Structured Review

Fisher Scientific steponeplus
Steponeplus, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 90/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/steponeplus/product/Fisher Scientific
Average 90 stars, based on 5 article reviews
Price from $9.99 to $1999.99
steponeplus - by Bioz Stars, 2020-02
90/100 stars

Images

Related Articles

Real-time Polymerase Chain Reaction:

Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
Article Snippet: .. Briefly, total RNA was extracted with the RNeasy Plant Mini kit (Qiagen) and DNase treated (DNA‐free; Ambion). cDNA was typically synthesized from 1 μg of total RNA using random hexamers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific U.K. Ltd., Loughborough, U.K.) real‐time PCR system. .. The average Ct values for PP2A (At1g13320, primers PP2A‐f2; 5′‐TAACGTGGCCAAAATGATGC‐3′ and PP2A‐r2; 5′‐GTTCTCCACAACCGCTTGGT‐3′) was used as internal control for expression levels.

Article Title: Cold-Dependent Expression and Alternative Splicing of Arabidopsis Long Non-coding RNAs
Article Snippet: .. Each reaction (1:100 dilution of cDNA) was performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific-UK Ltd., Loughborough, United Kingdom) real-time PCR system. .. The average Ct values for IPP2 (AT3G02780) were used as internal control expression levels.

Article Title: How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY), et al. How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY)
Article Snippet: .. Complementary DNA (cDNA) was typically synthesized from 2 μg of total RNA using oligo dT primers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system. .. The average Ct values for PP2A (At1g13320) and IPP2 (At3g02780) were used as internal control expression levels.

Article Title: Organ specificity in the plant circadian system is explained by different light inputs to the shoot and root clocks
Article Snippet: .. Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using oligo dT and SuperScript II reverse transcriptase (Invitrogen). qPCR reactions were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a Mx3000P (Agilent Technologies Ltd, Stockport, UK) or a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system. .. IRON SULFUR CLUSTER ASSEMBLY PROTEIN 1 (ISU1 , At4G22220) was used as the reference gene as its expression has been shown not to cycle over a range of conditions (Michael et al ., ).

RNA Extraction:

Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
Article Snippet: Paragraph title: 2.7. RNA extraction, c DNA synthesis, and q PCR ... Briefly, total RNA was extracted with the RNeasy Plant Mini kit (Qiagen) and DNase treated (DNA‐free; Ambion). cDNA was typically synthesized from 1 μg of total RNA using random hexamers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific U.K. Ltd., Loughborough, U.K.) real‐time PCR system.

Article Title: How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY), et al. How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY)
Article Snippet: Paragraph title: RNA extraction, cDNA synthesis, RT‐PCR, and qPCR ... Complementary DNA (cDNA) was typically synthesized from 2 μg of total RNA using oligo dT primers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system.

Article Title: Organ specificity in the plant circadian system is explained by different light inputs to the shoot and root clocks
Article Snippet: Paragraph title: RNA extraction and quantification by RT‐qPCR ... Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using oligo dT and SuperScript II reverse transcriptase (Invitrogen). qPCR reactions were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a Mx3000P (Agilent Technologies Ltd, Stockport, UK) or a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system.

DNA Synthesis:

Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
Article Snippet: Paragraph title: 2.7. RNA extraction, c DNA synthesis, and q PCR ... Briefly, total RNA was extracted with the RNeasy Plant Mini kit (Qiagen) and DNase treated (DNA‐free; Ambion). cDNA was typically synthesized from 1 μg of total RNA using random hexamers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific U.K. Ltd., Loughborough, U.K.) real‐time PCR system.

Synthesized:

Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
Article Snippet: .. Briefly, total RNA was extracted with the RNeasy Plant Mini kit (Qiagen) and DNase treated (DNA‐free; Ambion). cDNA was typically synthesized from 1 μg of total RNA using random hexamers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific U.K. Ltd., Loughborough, U.K.) real‐time PCR system. .. The average Ct values for PP2A (At1g13320, primers PP2A‐f2; 5′‐TAACGTGGCCAAAATGATGC‐3′ and PP2A‐r2; 5′‐GTTCTCCACAACCGCTTGGT‐3′) was used as internal control for expression levels.

Article Title: Cold-Dependent Expression and Alternative Splicing of Arabidopsis Long Non-coding RNAs
Article Snippet: Complementary DNA (cDNA) was synthesized from 2 μg of total RNA using oligo dT primers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). .. Each reaction (1:100 dilution of cDNA) was performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific-UK Ltd., Loughborough, United Kingdom) real-time PCR system.

Article Title: How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY), et al. How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY)
Article Snippet: .. Complementary DNA (cDNA) was typically synthesized from 2 μg of total RNA using oligo dT primers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system. .. The average Ct values for PP2A (At1g13320) and IPP2 (At3g02780) were used as internal control expression levels.

Article Title: Organ specificity in the plant circadian system is explained by different light inputs to the shoot and root clocks
Article Snippet: .. Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using oligo dT and SuperScript II reverse transcriptase (Invitrogen). qPCR reactions were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a Mx3000P (Agilent Technologies Ltd, Stockport, UK) or a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system. .. IRON SULFUR CLUSTER ASSEMBLY PROTEIN 1 (ISU1 , At4G22220) was used as the reference gene as its expression has been shown not to cycle over a range of conditions (Michael et al ., ).

Quantitative RT-PCR:

Article Title: Cold-Dependent Expression and Alternative Splicing of Arabidopsis Long Non-coding RNAs
Article Snippet: Paragraph title: Quantitative Reverse Transcription RT-PCR (RT-qPCR) ... Each reaction (1:100 dilution of cDNA) was performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific-UK Ltd., Loughborough, United Kingdom) real-time PCR system.

Article Title: How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY), et al. How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY)
Article Snippet: 2.2 RNA extraction, cDNA synthesis, RT‐PCR, and qPCR RNA extraction, cDNA synthesis, and qPCR (RT‐qPCR) were performed essentially as described previously (James et al., ; James, Syed, Bordage, et al., ). .. Complementary DNA (cDNA) was typically synthesized from 2 μg of total RNA using oligo dT primers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system.

Article Title: Organ specificity in the plant circadian system is explained by different light inputs to the shoot and root clocks
Article Snippet: Paragraph title: RNA extraction and quantification by RT‐qPCR ... Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using oligo dT and SuperScript II reverse transcriptase (Invitrogen). qPCR reactions were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a Mx3000P (Agilent Technologies Ltd, Stockport, UK) or a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system.

SYBR Green Assay:

Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
Article Snippet: .. Briefly, total RNA was extracted with the RNeasy Plant Mini kit (Qiagen) and DNase treated (DNA‐free; Ambion). cDNA was typically synthesized from 1 μg of total RNA using random hexamers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific U.K. Ltd., Loughborough, U.K.) real‐time PCR system. .. The average Ct values for PP2A (At1g13320, primers PP2A‐f2; 5′‐TAACGTGGCCAAAATGATGC‐3′ and PP2A‐r2; 5′‐GTTCTCCACAACCGCTTGGT‐3′) was used as internal control for expression levels.

Article Title: Cold-Dependent Expression and Alternative Splicing of Arabidopsis Long Non-coding RNAs
Article Snippet: .. Each reaction (1:100 dilution of cDNA) was performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific-UK Ltd., Loughborough, United Kingdom) real-time PCR system. .. The average Ct values for IPP2 (AT3G02780) were used as internal control expression levels.

Article Title: How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY), et al. How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY)
Article Snippet: .. Complementary DNA (cDNA) was typically synthesized from 2 μg of total RNA using oligo dT primers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system. .. The average Ct values for PP2A (At1g13320) and IPP2 (At3g02780) were used as internal control expression levels.

Article Title: Organ specificity in the plant circadian system is explained by different light inputs to the shoot and root clocks
Article Snippet: .. Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using oligo dT and SuperScript II reverse transcriptase (Invitrogen). qPCR reactions were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a Mx3000P (Agilent Technologies Ltd, Stockport, UK) or a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system. .. IRON SULFUR CLUSTER ASSEMBLY PROTEIN 1 (ISU1 , At4G22220) was used as the reference gene as its expression has been shown not to cycle over a range of conditions (Michael et al ., ).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Cold-Dependent Expression and Alternative Splicing of Arabidopsis Long Non-coding RNAs
Article Snippet: Paragraph title: Quantitative Reverse Transcription RT-PCR (RT-qPCR) ... Each reaction (1:100 dilution of cDNA) was performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific-UK Ltd., Loughborough, United Kingdom) real-time PCR system.

Article Title: How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY), et al. How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY)
Article Snippet: Paragraph title: RNA extraction, cDNA synthesis, RT‐PCR, and qPCR ... Complementary DNA (cDNA) was typically synthesized from 2 μg of total RNA using oligo dT primers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system.

Polymerase Chain Reaction:

Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
Article Snippet: Paragraph title: 2.7. RNA extraction, c DNA synthesis, and q PCR ... Briefly, total RNA was extracted with the RNeasy Plant Mini kit (Qiagen) and DNase treated (DNA‐free; Ambion). cDNA was typically synthesized from 1 μg of total RNA using random hexamers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific U.K. Ltd., Loughborough, U.K.) real‐time PCR system.

Article Title: Organ specificity in the plant circadian system is explained by different light inputs to the shoot and root clocks
Article Snippet: Absence of genomic DNA contamination was confirmed by PCR with ACTIN2 gene primers. .. Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using oligo dT and SuperScript II reverse transcriptase (Invitrogen). qPCR reactions were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a Mx3000P (Agilent Technologies Ltd, Stockport, UK) or a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system.

Expressing:

Article Title: Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature. Global spatial analysis of Arabidopsis natural variants implicates 5′UTR splicing of LATE ELONGATED HYPOCOTYL in responses to temperature
Article Snippet: Briefly, total RNA was extracted with the RNeasy Plant Mini kit (Qiagen) and DNase treated (DNA‐free; Ambion). cDNA was typically synthesized from 1 μg of total RNA using random hexamers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific U.K. Ltd., Loughborough, U.K.) real‐time PCR system. .. The average Ct values for PP2A (At1g13320, primers PP2A‐f2; 5′‐TAACGTGGCCAAAATGATGC‐3′ and PP2A‐r2; 5′‐GTTCTCCACAACCGCTTGGT‐3′) was used as internal control for expression levels.

Article Title: Cold-Dependent Expression and Alternative Splicing of Arabidopsis Long Non-coding RNAs
Article Snippet: Each reaction (1:100 dilution of cDNA) was performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific-UK Ltd., Loughborough, United Kingdom) real-time PCR system. .. The average Ct values for IPP2 (AT3G02780) were used as internal control expression levels.

Article Title: How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY), et al. How does temperature affect splicing events? Isoform switching of splicing factors regulates splicing of LATE ELONGATED HYPOCOTYL (LHY)
Article Snippet: Complementary DNA (cDNA) was typically synthesized from 2 μg of total RNA using oligo dT primers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system. .. The average Ct values for PP2A (At1g13320) and IPP2 (At3g02780) were used as internal control expression levels.

Article Title: Organ specificity in the plant circadian system is explained by different light inputs to the shoot and root clocks
Article Snippet: Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using oligo dT and SuperScript II reverse transcriptase (Invitrogen). qPCR reactions were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a Mx3000P (Agilent Technologies Ltd, Stockport, UK) or a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system. .. IRON SULFUR CLUSTER ASSEMBLY PROTEIN 1 (ISU1 , At4G22220) was used as the reference gene as its expression has been shown not to cycle over a range of conditions (Michael et al ., ).

Sequencing:

Article Title: Cold-Dependent Expression and Alternative Splicing of Arabidopsis Long Non-coding RNAs
Article Snippet: Each reaction (1:100 dilution of cDNA) was performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific-UK Ltd., Loughborough, United Kingdom) real-time PCR system. .. Primers TAS1a-ex1-fwd 5′-CTAAGCGGCTAAGCCTGACGTCA-3′ and TAS1a-ex2-ex1-rev 5′-CACCCATTACAAG CC TTTCTATCAGACAAGAC-3′ targeted spliced TAS1a transcripts where the latter primer bridged the spliced intron (between exonic nucleotides underlined in the primer sequence).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Fisher Scientific steponeplus
    Steponeplus, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 90/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/steponeplus/product/Fisher Scientific
    Average 90 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    steponeplus - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    83
    Fisher Scientific applied biosystems steponeplus instrument
    Applied Biosystems Steponeplus Instrument, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 83/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/applied biosystems steponeplus instrument/product/Fisher Scientific
    Average 83 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    applied biosystems steponeplus instrument - by Bioz Stars, 2020-02
    83/100 stars
      Buy from Supplier

    89
    Fisher Scientific steponeplus real time pcr instrument
    Steponeplus Real Time Pcr Instrument, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/steponeplus real time pcr instrument/product/Fisher Scientific
    Average 89 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    steponeplus real time pcr instrument - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    Image Search Results