Regulates Somite Formation in Xenopus laevis D⃞
    Article Snippet: Bound immunoglobulin was reacted with biotinylated secondary antibodies followed by a streptavidin-peroxidase conjugate and stained with the AEC chromogen (Histomouse-SP kit; Zymed Laboratories, South San Francisco, CA). .. Light microscopy was performed using a Nikon TE300 microscope connected to a CoolSnap camera (RS Photometrics, Trenton, NJ) by using 4×, 10×, 40×, and 60× objectives.

    Generated:

    Article Title: B7 Costimulation Molecules Expressed from the Herpes Simplex Virus 2 Genome Rescue Immune Induction in B7-Deficient Mice ▿
    Article Snippet: Anti-mouse IgG-biotin (R & D Systems) was used as secondary antibody, and streptavidin-horseradish peroxidase (Pierce) was used as a detection reagent. .. Antibody titers were determined by comparison to standard curves generated with serum containing known concentrations of IgG captured on plates coated with goat-anti-kappa light chain antibody (Caltag).

    other:

    Article Title: Single bead-based electrochemical biosensor
    Article Snippet: Streptavidin-horseradish peroxidase conjugate and streptavidin-Alexa Fluor 488 were purchased from Invitrogen (Carlsbad, CA, USA).

    Imaging:

    Article Title: Role of Translational Attenuation in Inherited Retinal Degeneration
    Article Snippet: .. Biotinylated proteins then were probed with HRP-conjugated streptavidin (S911; Thermo Fisher Scientific), incubated in ECL substrate (RPN2232; GE Healthcare, Chicago, IL, USA) and then imaged using a LI-COR (Lincoln, NE, USA) Fc imaging system. .. After imaging, the membrane was stained with coomassie blue G-250 (161-0786; Bio-Rad Laboratories) for 30 minutes and then destained for 30 minutes (water, ethanol, acetic acid at 50:40:10).

    Sequencing:

    Article Title: Three assays show differences in binding of wild-type and mutant p53 to unique gene sequences
    Article Snippet: Double-stranded biotinylated oligonucleotides for the cyclin G wild type promoter sequence (top strand 5' AGGCCAGACCTGCCCGGGCAAGCCTTGGCA 3') , a cyclin G mutant promoter sequence (top strand 5' AGGCCAGACCTGACCGGGAAATCCTTGGCA3') ( ) the mdm2 promoter sequence (top strand 5' CGGAACGTGTCTGAACTTGACCAGCTC 3') ( ) and the 5'- p21 promoter sequence (top strand 5' CGAGGAACATGTCCCAACATGTTGCTCGAG 3') ( , ) were obtained from Integrated DNA Technologies (Coralville, IA) with the biotin label at the 5' end of one of the strands. .. This membrane was incubated after blocking in a solution containing 1:100,000 dilution of streptavidin horseradish peroxidase (Pierce, Rockford, IL) and visualized using a chemiluminescent substrate (SuperSignal West Pico Chemiluminescent Substrate; Pierce).

    Injection:

    Article Title: Role of Translational Attenuation in Inherited Retinal Degeneration
    Article Snippet: Protein Synthesis Analysis Two hours before retinal collection, mice were intraperitoneally injected with Click-it azidohomoalanine (C10102; Thermo Fisher Scientific) at a dosage of 1.20 mg/kg. .. Biotinylated proteins then were probed with HRP-conjugated streptavidin (S911; Thermo Fisher Scientific), incubated in ECL substrate (RPN2232; GE Healthcare, Chicago, IL, USA) and then imaged using a LI-COR (Lincoln, NE, USA) Fc imaging system.

    Binding Assay:

    Article Title: Three assays show differences in binding of wild-type and mutant p53 to unique gene sequences
    Article Snippet: Paragraph title: Electrophoretic mobility shift assay (EMSA) for p53 DNA binding ... This membrane was incubated after blocking in a solution containing 1:100,000 dilution of streptavidin horseradish peroxidase (Pierce, Rockford, IL) and visualized using a chemiluminescent substrate (SuperSignal West Pico Chemiluminescent Substrate; Pierce).

    Article Title: Enzyme-Linked Aptamer Assay (ELAA) for Detection of Toxoplasma ROP18 Protein in Human Serum
    Article Snippet: After washing three times, biotinylated aptamers (200 nM) against ROP18 were added to each well, these oligonucleotides were diluted in binding buffer (PBS, 0.5% glucose, 0.1% albumin and 1 M MgCl2 ) and incubated for 1 h at 37°C. .. Then, 5 washes were performed and 100 μL of streptavidin-horseradish peroxidase conjugate (Thermo-Fisher) was added, evaluating three previously reported dilutions, 1:10,000 (Murphy et al., ), 1:15,000 (Rotherham et al., ), and 1:20,000 (Balogh et al., ) diluted in PBS and 1% BSA for 1 h at 37°C.

    Immunofluorescence:

    Article Title: EphB Receptors Regulate Stem/Progenitor Cell Proliferation, Migration, and Polarity during Hippocampal Neurogenesis
    Article Snippet: Paragraph title: Immunohistochemistry and immunofluorescence. ... After subsequent washing to remove excess X-gal, sections were postfixed in 4% PFA for 15 min, washed, and processed for immunohistochemistry using rabbit anti-calretinin antibodies (Millipore), biotinylated donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA), and streptavidin-horseradish peroxidase (Pierce, Rockford, IL) with the DAB-Plus kit (Zymed, South San Francisco, CA) to label calretinin-positive mossy cells in the DG.

    Mutagenesis:

    Article Title: Three assays show differences in binding of wild-type and mutant p53 to unique gene sequences
    Article Snippet: Double-stranded biotinylated oligonucleotides for the cyclin G wild type promoter sequence (top strand 5' AGGCCAGACCTGCCCGGGCAAGCCTTGGCA 3') , a cyclin G mutant promoter sequence (top strand 5' AGGCCAGACCTGACCGGGAAATCCTTGGCA3') ( ) the mdm2 promoter sequence (top strand 5' CGGAACGTGTCTGAACTTGACCAGCTC 3') ( ) and the 5'- p21 promoter sequence (top strand 5' CGAGGAACATGTCCCAACATGTTGCTCGAG 3') ( , ) were obtained from Integrated DNA Technologies (Coralville, IA) with the biotin label at the 5' end of one of the strands. .. This membrane was incubated after blocking in a solution containing 1:100,000 dilution of streptavidin horseradish peroxidase (Pierce, Rockford, IL) and visualized using a chemiluminescent substrate (SuperSignal West Pico Chemiluminescent Substrate; Pierce).

    Isolation:

    Article Title: Characterization and Diagnostic Application of Trypanosoma cruzi Trypomastigote Excreted-Secreted Antigens Shed in Extracellular Vesicles Released from Infected Mammalian Cells
    Article Snippet: Alternatively, Western blots were probed with either IgG antibodies isolated from uninfected control or Chagas patients with severe cardiomyopathy; samples were biotinylated with biotin– N -hydroxysuccinimide ester for 2 h at 20°C as described by the manufacturer (Invitrogen, Burlington, ON, Canada). .. Bound antibodies were detected using a streptavidin-horseradish peroxidase conjugate (Invitrogen).

    Article Title: EphB Receptors Regulate Stem/Progenitor Cell Proliferation, Migration, and Polarity during Hippocampal Neurogenesis
    Article Snippet: Briefly, fresh brains were isolated from CO2 -killed animals and frozen in JUNG Tissue Freezing Medium (Leica Microsystems, Bannockburn, IL) and immediately cryosectioned on a Leica CM3050S cryostat (Leica Microsystems). .. After subsequent washing to remove excess X-gal, sections were postfixed in 4% PFA for 15 min, washed, and processed for immunohistochemistry using rabbit anti-calretinin antibodies (Millipore), biotinylated donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA), and streptavidin-horseradish peroxidase (Pierce, Rockford, IL) with the DAB-Plus kit (Zymed, South San Francisco, CA) to label calretinin-positive mossy cells in the DG.

    Avidin-Biotin Assay:

    Article Title: Chemical labelling for visualizing native AMPA receptors in live neurons
    Article Snippet: .. The labelled GluA2 was analyzed using an anti-fluorescein antibody for OG -AMPAR and Fl -AMPAR (abcam, ab19491, × 1,000), anti-Alexa488 antibody for Ax488 -AMPAR (Invitrogen, A11094, × 1,000) or avidin-HRP conjugate for Bt -AMPAR (Invitrogen, S911, × 3,000). .. For western blot analysis of glutamate receptors, a rabbit anti-GluA2 antibody (abcam, ab20673, × 1,000), a mouse anti-GluN1 antibody (BD Pharmingen, 556308, × 1,000), a rabbit anti-GluN2 antibody (Cell Signaling, D15B3, × 1,000), a rabbit anti-GluK2/3 (Millipore, 04-921, × 1,000), and a rabbit anti-GluK5 (Millipore, 06-315, × 1,000) were utilized.

    Electrophoretic Mobility Shift Assay:

    Article Title: Three assays show differences in binding of wild-type and mutant p53 to unique gene sequences
    Article Snippet: Paragraph title: Electrophoretic mobility shift assay (EMSA) for p53 DNA binding ... This membrane was incubated after blocking in a solution containing 1:100,000 dilution of streptavidin horseradish peroxidase (Pierce, Rockford, IL) and visualized using a chemiluminescent substrate (SuperSignal West Pico Chemiluminescent Substrate; Pierce).

    Mouse Assay:

    Article Title: B7 Costimulation Molecules Expressed from the Herpes Simplex Virus 2 Genome Rescue Immune Induction in B7-Deficient Mice ▿
    Article Snippet: Blood was collected from the tail vein of mice 24 days postimmunization and 14 days after challenge. .. Anti-mouse IgG-biotin (R & D Systems) was used as secondary antibody, and streptavidin-horseradish peroxidase (Pierce) was used as a detection reagent.

    Article Title: The RNA-binding Protein Fragile X-related 1 Regulates Somite Formation in Xenopus laevis D⃞
    Article Snippet: Xenopus and mice embryos were fixed in a freshly prepared 4% paraformaldehyde solution in PBS for 18 h at 4°C. .. Bound immunoglobulin was reacted with biotinylated secondary antibodies followed by a streptavidin-peroxidase conjugate and stained with the AEC chromogen (Histomouse-SP kit; Zymed Laboratories, South San Francisco, CA).

    Article Title: Role of Translational Attenuation in Inherited Retinal Degeneration
    Article Snippet: Protein Synthesis Analysis Two hours before retinal collection, mice were intraperitoneally injected with Click-it azidohomoalanine (C10102; Thermo Fisher Scientific) at a dosage of 1.20 mg/kg. .. Biotinylated proteins then were probed with HRP-conjugated streptavidin (S911; Thermo Fisher Scientific), incubated in ECL substrate (RPN2232; GE Healthcare, Chicago, IL, USA) and then imaged using a LI-COR (Lincoln, NE, USA) Fc imaging system.

    Labeling:

    Article Title: Three assays show differences in binding of wild-type and mutant p53 to unique gene sequences
    Article Snippet: The nuclear extracts containing the p53 protein (100 pg) from the different human cell lines was incubated with 20 pmole of biotin labeled DNA, 1 μg of non-specific DNA (poly-dAdT; Roche, Indianapolis, IN) in the binding buffer (20 mM Hepes (pH 7.5), 1 mM EDTA, 1 mM DTT, 10 mM (NH4 )2 SO4 , 10 mM KCl, 0.2% Tween-20) in a total volume of 20 μl. .. This membrane was incubated after blocking in a solution containing 1:100,000 dilution of streptavidin horseradish peroxidase (Pierce, Rockford, IL) and visualized using a chemiluminescent substrate (SuperSignal West Pico Chemiluminescent Substrate; Pierce).

    Article Title: EphB Receptors Regulate Stem/Progenitor Cell Proliferation, Migration, and Polarity during Hippocampal Neurogenesis
    Article Snippet: To carry out double labeling for calretinin and ephrin-B3 expression, brains from 4% PFA perfused ephrin-B3 lacZ/lacZ animals were vibratome sectioned, washed, and processed overnight in X-gal for detection of the ephrin-B3-β-gal fusion protein. .. After subsequent washing to remove excess X-gal, sections were postfixed in 4% PFA for 15 min, washed, and processed for immunohistochemistry using rabbit anti-calretinin antibodies (Millipore), biotinylated donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA), and streptavidin-horseradish peroxidase (Pierce, Rockford, IL) with the DAB-Plus kit (Zymed, South San Francisco, CA) to label calretinin-positive mossy cells in the DG.

    IA:

    Article Title: Three assays show differences in binding of wild-type and mutant p53 to unique gene sequences
    Article Snippet: Double-stranded biotinylated oligonucleotides for the cyclin G wild type promoter sequence (top strand 5' AGGCCAGACCTGCCCGGGCAAGCCTTGGCA 3') , a cyclin G mutant promoter sequence (top strand 5' AGGCCAGACCTGACCGGGAAATCCTTGGCA3') ( ) the mdm2 promoter sequence (top strand 5' CGGAACGTGTCTGAACTTGACCAGCTC 3') ( ) and the 5'- p21 promoter sequence (top strand 5' CGAGGAACATGTCCCAACATGTTGCTCGAG 3') ( , ) were obtained from Integrated DNA Technologies (Coralville, IA) with the biotin label at the 5' end of one of the strands. .. This membrane was incubated after blocking in a solution containing 1:100,000 dilution of streptavidin horseradish peroxidase (Pierce, Rockford, IL) and visualized using a chemiluminescent substrate (SuperSignal West Pico Chemiluminescent Substrate; Pierce).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Pyrrothiogatain acts as an inhibitor of GATA family proteins and inhibits Th2 cell differentiation in vitro
    Article Snippet: .. The amount of cytokines in the recovered supernatants was determined with ELISA using the following antibodies and reagents: anti-IL-4 mAb (Cat554387, BD Biosciences), biotin-anti-IL-4 mAb (Cat#554390, BD Biosciences), anti-IL-5 mAb (Cat#554393, BD Biosciences), biotin-anti-IL-5 mAb (Cat#554397, BD Biosciences), anti-IFN-γ mAb (Cat#551216, BD Biosciences), biotin-anti-IFN-γ mAb (Cat#554410, BD Biosciences), anti-IL-2 mAb (Cat#554424, BD Biosciences), biotin-anti-IL-2 mAb (Cat#554426, BD Biosciences), streptavidin horseradish peroxidase (Cat#434323, Invitrogen), and TMB peroxidase EIA substrate kit (Cat#1721066, BioRad). .. For IL-13, the mouse IL-13 Duoset ELISA (Cat#DY413, R & D systems) was used for detecting the levels of the IL-13 cytokine.

    SDS Page:

    Article Title: Characterization and Diagnostic Application of Trypanosoma cruzi Trypomastigote Excreted-Secreted Antigens Shed in Extracellular Vesicles Released from Infected Mammalian Cells
    Article Snippet: Western blot analysis of trypomastigote lysates (1 × 105 parasites/lane) or EVs (2 μg/lane) was performed by resolving proteins on a 6% or 8% SDS-PAGE gel, transferring proteins to polyvinylidene difluoride (PVDF) membranes (Bio-Rad, Mississauga, ON, Canada), and blocking with 2% milk powder in PBS containing 0.05% Tween 20 (PBST). .. Bound antibodies were detected using a streptavidin-horseradish peroxidase conjugate (Invitrogen).

    Article Title: Chemical labelling for visualizing native AMPA receptors in live neurons
    Article Snippet: After mixing with a quarter volume of 5 × SDS–PAGE loading buffer containing 250 mM DTT, the following electrophoresis processes were similarly performed as described above. .. The labelled GluA2 was analyzed using an anti-fluorescein antibody for OG -AMPAR and Fl -AMPAR (abcam, ab19491, × 1,000), anti-Alexa488 antibody for Ax488 -AMPAR (Invitrogen, A11094, × 1,000) or avidin-HRP conjugate for Bt -AMPAR (Invitrogen, S911, × 3,000).

    Article Title: Role of Translational Attenuation in Inherited Retinal Degeneration
    Article Snippet: After the tagged proteins were precipitated to remove reaction components, they were resolubilized in 1 × SDS-loading buffer (2% SDS, 10% glycerol, 0.005% bromophenol blue, and 5% 2-mercaptoethanol) and heated at 95°C for 10 minutes before half of the reaction (∼50 μg) was separated by SDS-PAGE (4568093, 4568096; Bio-Rad Laboratories). .. Biotinylated proteins then were probed with HRP-conjugated streptavidin (S911; Thermo Fisher Scientific), incubated in ECL substrate (RPN2232; GE Healthcare, Chicago, IL, USA) and then imaged using a LI-COR (Lincoln, NE, USA) Fc imaging system.

    Plasmid Preparation:

    Article Title: The Promyelocytic Leukemia Zinc Finger Transcription Factor Is Critical for Human Endometrial Stromal Cell Decidualization
    Article Snippet: After incubation with the primary antibodies, sections were incubated with the goat anti-rabbit IgG secondary antibody (Vector Laboratories, Inc.), followed by incubation with ZyMax streptavidin-horseradish peroxidase conjugate (Invitrogen Corporation, Carlsbad, CA). .. After incubation with the primary antibodies, sections were incubated with the goat anti-rabbit IgG secondary antibody (Vector Laboratories, Inc.), followed by incubation with ZyMax streptavidin-horseradish peroxidase conjugate (Invitrogen Corporation, Carlsbad, CA).

    Software:

    Article Title: Role of Translational Attenuation in Inherited Retinal Degeneration
    Article Snippet: Biotinylated proteins then were probed with HRP-conjugated streptavidin (S911; Thermo Fisher Scientific), incubated in ECL substrate (RPN2232; GE Healthcare, Chicago, IL, USA) and then imaged using a LI-COR (Lincoln, NE, USA) Fc imaging system. .. Densitometry analyses were performed on entire lanes using ImageJ software.

    Microscopy:

    Article Title: EphB Receptors Regulate Stem/Progenitor Cell Proliferation, Migration, and Polarity during Hippocampal Neurogenesis
    Article Snippet: Slides were counterstained in Nuclear Fast Red solution (Polysciences, Warrington, PA) and color images obtained with a Nikon (Tokyo, Japan) DMX-1200 color digital camera on an Olympus (Tokyo, Japan) BX-50 microscope. .. After subsequent washing to remove excess X-gal, sections were postfixed in 4% PFA for 15 min, washed, and processed for immunohistochemistry using rabbit anti-calretinin antibodies (Millipore), biotinylated donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA), and streptavidin-horseradish peroxidase (Pierce, Rockford, IL) with the DAB-Plus kit (Zymed, South San Francisco, CA) to label calretinin-positive mossy cells in the DG.

    Article Title: The RNA-binding Protein Fragile X-related 1 Regulates Somite Formation in Xenopus laevis D⃞
    Article Snippet: Bound immunoglobulin was reacted with biotinylated secondary antibodies followed by a streptavidin-peroxidase conjugate and stained with the AEC chromogen (Histomouse-SP kit; Zymed Laboratories, South San Francisco, CA). .. Light microscopy was performed using a Nikon TE300 microscope connected to a CoolSnap camera (RS Photometrics, Trenton, NJ) by using 4×, 10×, 40×, and 60× objectives.

    Electrophoresis:

    Article Title: Chemical labelling for visualizing native AMPA receptors in live neurons
    Article Snippet: After mixing with a quarter volume of 5 × SDS–PAGE loading buffer containing 250 mM DTT, the following electrophoresis processes were similarly performed as described above. .. The labelled GluA2 was analyzed using an anti-fluorescein antibody for OG -AMPAR and Fl -AMPAR (abcam, ab19491, × 1,000), anti-Alexa488 antibody for Ax488 -AMPAR (Invitrogen, A11094, × 1,000) or avidin-HRP conjugate for Bt -AMPAR (Invitrogen, S911, × 3,000).

    Recombinant:

    Article Title: Characterization and Diagnostic Application of Trypanosoma cruzi Trypomastigote Excreted-Secreted Antigens Shed in Extracellular Vesicles Released from Infected Mammalian Cells
    Article Snippet: Bound antibodies were detected using a streptavidin-horseradish peroxidase conjugate (Invitrogen). .. For Western blot analysis using recombinant protein, ∼1.0 μg of PFR1 or RHS, or 10 μg of TESA EVs, was resolved on an 8% SDS-PAGE gel and transferred to a PVDF membrane, and membranes were blocked with 2% skimmed milk powder prior to probing with antisera (1:2,000 dilution) from uninfected controls or Chagas patients with asymptomatic clinical signs, ECG abnormalities, or ventricular arrhythmia.

    Article Title: Rapid labelling and covalent inhibition of intracellular native proteins using ligand-directed N-acyl-N-alkyl sulfonamide
    Article Snippet: This solution was incubated with recombinant FKBP12 (final concentration 1 µM) and 1 (1 µM) or 8 (1–20 µM) in the absence or presence of Rapamycin (10 or 20 µM) for 1 h at 37 °C. .. The samples were analysed by western blotting using Streptavidin-HRP conjugate (SAv-HRP, Thermo, S911, 1:5000) and Coomassie Brilliant Blue (CBB) stain.

    Article Title: Design, Synthesis, and Biological Evaluation of N-Carboxyphenylpyrrole Derivatives as Potent HIV Fusion Inhibitors Targeting gp41
    Article Snippet: Virus lysates were added to the wells and incubated at 37 °C for 1 h. After extensive washes, anti-p24 mAb (183-12H-5C), biotin-labeled anti-mouse IgG1 (Santa Cruz Biotech., Santa Cruz, CA), streptavidin-labeled horseradish peroxidase (Zymed, S. San Francisco, CA), and the substrate 3,3′,5,5′-tetramethylbenzidine (Sigma Chemical Co., St. Louis, MO) were added sequentially. .. Recombinant protein p24 purchased from US Biological Swampscott, MA) was included for establishing standard dose response curves.

    Next-Generation Sequencing:

    Article Title: Neuronal Expression and Subcellular Localization of Cholesterol 24-Hydroxylase in the Mouse Brain
    Article Snippet: .. The slides were washed three times for 10 minutes in PBS-T. Streptavidin-horseradish peroxidase conjugate (S911; Invitrogen) was diluted 1:4,000 in 0.5× NGS blocking and incubated for 20 minutes at room temperature. .. The slides were washed three times for 10 minutes in PBS-T. A fresh mixture (1:10) of metal-enhanced diaminobenzidine (DAB) and stable peroxide buffer (34065; Pierce Biotechnology) was prepared and incubated on the slides for 3–5 minutes.

    Incubation:

    Article Title: Neuronal Expression and Subcellular Localization of Cholesterol 24-Hydroxylase in the Mouse Brain
    Article Snippet: .. The slides were washed three times for 10 minutes in PBS-T. Streptavidin-horseradish peroxidase conjugate (S911; Invitrogen) was diluted 1:4,000 in 0.5× NGS blocking and incubated for 20 minutes at room temperature. .. The slides were washed three times for 10 minutes in PBS-T. A fresh mixture (1:10) of metal-enhanced diaminobenzidine (DAB) and stable peroxide buffer (34065; Pierce Biotechnology) was prepared and incubated on the slides for 3–5 minutes.

    Article Title: Rapid labelling and covalent inhibition of intracellular native proteins using ligand-directed N-acyl-N-alkyl sulfonamide
    Article Snippet: The reaction mixture was mixed with 1/4 volume of 5 × sample buffer (pH 6.8, 312.5 mM Tris–HCl, 25% sucrose, 10% SDS, 0.025% bromophenol blue) containing 250 mM DTT and incubated for 1 h at 25 °C. .. The samples were analysed by western blotting using Streptavidin-HRP conjugate (SAv-HRP, Thermo, S911, 1:5000) and Coomassie Brilliant Blue (CBB) stain.

    Article Title: Three assays show differences in binding of wild-type and mutant p53 to unique gene sequences
    Article Snippet: .. This membrane was incubated after blocking in a solution containing 1:100,000 dilution of streptavidin horseradish peroxidase (Pierce, Rockford, IL) and visualized using a chemiluminescent substrate (SuperSignal West Pico Chemiluminescent Substrate; Pierce). ..

    Article Title: EphB Receptors Regulate Stem/Progenitor Cell Proliferation, Migration, and Polarity during Hippocampal Neurogenesis
    Article Snippet: Sections were postfixed on slides in 4% PFA and incubated overnight at 37°C in X-gal solution. .. After subsequent washing to remove excess X-gal, sections were postfixed in 4% PFA for 15 min, washed, and processed for immunohistochemistry using rabbit anti-calretinin antibodies (Millipore), biotinylated donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA), and streptavidin-horseradish peroxidase (Pierce, Rockford, IL) with the DAB-Plus kit (Zymed, South San Francisco, CA) to label calretinin-positive mossy cells in the DG.

    Article Title: The RNA-binding Protein Fragile X-related 1 Regulates Somite Formation in Xenopus laevis D⃞
    Article Snippet: Endogenous peroxidase was inhibited by a 15-min treatment with 0.5% H2 O2 solution in PBS, and the sections were next incubated for 18 h at 4°C with antiserum #27-17 (dilution 1:500) or mAb3FX (dilution 1:500). .. Bound immunoglobulin was reacted with biotinylated secondary antibodies followed by a streptavidin-peroxidase conjugate and stained with the AEC chromogen (Histomouse-SP kit; Zymed Laboratories, South San Francisco, CA).

    Article Title: The Promyelocytic Leukemia Zinc Finger Transcription Factor Is Critical for Human Endometrial Stromal Cell Decidualization
    Article Snippet: .. After incubation with the primary antibodies, sections were incubated with the goat anti-rabbit IgG secondary antibody (Vector Laboratories, Inc.), followed by incubation with ZyMax streptavidin-horseradish peroxidase conjugate (Invitrogen Corporation, Carlsbad, CA). .. The 3, 3’-diaminobenzidine (DAB) peroxidase substrate kit (Vector Laboratories, Inc.) was used to visualize immunoreactivity before sections were counterstained with hematoxylin.

    Article Title: Chemical labelling for visualizing native AMPA receptors in live neurons
    Article Snippet: Chemical labelling of endogenous AMPARs in cortical neurons The cultured cortical neurons were washed with serum free Neurobasal medium (10 mM HEPES), treated with 1 μM labelling reagents ( CAM2(OG) , CAM2(Fl) , CAM2(Ax488) or CAM2(Bt) ) in serum free serum free Neurobasal medium (10 mM HEPES) and incubated at 17 °C for 4 h to suppress internalization of AMPARs . .. The labelled GluA2 was analyzed using an anti-fluorescein antibody for OG -AMPAR and Fl -AMPAR (abcam, ab19491, × 1,000), anti-Alexa488 antibody for Ax488 -AMPAR (Invitrogen, A11094, × 1,000) or avidin-HRP conjugate for Bt -AMPAR (Invitrogen, S911, × 3,000).

    Article Title: Enzyme-Linked Aptamer Assay (ELAA) for Detection of Toxoplasma ROP18 Protein in Human Serum
    Article Snippet: After washing three times, biotinylated aptamers (200 nM) against ROP18 were added to each well, these oligonucleotides were diluted in binding buffer (PBS, 0.5% glucose, 0.1% albumin and 1 M MgCl2 ) and incubated for 1 h at 37°C. .. Then, 5 washes were performed and 100 μL of streptavidin-horseradish peroxidase conjugate (Thermo-Fisher) was added, evaluating three previously reported dilutions, 1:10,000 (Murphy et al., ), 1:15,000 (Rotherham et al., ), and 1:20,000 (Balogh et al., ) diluted in PBS and 1% BSA for 1 h at 37°C.

    Article Title: Role of Translational Attenuation in Inherited Retinal Degeneration
    Article Snippet: .. Biotinylated proteins then were probed with HRP-conjugated streptavidin (S911; Thermo Fisher Scientific), incubated in ECL substrate (RPN2232; GE Healthcare, Chicago, IL, USA) and then imaged using a LI-COR (Lincoln, NE, USA) Fc imaging system. .. After imaging, the membrane was stained with coomassie blue G-250 (161-0786; Bio-Rad Laboratories) for 30 minutes and then destained for 30 minutes (water, ethanol, acetic acid at 50:40:10).

    Article Title: Design, Synthesis, and Biological Evaluation of N-Carboxyphenylpyrrole Derivatives as Potent HIV Fusion Inhibitors Targeting gp41
    Article Snippet: .. Virus lysates were added to the wells and incubated at 37 °C for 1 h. After extensive washes, anti-p24 mAb (183-12H-5C), biotin-labeled anti-mouse IgG1 (Santa Cruz Biotech., Santa Cruz, CA), streptavidin-labeled horseradish peroxidase (Zymed, S. San Francisco, CA), and the substrate 3,3′,5,5′-tetramethylbenzidine (Sigma Chemical Co., St. Louis, MO) were added sequentially. ..

    Spectrophotometry:

    Article Title: Enzyme-Linked Aptamer Assay (ELAA) for Detection of Toxoplasma ROP18 Protein in Human Serum
    Article Snippet: Then, 5 washes were performed and 100 μL of streptavidin-horseradish peroxidase conjugate (Thermo-Fisher) was added, evaluating three previously reported dilutions, 1:10,000 (Murphy et al., ), 1:15,000 (Rotherham et al., ), and 1:20,000 (Balogh et al., ) diluted in PBS and 1% BSA for 1 h at 37°C. .. The absorbance at 450 nm was read in an Epoch 2 spectrophotometer (BioTek Instruments, Winooski, VT, USA).

    Immunoprecipitation:

    Article Title: Chemical labelling for visualizing native AMPA receptors in live neurons
    Article Snippet: The labelled GluA2 was analyzed using an anti-fluorescein antibody for OG -AMPAR and Fl -AMPAR (abcam, ab19491, × 1,000), anti-Alexa488 antibody for Ax488 -AMPAR (Invitrogen, A11094, × 1,000) or avidin-HRP conjugate for Bt -AMPAR (Invitrogen, S911, × 3,000). .. For immunoprecipitation, an anti-fluorescein antibody (Abcam, ab19491) was utilized.

    Staining:

    Article Title: Rapid labelling and covalent inhibition of intracellular native proteins using ligand-directed N-acyl-N-alkyl sulfonamide
    Article Snippet: .. The samples were analysed by western blotting using Streptavidin-HRP conjugate (SAv-HRP, Thermo, S911, 1:5000) and Coomassie Brilliant Blue (CBB) stain. .. Mouse myoblast C2C12 cells (ATCC) (2.0 × 105 cells) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% foetal bovine serum (FBS, Gibco), penicillin (100 units/ml), streptomycin (100 mg/ml), and amphotericin B (250 ng/ml), and incubated in a 5% CO2 humidified chamber at 37 °C.

    Article Title: EphB Receptors Regulate Stem/Progenitor Cell Proliferation, Migration, and Polarity during Hippocampal Neurogenesis
    Article Snippet: 5-Bromo-4-chloro-3-indolyl-β- d -galactopyranoside (X-gal) staining procedures have been previously described ( ). .. After subsequent washing to remove excess X-gal, sections were postfixed in 4% PFA for 15 min, washed, and processed for immunohistochemistry using rabbit anti-calretinin antibodies (Millipore), biotinylated donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA), and streptavidin-horseradish peroxidase (Pierce, Rockford, IL) with the DAB-Plus kit (Zymed, South San Francisco, CA) to label calretinin-positive mossy cells in the DG.

    Article Title: The RNA-binding Protein Fragile X-related 1 Regulates Somite Formation in Xenopus laevis D⃞
    Article Snippet: .. Bound immunoglobulin was reacted with biotinylated secondary antibodies followed by a streptavidin-peroxidase conjugate and stained with the AEC chromogen (Histomouse-SP kit; Zymed Laboratories, South San Francisco, CA). .. The slides were then mounted in GVA Mount (Zymed Laboratories).

    Article Title: The Promyelocytic Leukemia Zinc Finger Transcription Factor Is Critical for Human Endometrial Stromal Cell Decidualization
    Article Snippet: After incubation with the primary antibodies, sections were incubated with the goat anti-rabbit IgG secondary antibody (Vector Laboratories, Inc.), followed by incubation with ZyMax streptavidin-horseradish peroxidase conjugate (Invitrogen Corporation, Carlsbad, CA). .. Cover slips were mounted onto stained sections using Slowfade mounting media (Fisher Scientific, Inc.).

    Article Title: Role of Translational Attenuation in Inherited Retinal Degeneration
    Article Snippet: Biotinylated proteins then were probed with HRP-conjugated streptavidin (S911; Thermo Fisher Scientific), incubated in ECL substrate (RPN2232; GE Healthcare, Chicago, IL, USA) and then imaged using a LI-COR (Lincoln, NE, USA) Fc imaging system. .. After imaging, the membrane was stained with coomassie blue G-250 (161-0786; Bio-Rad Laboratories) for 30 minutes and then destained for 30 minutes (water, ethanol, acetic acid at 50:40:10).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher horseradish peroxidase hrp conjugated streptavidin
    Horseradish Peroxidase Hrp Conjugated Streptavidin, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/horseradish peroxidase hrp conjugated streptavidin/product/Thermo Fisher
    Average 99 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    horseradish peroxidase hrp conjugated streptavidin - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results