Review





Similar Products

93
EpiCypher human snf2h
a . Neighbor-joining radial phylogenetic analysis of full-length ISWI proteins from apicomplexan parasites ( T. gondii, N. caninum, E. tenella, P. falciparum, P. vivax, B. microti, C. parvum ), chromerids ( C. velia, V. brassicaformis ), and model eukaryotes ( A. thaliana, H. sapiens, S. cerevisiae ) reveals two distinct apicomplexan-specific clades corresponding to Tg <t>SNF2h-</t> and Tg SNF2L-like proteins. b . Schematic domain organization of human and T. gondii ISWI proteins highlights the presence of a unique insertion in Tg SNF2L, termed Hydra. c . Secondary structures and surface of the domains of Tg SNF2L predicted by AlphaFold v2; C-ter; C-terminal; N-ter, N-terminal. d . Multiple sequence alignment of the Hydra domain from coccidian SNF2L-like ISWI proteins showing conserved residues and predicted secondary structures.
Human Snf2h, supplied by EpiCypher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human snf2h/product/EpiCypher
Average 93 stars, based on 1 article reviews
human snf2h - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

86
Novus Biologicals snf2h novus biologicals nb100
a . Neighbor-joining radial phylogenetic analysis of full-length ISWI proteins from apicomplexan parasites ( T. gondii, N. caninum, E. tenella, P. falciparum, P. vivax, B. microti, C. parvum ), chromerids ( C. velia, V. brassicaformis ), and model eukaryotes ( A. thaliana, H. sapiens, S. cerevisiae ) reveals two distinct apicomplexan-specific clades corresponding to Tg <t>SNF2h-</t> and Tg SNF2L-like proteins. b . Schematic domain organization of human and T. gondii ISWI proteins highlights the presence of a unique insertion in Tg SNF2L, termed Hydra. c . Secondary structures and surface of the domains of Tg SNF2L predicted by AlphaFold v2; C-ter; C-terminal; N-ter, N-terminal. d . Multiple sequence alignment of the Hydra domain from coccidian SNF2L-like ISWI proteins showing conserved residues and predicted secondary structures.
Snf2h Novus Biologicals Nb100, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/snf2h novus biologicals nb100/product/Novus Biologicals
Average 86 stars, based on 1 article reviews
snf2h novus biologicals nb100 - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

86
Novus Biologicals nb100 55310
a . Neighbor-joining radial phylogenetic analysis of full-length ISWI proteins from apicomplexan parasites ( T. gondii, N. caninum, E. tenella, P. falciparum, P. vivax, B. microti, C. parvum ), chromerids ( C. velia, V. brassicaformis ), and model eukaryotes ( A. thaliana, H. sapiens, S. cerevisiae ) reveals two distinct apicomplexan-specific clades corresponding to Tg <t>SNF2h-</t> and Tg SNF2L-like proteins. b . Schematic domain organization of human and T. gondii ISWI proteins highlights the presence of a unique insertion in Tg SNF2L, termed Hydra. c . Secondary structures and surface of the domains of Tg SNF2L predicted by AlphaFold v2; C-ter; C-terminal; N-ter, N-terminal. d . Multiple sequence alignment of the Hydra domain from coccidian SNF2L-like ISWI proteins showing conserved residues and predicted secondary structures.
Nb100 55310, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nb100 55310/product/Novus Biologicals
Average 86 stars, based on 1 article reviews
nb100 55310 - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

86
novus biologicals NB100-55310
a . Neighbor-joining radial phylogenetic analysis of full-length ISWI proteins from apicomplexan parasites ( T. gondii, N. caninum, E. tenella, P. falciparum, P. vivax, B. microti, C. parvum ), chromerids ( C. velia, V. brassicaformis ), and model eukaryotes ( A. thaliana, H. sapiens, S. cerevisiae ) reveals two distinct apicomplexan-specific clades corresponding to Tg <t>SNF2h-</t> and Tg SNF2L-like proteins. b . Schematic domain organization of human and T. gondii ISWI proteins highlights the presence of a unique insertion in Tg SNF2L, termed Hydra. c . Secondary structures and surface of the domains of Tg SNF2L predicted by AlphaFold v2; C-ter; C-terminal; N-ter, N-terminal. d . Multiple sequence alignment of the Hydra domain from coccidian SNF2L-like ISWI proteins showing conserved residues and predicted secondary structures.
Nb100 55310, supplied by novus biologicals, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/NB100-55310/product/novus biologicals
Average 86 stars, based on 1 article reviews
NB100-55310 - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

94
Biorbyt biorbyt orb340809
a . Neighbor-joining radial phylogenetic analysis of full-length ISWI proteins from apicomplexan parasites ( T. gondii, N. caninum, E. tenella, P. falciparum, P. vivax, B. microti, C. parvum ), chromerids ( C. velia, V. brassicaformis ), and model eukaryotes ( A. thaliana, H. sapiens, S. cerevisiae ) reveals two distinct apicomplexan-specific clades corresponding to Tg <t>SNF2h-</t> and Tg SNF2L-like proteins. b . Schematic domain organization of human and T. gondii ISWI proteins highlights the presence of a unique insertion in Tg SNF2L, termed Hydra. c . Secondary structures and surface of the domains of Tg SNF2L predicted by AlphaFold v2; C-ter; C-terminal; N-ter, N-terminal. d . Multiple sequence alignment of the Hydra domain from coccidian SNF2L-like ISWI proteins showing conserved residues and predicted secondary structures.
Biorbyt Orb340809, supplied by Biorbyt, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/biorbyt orb340809/product/Biorbyt
Average 94 stars, based on 1 article reviews
biorbyt orb340809 - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

94
Biorbyt smarca5
CIZ1 C-terminal interaction partners. ( A ) Overview of nuclear protein interaction studies using mammalian cell nuclear extracts from HeLa cells and recombinant GST-tagged hCIZ1 C-terminal fragment C179. Domains coloured as in Fig. . Below, volcano plots showing protein interaction partners identified with high confidence in three independent studies and their relative retrieval by GST-hC179 compared to GST control. Significance (−log 10 FDR q -value) is plotted against log 2 fold change (FC), derived from n = 4 replicates in each case. Significant interaction partners are ≥2-fold more abundant in CIZ1–retrieved samples compared to GST samples, at q -value ≤0.05. Data are given in . ( B ) Venn diagram showing common interaction partners between three independent studies. The 56 core interaction partners are listed in . ( C ) CIZ1 interaction partners in common with 80 Xist interactors identified by CHIRP-MS or iDRIP . Venn diagram indicates those that interact with CIZ1 in all three of our studies. Proteins that were common to both Xist studies and also identified in any of our CIZ1 interaction studies are listed in . ( D ) Simplified STRING diagram showing 56 core CIZ1 interaction partners, clustered using MCL clustering. Three unclustered proteins (dark pink) and one chromatin protein (green) are nuclear matrix-associated proteins . ( E ) Individual abundance (mean of four replicates) across three studies for four nuclear matrix proteins in the core 56 interaction list (SAFB2, <t>SMARCA5,</t> NUMA1, SLTM) and two that appear in at least one of the studies (SAFA, SAFB1). Histograms show fraction of high-confidence peptides in bait and control for each study. ( F ) Example immunofluorescence images of SAFB2 (green) in cycling WT and CIZ1 null PEFs, co-stained for CIZ1-N (red), and DAPI (blue). Box and whisker plots show intensity measures derived from two independent primary cell populations (N) for each genotype. n = number of nuclei measured. Comparison is by t-test, where *** denotes P < .001 and indicates a significant reduction of bound SAFB2 epitope in CIZ1 null cells. ( G ) As in panel (F) but for SAFA, which is not significantly changed in CIZ1 null cells.
Smarca5, supplied by Biorbyt, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/smarca5/product/Biorbyt
Average 94 stars, based on 1 article reviews
smarca5 - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology smarca5
DGCR8 interacts with chromatin remodelers and may act as a molecular switch in response to UV irradiation. (a, b) Representative PLA images showing interactions between DGCR8 and SPT16 or <t>SMARCA5</t> ( a ) and interactions between phosphorylated S153-DGCR8 (pS153) and Drosha or CSA ( b ). U2-OS cells were irradiated with 20 J/m 2 UV-C (purple) or left untreated (gray), followed by 1, 2, or 4 h of recovery. White scale bars, 10 μm. ( c ) Quantification of PLA signals shown in (a) and (b). PLA signals (red) were detected and quantified in nuclei counterstained with DAPI (blue). Horizontal black bars indicate the median of each group. Asterisks denote significant differences relative to untreated cells (*** p < 0.001).
Smarca5, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/smarca5/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
smarca5 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Addgene inc gacccugaugagaagauaatt plko 1 puro shrna smarca5 cgtcgaattaaggctgatgtt plko 1 puro shrna β catenin 1248
sPOM121 localizes at gene promoters through <t>SMARCA5</t> interaction. A, Experimental design to determine sPOM121 chromatin interactome using RIME (left). Venn diagram of commonly identified sPOM121-interacting proteins in three prostate cancer cell lines (right). B, Gene Ontology (GO) molecular functions enriched in sPOM121 protein interactome (g:Profiler). P value computed by a Fisher test corrected with Benjamini–Hochberg FDR. C, Table describing top sPOM121-interacting proteins and their overlap with RNA Pol–interacting proteins from a publicly available proteomic dataset. D, POM121, SMARCA5, DDX54, RBM25, and histone H3 immunoblots after POM121 IP using nuclear (N) and chromatin (Ch) subcellular fraction protein extracts from 22Rv1, DU145, and VCaP cells. Arrows point to both POM121 isoforms. E, Representative images and quantification of POM121–SMARCA5 PLA in control or sPOM121 knockdown (KD) cells. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. F, Representative images and quantification of POM121–SMARCA5 PLA in a cohort of primary/localized ( n = 14) and metastatic ( n = 14) prostate cancer tissue samples. Black lined circles = matched samples. *, P ≤ 0.05 as determined by a Student t test. G, Venn diagram of sPOM121 and SMARCA5 ChIP-seq peaks at promoter sites in 22Rv1 and DU145 prostate cancer cells. H, Genome browser tracks of SMARCA5 peak enrichment at promoters of sPOM121-specific genes. ChIP-seq and corresponding input DNA of the same gene are plotted. I, ChIP-qPCR analysis of sPOM121 enrichment at gene promoters comparing control and SMARCA5 KD in 22Rv1 and DU145 cells. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test.
Gacccugaugagaagauaatt Plko 1 Puro Shrna Smarca5 Cgtcgaattaaggctgatgtt Plko 1 Puro Shrna β Catenin 1248, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gacccugaugagaagauaatt plko 1 puro shrna smarca5 cgtcgaattaaggctgatgtt plko 1 puro shrna β catenin 1248/product/Addgene inc
Average 93 stars, based on 1 article reviews
gacccugaugagaagauaatt plko 1 puro shrna smarca5 cgtcgaattaaggctgatgtt plko 1 puro shrna β catenin 1248 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Addgene inc gacccugaugagaagau aatt plko 1 puro shrna smarca5 cgtcgaattaaggctgatgtt plko 1 puro shrna β catenin 1248
sPOM121 localizes at gene promoters through <t>SMARCA5</t> interaction. A, Experimental design to determine sPOM121 chromatin interactome using RIME (left). Venn diagram of commonly identified sPOM121-interacting proteins in three prostate cancer cell lines (right). B, Gene Ontology (GO) molecular functions enriched in sPOM121 protein interactome (g:Profiler). P value computed by a Fisher test corrected with Benjamini–Hochberg FDR. C, Table describing top sPOM121-interacting proteins and their overlap with RNA Pol–interacting proteins from a publicly available proteomic dataset. D, POM121, SMARCA5, DDX54, RBM25, and histone H3 immunoblots after POM121 IP using nuclear (N) and chromatin (Ch) subcellular fraction protein extracts from 22Rv1, DU145, and VCaP cells. Arrows point to both POM121 isoforms. E, Representative images and quantification of POM121–SMARCA5 PLA in control or sPOM121 knockdown (KD) cells. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. F, Representative images and quantification of POM121–SMARCA5 PLA in a cohort of primary/localized ( n = 14) and metastatic ( n = 14) prostate cancer tissue samples. Black lined circles = matched samples. *, P ≤ 0.05 as determined by a Student t test. G, Venn diagram of sPOM121 and SMARCA5 ChIP-seq peaks at promoter sites in 22Rv1 and DU145 prostate cancer cells. H, Genome browser tracks of SMARCA5 peak enrichment at promoters of sPOM121-specific genes. ChIP-seq and corresponding input DNA of the same gene are plotted. I, ChIP-qPCR analysis of sPOM121 enrichment at gene promoters comparing control and SMARCA5 KD in 22Rv1 and DU145 cells. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test.
Gacccugaugagaagau Aatt Plko 1 Puro Shrna Smarca5 Cgtcgaattaaggctgatgtt Plko 1 Puro Shrna β Catenin 1248, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gacccugaugagaagau aatt plko 1 puro shrna smarca5 cgtcgaattaaggctgatgtt plko 1 puro shrna β catenin 1248/product/Addgene inc
Average 93 stars, based on 1 article reviews
gacccugaugagaagau aatt plko 1 puro shrna smarca5 cgtcgaattaaggctgatgtt plko 1 puro shrna β catenin 1248 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

Image Search Results


a . Neighbor-joining radial phylogenetic analysis of full-length ISWI proteins from apicomplexan parasites ( T. gondii, N. caninum, E. tenella, P. falciparum, P. vivax, B. microti, C. parvum ), chromerids ( C. velia, V. brassicaformis ), and model eukaryotes ( A. thaliana, H. sapiens, S. cerevisiae ) reveals two distinct apicomplexan-specific clades corresponding to Tg SNF2h- and Tg SNF2L-like proteins. b . Schematic domain organization of human and T. gondii ISWI proteins highlights the presence of a unique insertion in Tg SNF2L, termed Hydra. c . Secondary structures and surface of the domains of Tg SNF2L predicted by AlphaFold v2; C-ter; C-terminal; N-ter, N-terminal. d . Multiple sequence alignment of the Hydra domain from coccidian SNF2L-like ISWI proteins showing conserved residues and predicted secondary structures.

Journal: bioRxiv

Article Title: Hydra domain drives SNF2L multimerization and marks ISWI diversification in parasites

doi: 10.1101/2025.09.03.673926

Figure Lengend Snippet: a . Neighbor-joining radial phylogenetic analysis of full-length ISWI proteins from apicomplexan parasites ( T. gondii, N. caninum, E. tenella, P. falciparum, P. vivax, B. microti, C. parvum ), chromerids ( C. velia, V. brassicaformis ), and model eukaryotes ( A. thaliana, H. sapiens, S. cerevisiae ) reveals two distinct apicomplexan-specific clades corresponding to Tg SNF2h- and Tg SNF2L-like proteins. b . Schematic domain organization of human and T. gondii ISWI proteins highlights the presence of a unique insertion in Tg SNF2L, termed Hydra. c . Secondary structures and surface of the domains of Tg SNF2L predicted by AlphaFold v2; C-ter; C-terminal; N-ter, N-terminal. d . Multiple sequence alignment of the Hydra domain from coccidian SNF2L-like ISWI proteins showing conserved residues and predicted secondary structures.

Article Snippet: Recombinant full-length TgSNF2L and TgSNF2LΔHydra were used alongside human SNF2h (HsSNF2h/SMARCA5, EpiCypher, SKU: 15-1024) as a positive control.

Techniques: Sequencing

a . Recombinant Tg SNF2L and its hydra domain deletion variant (Δhydra) were purified and analyzed by 4-12% NuPAGE, followed by Coomassie blue staining and anti-His tag Western blotting. b . Nucleosome remodeling assay using restriction enzyme accessibility confirms that both full-length and Δhydra recombinant Tg SNF2L retain catalytic activity. Commercial Hs SNF2h (top), recombinant full-length Tg SNF2L (middle), and truncated Tg SNF2L lacking the Hydra domain (bottom) were incubated with EpiDyne nucleosome remodeling substrates. In this assay, remodeling exposes previously occluded GATC sites, enabling cleavage by the restriction enzyme DpnII. The upper band corresponds to intact nucleosomes; the appearance of the lower band indicates successful remodeling. The first lane serves as a -DpnII control, subsequent lanes represent increasing reaction times and the final lane is - ATP control. c . Size-exclusion chromatography coupled with multi-angle light scattering (SEC-MALLS) shows that removing the hydra domain decreases the higher oligomeric forms of Tg SNF2L in the micromolar range. With the loss of the hydra domain, two new forms are detected, corresponding to a Tg SNF2L and Tg SNF2LΔhydra SEC-MALLS (Superose 6 Increase) chromatograms shown as the refractive index curves in blue and orange, respectively. Point measurements of the molecular weight in kDa are displayed as black curves with average masses within the peak regions. d . Mass photometry demonstrates a decrease in tetramer and higher oligomeric forms in the nanomolar range upon hydra domain deletion. The data, shown as normalized counts per molecular weight bin (one representative experiment), compares Tg SNF2L and Tg SNF2LΔhydra in blue and orange, respectively. Monomer, dimer and tetramer peaks are fitted using Gaussian distribution model while higher oligomeric forms are delimited by a dotted line. The relative quantifications of these peaks or windows are shown on the right with the mean and standard deviations shown from duplicate measurements. e . Proposed model: The hydra domain acts as a multimerization module, facilitating Tg SNF2L storage in a functionally primed state. In this model, Tg SNF2L’s multi-oligomeric forms may rapidly release Tg SNF2L and its associated proteins in response to DNA damage or replication fork progression.

Journal: bioRxiv

Article Title: Hydra domain drives SNF2L multimerization and marks ISWI diversification in parasites

doi: 10.1101/2025.09.03.673926

Figure Lengend Snippet: a . Recombinant Tg SNF2L and its hydra domain deletion variant (Δhydra) were purified and analyzed by 4-12% NuPAGE, followed by Coomassie blue staining and anti-His tag Western blotting. b . Nucleosome remodeling assay using restriction enzyme accessibility confirms that both full-length and Δhydra recombinant Tg SNF2L retain catalytic activity. Commercial Hs SNF2h (top), recombinant full-length Tg SNF2L (middle), and truncated Tg SNF2L lacking the Hydra domain (bottom) were incubated with EpiDyne nucleosome remodeling substrates. In this assay, remodeling exposes previously occluded GATC sites, enabling cleavage by the restriction enzyme DpnII. The upper band corresponds to intact nucleosomes; the appearance of the lower band indicates successful remodeling. The first lane serves as a -DpnII control, subsequent lanes represent increasing reaction times and the final lane is - ATP control. c . Size-exclusion chromatography coupled with multi-angle light scattering (SEC-MALLS) shows that removing the hydra domain decreases the higher oligomeric forms of Tg SNF2L in the micromolar range. With the loss of the hydra domain, two new forms are detected, corresponding to a Tg SNF2L and Tg SNF2LΔhydra SEC-MALLS (Superose 6 Increase) chromatograms shown as the refractive index curves in blue and orange, respectively. Point measurements of the molecular weight in kDa are displayed as black curves with average masses within the peak regions. d . Mass photometry demonstrates a decrease in tetramer and higher oligomeric forms in the nanomolar range upon hydra domain deletion. The data, shown as normalized counts per molecular weight bin (one representative experiment), compares Tg SNF2L and Tg SNF2LΔhydra in blue and orange, respectively. Monomer, dimer and tetramer peaks are fitted using Gaussian distribution model while higher oligomeric forms are delimited by a dotted line. The relative quantifications of these peaks or windows are shown on the right with the mean and standard deviations shown from duplicate measurements. e . Proposed model: The hydra domain acts as a multimerization module, facilitating Tg SNF2L storage in a functionally primed state. In this model, Tg SNF2L’s multi-oligomeric forms may rapidly release Tg SNF2L and its associated proteins in response to DNA damage or replication fork progression.

Article Snippet: Recombinant full-length TgSNF2L and TgSNF2LΔHydra were used alongside human SNF2h (HsSNF2h/SMARCA5, EpiCypher, SKU: 15-1024) as a positive control.

Techniques: Recombinant, Variant Assay, Purification, Staining, Western Blot, Activity Assay, Incubation, Control, Size-exclusion Chromatography, Multi-Angle Light Scattering, Refractive Index, Molecular Weight

CIZ1 C-terminal interaction partners. ( A ) Overview of nuclear protein interaction studies using mammalian cell nuclear extracts from HeLa cells and recombinant GST-tagged hCIZ1 C-terminal fragment C179. Domains coloured as in Fig. . Below, volcano plots showing protein interaction partners identified with high confidence in three independent studies and their relative retrieval by GST-hC179 compared to GST control. Significance (−log 10 FDR q -value) is plotted against log 2 fold change (FC), derived from n = 4 replicates in each case. Significant interaction partners are ≥2-fold more abundant in CIZ1–retrieved samples compared to GST samples, at q -value ≤0.05. Data are given in . ( B ) Venn diagram showing common interaction partners between three independent studies. The 56 core interaction partners are listed in . ( C ) CIZ1 interaction partners in common with 80 Xist interactors identified by CHIRP-MS or iDRIP . Venn diagram indicates those that interact with CIZ1 in all three of our studies. Proteins that were common to both Xist studies and also identified in any of our CIZ1 interaction studies are listed in . ( D ) Simplified STRING diagram showing 56 core CIZ1 interaction partners, clustered using MCL clustering. Three unclustered proteins (dark pink) and one chromatin protein (green) are nuclear matrix-associated proteins . ( E ) Individual abundance (mean of four replicates) across three studies for four nuclear matrix proteins in the core 56 interaction list (SAFB2, SMARCA5, NUMA1, SLTM) and two that appear in at least one of the studies (SAFA, SAFB1). Histograms show fraction of high-confidence peptides in bait and control for each study. ( F ) Example immunofluorescence images of SAFB2 (green) in cycling WT and CIZ1 null PEFs, co-stained for CIZ1-N (red), and DAPI (blue). Box and whisker plots show intensity measures derived from two independent primary cell populations (N) for each genotype. n = number of nuclei measured. Comparison is by t-test, where *** denotes P < .001 and indicates a significant reduction of bound SAFB2 epitope in CIZ1 null cells. ( G ) As in panel (F) but for SAFA, which is not significantly changed in CIZ1 null cells.

Journal: Nucleic Acids Research

Article Title: AURKB-driven dissolution of CIZ1–RNA assemblies from the inactive X chromosome in mitosis

doi: 10.1093/nar/gkag018

Figure Lengend Snippet: CIZ1 C-terminal interaction partners. ( A ) Overview of nuclear protein interaction studies using mammalian cell nuclear extracts from HeLa cells and recombinant GST-tagged hCIZ1 C-terminal fragment C179. Domains coloured as in Fig. . Below, volcano plots showing protein interaction partners identified with high confidence in three independent studies and their relative retrieval by GST-hC179 compared to GST control. Significance (−log 10 FDR q -value) is plotted against log 2 fold change (FC), derived from n = 4 replicates in each case. Significant interaction partners are ≥2-fold more abundant in CIZ1–retrieved samples compared to GST samples, at q -value ≤0.05. Data are given in . ( B ) Venn diagram showing common interaction partners between three independent studies. The 56 core interaction partners are listed in . ( C ) CIZ1 interaction partners in common with 80 Xist interactors identified by CHIRP-MS or iDRIP . Venn diagram indicates those that interact with CIZ1 in all three of our studies. Proteins that were common to both Xist studies and also identified in any of our CIZ1 interaction studies are listed in . ( D ) Simplified STRING diagram showing 56 core CIZ1 interaction partners, clustered using MCL clustering. Three unclustered proteins (dark pink) and one chromatin protein (green) are nuclear matrix-associated proteins . ( E ) Individual abundance (mean of four replicates) across three studies for four nuclear matrix proteins in the core 56 interaction list (SAFB2, SMARCA5, NUMA1, SLTM) and two that appear in at least one of the studies (SAFA, SAFB1). Histograms show fraction of high-confidence peptides in bait and control for each study. ( F ) Example immunofluorescence images of SAFB2 (green) in cycling WT and CIZ1 null PEFs, co-stained for CIZ1-N (red), and DAPI (blue). Box and whisker plots show intensity measures derived from two independent primary cell populations (N) for each genotype. n = number of nuclei measured. Comparison is by t-test, where *** denotes P < .001 and indicates a significant reduction of bound SAFB2 epitope in CIZ1 null cells. ( G ) As in panel (F) but for SAFA, which is not significantly changed in CIZ1 null cells.

Article Snippet: SMARCA5 , Biorbyt orb340809.

Techniques: Recombinant, Control, Derivative Assay, Immunofluorescence, Staining, Whisker Assay, Comparison

Effect of mutation on CIZ1 C-terminal interaction partners. ( A ) Volcano plots displaying protein interaction partners, comparing WT human C179 with C179 DDD or C179 Δtail in independent studies. The majority of proteins were unaffected. Those significantly increased or decreased are highlighted (log 2 fold change ±1, q ≤ 0.05). See also . To the right, STRING diagrams showing functional protein clusters for differentially retrieved proteins. Cluster identities are given in . ( B ) Summary table describing effects of mutations on study-specific interaction partners and core 56 interaction partners (in parentheses). ( C ) Heatmaps showing peptide abundance of the core 56 interaction partners retrieved in control (GST), WT (C179), and mutant reactions, as indicated ( n = 4 replicates). Upper, 10 proteins that are significantly reduced in C179 DDD compared to WT are indicated. Lower, of the core 56 only 5 are significantly changed [see panel (D)]. ( D ) Plot displays log 2 FC of core 56 proteins for C179 DDD (blue) and C179 Δtail (orange), with identities. Ten proteins that are significantly reduced upon phosphomimetic mutation are labelled in blue. Nuclear matrix proteins SAFB2, SLTM, and SMARCA5 are not affected; however, NUMA1 was increased in C179 Δtail (green).

Journal: Nucleic Acids Research

Article Title: AURKB-driven dissolution of CIZ1–RNA assemblies from the inactive X chromosome in mitosis

doi: 10.1093/nar/gkag018

Figure Lengend Snippet: Effect of mutation on CIZ1 C-terminal interaction partners. ( A ) Volcano plots displaying protein interaction partners, comparing WT human C179 with C179 DDD or C179 Δtail in independent studies. The majority of proteins were unaffected. Those significantly increased or decreased are highlighted (log 2 fold change ±1, q ≤ 0.05). See also . To the right, STRING diagrams showing functional protein clusters for differentially retrieved proteins. Cluster identities are given in . ( B ) Summary table describing effects of mutations on study-specific interaction partners and core 56 interaction partners (in parentheses). ( C ) Heatmaps showing peptide abundance of the core 56 interaction partners retrieved in control (GST), WT (C179), and mutant reactions, as indicated ( n = 4 replicates). Upper, 10 proteins that are significantly reduced in C179 DDD compared to WT are indicated. Lower, of the core 56 only 5 are significantly changed [see panel (D)]. ( D ) Plot displays log 2 FC of core 56 proteins for C179 DDD (blue) and C179 Δtail (orange), with identities. Ten proteins that are significantly reduced upon phosphomimetic mutation are labelled in blue. Nuclear matrix proteins SAFB2, SLTM, and SMARCA5 are not affected; however, NUMA1 was increased in C179 Δtail (green).

Article Snippet: SMARCA5 , Biorbyt orb340809.

Techniques: Mutagenesis, Functional Assay, Control

DGCR8 interacts with chromatin remodelers and may act as a molecular switch in response to UV irradiation. (a, b) Representative PLA images showing interactions between DGCR8 and SPT16 or SMARCA5 ( a ) and interactions between phosphorylated S153-DGCR8 (pS153) and Drosha or CSA ( b ). U2-OS cells were irradiated with 20 J/m 2 UV-C (purple) or left untreated (gray), followed by 1, 2, or 4 h of recovery. White scale bars, 10 μm. ( c ) Quantification of PLA signals shown in (a) and (b). PLA signals (red) were detected and quantified in nuclei counterstained with DAPI (blue). Horizontal black bars indicate the median of each group. Asterisks denote significant differences relative to untreated cells (*** p < 0.001).

Journal: Scientific Reports

Article Title: DGCR8 regulates multiple processes of transcription coupled nucleotide excision repair

doi: 10.1038/s41598-026-38338-5

Figure Lengend Snippet: DGCR8 interacts with chromatin remodelers and may act as a molecular switch in response to UV irradiation. (a, b) Representative PLA images showing interactions between DGCR8 and SPT16 or SMARCA5 ( a ) and interactions between phosphorylated S153-DGCR8 (pS153) and Drosha or CSA ( b ). U2-OS cells were irradiated with 20 J/m 2 UV-C (purple) or left untreated (gray), followed by 1, 2, or 4 h of recovery. White scale bars, 10 μm. ( c ) Quantification of PLA signals shown in (a) and (b). PLA signals (red) were detected and quantified in nuclei counterstained with DAPI (blue). Horizontal black bars indicate the median of each group. Asterisks denote significant differences relative to untreated cells (*** p < 0.001).

Article Snippet: The following commercial antibodies were also used: DGCR8 (10996-1-AP, Proteintech; sc-377249, Santa Cruz), RNA polymerase II (CDT-pS5, sc-55492[F-12], Santa Cruz), CSB (sc-25370, Santa Cruz), CSA (sc-376981, Santa Cruz), USP7 (300 − 033, Bethyl), UVSSA (GT816, GeneTex), CHK1-pS345 (2341 L, CST), ATM-pS1981 (4526 S, CST), SPT16 (sc-165987, Santa Cruz), SMARCA5 (sc-365727, Santa Cruz), CPD (CAC-NM-DND-001, Cosmo Bio), 6-4PP (CAC-NM-DND-002, Cosmo Bio), and GFP (50430-2-AP, Proteintech; AE012, Abclonal).

Techniques: Irradiation

sPOM121 localizes at gene promoters through SMARCA5 interaction. A, Experimental design to determine sPOM121 chromatin interactome using RIME (left). Venn diagram of commonly identified sPOM121-interacting proteins in three prostate cancer cell lines (right). B, Gene Ontology (GO) molecular functions enriched in sPOM121 protein interactome (g:Profiler). P value computed by a Fisher test corrected with Benjamini–Hochberg FDR. C, Table describing top sPOM121-interacting proteins and their overlap with RNA Pol–interacting proteins from a publicly available proteomic dataset. D, POM121, SMARCA5, DDX54, RBM25, and histone H3 immunoblots after POM121 IP using nuclear (N) and chromatin (Ch) subcellular fraction protein extracts from 22Rv1, DU145, and VCaP cells. Arrows point to both POM121 isoforms. E, Representative images and quantification of POM121–SMARCA5 PLA in control or sPOM121 knockdown (KD) cells. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. F, Representative images and quantification of POM121–SMARCA5 PLA in a cohort of primary/localized ( n = 14) and metastatic ( n = 14) prostate cancer tissue samples. Black lined circles = matched samples. *, P ≤ 0.05 as determined by a Student t test. G, Venn diagram of sPOM121 and SMARCA5 ChIP-seq peaks at promoter sites in 22Rv1 and DU145 prostate cancer cells. H, Genome browser tracks of SMARCA5 peak enrichment at promoters of sPOM121-specific genes. ChIP-seq and corresponding input DNA of the same gene are plotted. I, ChIP-qPCR analysis of sPOM121 enrichment at gene promoters comparing control and SMARCA5 KD in 22Rv1 and DU145 cells. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test.

Journal: Cancer Discovery

Article Title: Off-pore Nucleoporin sPOM121 Transcriptionally Propels β-Catenin–driven Tumor Progression and Immune Escape in Prostate Cancer

doi: 10.1158/2159-8290.CD-25-0629

Figure Lengend Snippet: sPOM121 localizes at gene promoters through SMARCA5 interaction. A, Experimental design to determine sPOM121 chromatin interactome using RIME (left). Venn diagram of commonly identified sPOM121-interacting proteins in three prostate cancer cell lines (right). B, Gene Ontology (GO) molecular functions enriched in sPOM121 protein interactome (g:Profiler). P value computed by a Fisher test corrected with Benjamini–Hochberg FDR. C, Table describing top sPOM121-interacting proteins and their overlap with RNA Pol–interacting proteins from a publicly available proteomic dataset. D, POM121, SMARCA5, DDX54, RBM25, and histone H3 immunoblots after POM121 IP using nuclear (N) and chromatin (Ch) subcellular fraction protein extracts from 22Rv1, DU145, and VCaP cells. Arrows point to both POM121 isoforms. E, Representative images and quantification of POM121–SMARCA5 PLA in control or sPOM121 knockdown (KD) cells. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. F, Representative images and quantification of POM121–SMARCA5 PLA in a cohort of primary/localized ( n = 14) and metastatic ( n = 14) prostate cancer tissue samples. Black lined circles = matched samples. *, P ≤ 0.05 as determined by a Student t test. G, Venn diagram of sPOM121 and SMARCA5 ChIP-seq peaks at promoter sites in 22Rv1 and DU145 prostate cancer cells. H, Genome browser tracks of SMARCA5 peak enrichment at promoters of sPOM121-specific genes. ChIP-seq and corresponding input DNA of the same gene are plotted. I, ChIP-qPCR analysis of sPOM121 enrichment at gene promoters comparing control and SMARCA5 KD in 22Rv1 and DU145 cells. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test.

Article Snippet: Details of the shRNA and siRNA used in this study are listed below: GL2 siRNA control: CGUACGCGGAAUACUUCGA sPOM121 siRNA#1 (5′UTR): GCAACUUGCCCAAGUCCUU sPOM121 siRNA#2 (5′UTR): GACCCUGAUGAGAAGAUAA pLKO.1 puro non-target shRNA control: SHC016 shRNA MISSION Sigma pLKO.1 puro shRNA sPOM121#1: GCAACUUGCCCAAGUCCUUTT pLKO.1 puro shRNA sPOM121#2: GACCCUGAUGAGAAGAUAATT pLKO.1 puro shRNA SMARCA5: CGTCGAATTAAGGCTGATGTT pLKO.1 puro shRNA β-catenin.1248: (RRID: Addgene_ 19761)

Techniques: Western Blot, Control, Knockdown, ChIP-sequencing, ChIP-qPCR

The C-terminus of sPOM121 is essential for SMARCA5 interaction and localization to nucleoplasmic condensates. A, Diagram of GFP-fused sPOM121 deletion mutant proteins. N terminal (NT), middle (M) and C terminal (CT) protein fragments are highlighted in orange, yellow, and purple, respectively. FL, full length. B, GFP and SMARCA5 immunoblots after GFP IP from 22Rv1 cells stably expressing sPOM121 fragments under endogenous sPOM121 knockdown. C, SMARCA5 and GFP immunoblots after SMARCA5 IP from 22Rv1 cells stably expressing sPOM121 fragments under endogenous sPOM121 knockdown. D, ChIP-qPCR enrichment of GFP at gene promoters of indicated genes comparing FL, ΔC, and CT sPOM121-GFP under endogenous sPOM121 knockdown in 22Rv1 cells. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. E, Representative GFP IF z-projection images and quantification of nucleoplasmic foci in 22Rv1 cells expressing FL, ΔC, and CT sPOM121-GFP under endogenous sPOM121 knockdown. A total of 60 nuclei for each condition were quantified. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. F, POM121 and FUS immunoblots from input, supernatant, and pellet of 22Rv1 chromatin fractions treated with 33 or 100 μmol/L b-isox. G, Representative POM121 IF z-projection images and nucleoplasmic foci quantification of endogenous sPOM121 in 22Rv1 cells treated with vehicle or with 5% HD for the indicated times. A total of 36 nuclei for each condition were quantified. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05, determined by Student t test. H, Representative images and quantification of fluorescence recovery of sPOM121-GFP nuclear foci after photobleaching (FRAP) in 22Rv1 cells. A total of 30 cells were assessed. I, Diagram of wild type (WT) and FG repeats mutant (FS, phenylalanine to serine substitution) in FL and CT sPOM121 proteins. Representative GFP IF z-projection images and quantification of nucleoplasmic foci in 22Rv1 cells expressing FL and CT sPOM121-GFP, wild-type (WT) or FS, under endogenous sPOM121 knockdown. A total of 60 nuclei for each condition were quantified. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. J, GFP and SMARCA5 ChIP-qPCR enrichment at gene promoters of indicated genes comparing 22Rv1 cells expressing either sPOM121-GFP WT or FS mutant under endogenous sPOM121 knockdown. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. K, GFP and SMARCA5 immunoblots after GFP IP from 22Rv1 cells stably expressing WT or FS mutant FL and CT sPOM121, under endogenous sPOM121 knockdown. L, Diagram of sPOM121-FL and FUS-IDR chimera proteins. Representative GFP IF images and quantification of nucleoplasmic foci in 22Rv1 cells expressing sPOM121-FL or the sPOM121 FUS-IDR chimera, under endogenous sPOM121 knockdown. A total of 60 nuclei for each condition were quantified. Data represent the mean ± SD of at least three independent experiments. n.s., non-significant. M, GFP and SMARCA5 immunoblots after GFP IP from 22Rv1 cells stably expressing sPOM121 WT or the FUS-IDR chimera, under endogenous sPOM121 knockdown. N, Nascent mRNA quantification of indicated genes in 22Rv1 cells expressing sPOM121-FL WT, FS-mutant, or FUS-IDR chimera, under endogenous sPOM121 knockdown. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test.

Journal: Cancer Discovery

Article Title: Off-pore Nucleoporin sPOM121 Transcriptionally Propels β-Catenin–driven Tumor Progression and Immune Escape in Prostate Cancer

doi: 10.1158/2159-8290.CD-25-0629

Figure Lengend Snippet: The C-terminus of sPOM121 is essential for SMARCA5 interaction and localization to nucleoplasmic condensates. A, Diagram of GFP-fused sPOM121 deletion mutant proteins. N terminal (NT), middle (M) and C terminal (CT) protein fragments are highlighted in orange, yellow, and purple, respectively. FL, full length. B, GFP and SMARCA5 immunoblots after GFP IP from 22Rv1 cells stably expressing sPOM121 fragments under endogenous sPOM121 knockdown. C, SMARCA5 and GFP immunoblots after SMARCA5 IP from 22Rv1 cells stably expressing sPOM121 fragments under endogenous sPOM121 knockdown. D, ChIP-qPCR enrichment of GFP at gene promoters of indicated genes comparing FL, ΔC, and CT sPOM121-GFP under endogenous sPOM121 knockdown in 22Rv1 cells. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. E, Representative GFP IF z-projection images and quantification of nucleoplasmic foci in 22Rv1 cells expressing FL, ΔC, and CT sPOM121-GFP under endogenous sPOM121 knockdown. A total of 60 nuclei for each condition were quantified. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. F, POM121 and FUS immunoblots from input, supernatant, and pellet of 22Rv1 chromatin fractions treated with 33 or 100 μmol/L b-isox. G, Representative POM121 IF z-projection images and nucleoplasmic foci quantification of endogenous sPOM121 in 22Rv1 cells treated with vehicle or with 5% HD for the indicated times. A total of 36 nuclei for each condition were quantified. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05, determined by Student t test. H, Representative images and quantification of fluorescence recovery of sPOM121-GFP nuclear foci after photobleaching (FRAP) in 22Rv1 cells. A total of 30 cells were assessed. I, Diagram of wild type (WT) and FG repeats mutant (FS, phenylalanine to serine substitution) in FL and CT sPOM121 proteins. Representative GFP IF z-projection images and quantification of nucleoplasmic foci in 22Rv1 cells expressing FL and CT sPOM121-GFP, wild-type (WT) or FS, under endogenous sPOM121 knockdown. A total of 60 nuclei for each condition were quantified. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. J, GFP and SMARCA5 ChIP-qPCR enrichment at gene promoters of indicated genes comparing 22Rv1 cells expressing either sPOM121-GFP WT or FS mutant under endogenous sPOM121 knockdown. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. K, GFP and SMARCA5 immunoblots after GFP IP from 22Rv1 cells stably expressing WT or FS mutant FL and CT sPOM121, under endogenous sPOM121 knockdown. L, Diagram of sPOM121-FL and FUS-IDR chimera proteins. Representative GFP IF images and quantification of nucleoplasmic foci in 22Rv1 cells expressing sPOM121-FL or the sPOM121 FUS-IDR chimera, under endogenous sPOM121 knockdown. A total of 60 nuclei for each condition were quantified. Data represent the mean ± SD of at least three independent experiments. n.s., non-significant. M, GFP and SMARCA5 immunoblots after GFP IP from 22Rv1 cells stably expressing sPOM121 WT or the FUS-IDR chimera, under endogenous sPOM121 knockdown. N, Nascent mRNA quantification of indicated genes in 22Rv1 cells expressing sPOM121-FL WT, FS-mutant, or FUS-IDR chimera, under endogenous sPOM121 knockdown. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test.

Article Snippet: Details of the shRNA and siRNA used in this study are listed below: GL2 siRNA control: CGUACGCGGAAUACUUCGA sPOM121 siRNA#1 (5′UTR): GCAACUUGCCCAAGUCCUU sPOM121 siRNA#2 (5′UTR): GACCCUGAUGAGAAGAUAA pLKO.1 puro non-target shRNA control: SHC016 shRNA MISSION Sigma pLKO.1 puro shRNA sPOM121#1: GCAACUUGCCCAAGUCCUUTT pLKO.1 puro shRNA sPOM121#2: GACCCUGAUGAGAAGAUAATT pLKO.1 puro shRNA SMARCA5: CGTCGAATTAAGGCTGATGTT pLKO.1 puro shRNA β-catenin.1248: (RRID: Addgene_ 19761)

Techniques: Mutagenesis, Western Blot, Stable Transfection, Expressing, Knockdown, ChIP-qPCR, Fluorescence

sPOM121 reprograms lethal prostate cancer. A, Venn diagram showcases the overlap of genes from RNA-seq of sPOM121 knockdown (KD), ATAC-seq of sPOM121 KD, and ATAC-seq of SMARCA5 KD of 22Rv1 and DU145 cells at promoter sites. B, Heatmap of sPOM121–target gene promoter signature obtained upon sPOM121 KD. Red and blue indicate high and low gene expression, respectively. C, ATAC-seq genome browser tracks of specific gene promoters comparing control vs. sPOM121 KD. D, ATAC-seq genome browser tracks of specific gene promoters comparing control vs. SMARCA5 KD. E, Gene set enrichment analysis of sPOM121–target gene signature in Hallmark, Reactome, and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases. F, Left, modulation of the sPOM121–target gene expression signature in a publicly available patient sample dataset containing primary/localized prostate cancer and metastatic warm autopsy samples (Grasso GSE35988 ). Right, gene set enrichment (GSEA) index box plot.

Journal: Cancer Discovery

Article Title: Off-pore Nucleoporin sPOM121 Transcriptionally Propels β-Catenin–driven Tumor Progression and Immune Escape in Prostate Cancer

doi: 10.1158/2159-8290.CD-25-0629

Figure Lengend Snippet: sPOM121 reprograms lethal prostate cancer. A, Venn diagram showcases the overlap of genes from RNA-seq of sPOM121 knockdown (KD), ATAC-seq of sPOM121 KD, and ATAC-seq of SMARCA5 KD of 22Rv1 and DU145 cells at promoter sites. B, Heatmap of sPOM121–target gene promoter signature obtained upon sPOM121 KD. Red and blue indicate high and low gene expression, respectively. C, ATAC-seq genome browser tracks of specific gene promoters comparing control vs. sPOM121 KD. D, ATAC-seq genome browser tracks of specific gene promoters comparing control vs. SMARCA5 KD. E, Gene set enrichment analysis of sPOM121–target gene signature in Hallmark, Reactome, and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases. F, Left, modulation of the sPOM121–target gene expression signature in a publicly available patient sample dataset containing primary/localized prostate cancer and metastatic warm autopsy samples (Grasso GSE35988 ). Right, gene set enrichment (GSEA) index box plot.

Article Snippet: Details of the shRNA and siRNA used in this study are listed below: GL2 siRNA control: CGUACGCGGAAUACUUCGA sPOM121 siRNA#1 (5′UTR): GCAACUUGCCCAAGUCCUU sPOM121 siRNA#2 (5′UTR): GACCCUGAUGAGAAGAUAA pLKO.1 puro non-target shRNA control: SHC016 shRNA MISSION Sigma pLKO.1 puro shRNA sPOM121#1: GCAACUUGCCCAAGUCCUUTT pLKO.1 puro shRNA sPOM121#2: GACCCUGAUGAGAAGAUAATT pLKO.1 puro shRNA SMARCA5: CGTCGAATTAAGGCTGATGTT pLKO.1 puro shRNA β-catenin.1248: (RRID: Addgene_ 19761)

Techniques: RNA Sequencing, Knockdown, Gene Expression, Control, Targeted Gene Expression