2277 ns mutant tp53 kras transgene expressing sublines  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Thermo Fisher 2277 ns mutant tp53 kras transgene expressing sublines
    Tumor protection after vaccination with highly immunogenic peptides can be hampered by induction of mutation-specific regulatory T cells. (A) Vaccination schedule for tumor challenge experiments. Depot: IFA-based formulation, Boost: boost vaccination containing CpG ODN 1668 and peptides in PBS (water-based formulation). (B) Tumor growth curves of differently vaccinated A2.DR1 dtg mice inoculated with a 1:1 mixture of <t>2277-NS</t> clones 5.2.2.1 and 5.2.2.2. In total 5 × 10 5 tumor cells were subcutaneously administered in 100 µl of Matrigel on the right flank of each animal on day 0. Three groups of 5 A2.DR1 dtg mice each (n = 5), have been vaccinated prior to the challenge according to the vaccination schedule shown in (A) with either mutated (‘mut’ group: <t>p53</t> R248W, Kras G12V), wt (‘wt’ group: p53 R248 wt, Kras G12 wt), or irrelevant (‘irr’ group: IgG 47–81 , IgG 273-304 ) pept ides. Beginning on day 7 after tumor inoculation all groups of mice were fed 2 g/l DOX in the drinking water ad libitum until the end of the challenge experiment. Mice were boosted twice with respective water-based peptide/CpG formulations during the challenge. n: number of biological replicates; error bars: mean ± SEM (C)/(D) T cell responses against mutated and wt peptide sequences tested for in A2.DR1 dtg mice immunized with p53 R248W and Kras G12V mutated peptides or non-vaccinated mice either challenged with 2277-NS clone 5.2.2.2, parental line NS-2277 or from tumor-free mice are shown. In vitro recall responses were obtained from two-color cytokine secretion assays (IL-2, IFN-γ) with pan-T cells purified from immunized or non-vaccinated animals Percentages of IFN-γ or IFN-γ/IL-2 positive CD8 + and CD4 + T cells upon in vitro recall against single wt and mutated peptides presented by CD11c + DCs are displayed. Each peptide and control sample was tested in triplicates. Results are plotted as means of triplicate assays ± SEM. (E) Percentage of splenic T reg cells in differentially vaccinated tumor bearing mice compared to non-tumor bearing mice on the day of sacrifice (day 38 of the tumor challenge experiment). T reg cells were stained for in whole splenocyte suspensions with fluorescent-labeled mAbs as CD4 + CD3 + CD25 + Foxp3 + living cells in FACS. P values as per unpaired, two-tailed t-test are shown. irr: irrelevant, mut: mutated. (F) Mutated peptide p53 R248W and the corresponding wt peptide p53 R248 wt enhance antigen-specific T reg cell activity when used for vaccination. The antigen-specific activity of T reg cells purified from the spleen and lymph nodes of C57BL/6 mice vaccinated with mutated or wt peptides was analyzed in T reg specificity assays. Groups of n = 3 mice were vaccinated with either wt or mutated peptide mixes. Purified T reg cells were re-stimulated on CD11c + DCs pulsed with single peptides of the same mix used for vaccination and corresponding wt or mutated peptides. The next day OVA 323-339 antigen-specifically activated, proliferating OT-II CD4 + conventional T cells were added to the culture and proliferation was measured additional 2 days later via the uptake of radioactive labeled 3 H-thymidine employing a scintillation counter. Respective control samples containing only peptide pulsed DCs and activated conventional OT-II T cells but no purified regulatory T cells were handled identically. This leads to two sets of triplicate data per tested peptide: one with T reg cells added and one without T reg cells. Percentages of specific suppression were calculated by using c.p.m. values of the different assay plates. Differences were tested for by unpaired, two-tailed t-test. ns: not significant.
    2277 Ns Mutant Tp53 Kras Transgene Expressing Sublines, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 160 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/2277 ns mutant tp53 kras transgene expressing sublines/product/Thermo Fisher
    Average 93 stars, based on 160 article reviews
    Price from $9.99 to $1999.99
    2277 ns mutant tp53 kras transgene expressing sublines - by Bioz Stars, 2020-09
    93/100 stars

    Images

    1) Product Images from "Long-peptide vaccination with driver gene mutations in p53 and Kras induces cancer mutation-specific effector as well as regulatory T cell responses"

    Article Title: Long-peptide vaccination with driver gene mutations in p53 and Kras induces cancer mutation-specific effector as well as regulatory T cell responses

    Journal: Oncoimmunology

    doi: 10.1080/2162402X.2018.1500671

    Tumor protection after vaccination with highly immunogenic peptides can be hampered by induction of mutation-specific regulatory T cells. (A) Vaccination schedule for tumor challenge experiments. Depot: IFA-based formulation, Boost: boost vaccination containing CpG ODN 1668 and peptides in PBS (water-based formulation). (B) Tumor growth curves of differently vaccinated A2.DR1 dtg mice inoculated with a 1:1 mixture of 2277-NS clones 5.2.2.1 and 5.2.2.2. In total 5 × 10 5 tumor cells were subcutaneously administered in 100 µl of Matrigel on the right flank of each animal on day 0. Three groups of 5 A2.DR1 dtg mice each (n = 5), have been vaccinated prior to the challenge according to the vaccination schedule shown in (A) with either mutated (‘mut’ group: p53 R248W, Kras G12V), wt (‘wt’ group: p53 R248 wt, Kras G12 wt), or irrelevant (‘irr’ group: IgG 47–81 , IgG 273-304 ) pept ides. Beginning on day 7 after tumor inoculation all groups of mice were fed 2 g/l DOX in the drinking water ad libitum until the end of the challenge experiment. Mice were boosted twice with respective water-based peptide/CpG formulations during the challenge. n: number of biological replicates; error bars: mean ± SEM (C)/(D) T cell responses against mutated and wt peptide sequences tested for in A2.DR1 dtg mice immunized with p53 R248W and Kras G12V mutated peptides or non-vaccinated mice either challenged with 2277-NS clone 5.2.2.2, parental line NS-2277 or from tumor-free mice are shown. In vitro recall responses were obtained from two-color cytokine secretion assays (IL-2, IFN-γ) with pan-T cells purified from immunized or non-vaccinated animals Percentages of IFN-γ or IFN-γ/IL-2 positive CD8 + and CD4 + T cells upon in vitro recall against single wt and mutated peptides presented by CD11c + DCs are displayed. Each peptide and control sample was tested in triplicates. Results are plotted as means of triplicate assays ± SEM. (E) Percentage of splenic T reg cells in differentially vaccinated tumor bearing mice compared to non-tumor bearing mice on the day of sacrifice (day 38 of the tumor challenge experiment). T reg cells were stained for in whole splenocyte suspensions with fluorescent-labeled mAbs as CD4 + CD3 + CD25 + Foxp3 + living cells in FACS. P values as per unpaired, two-tailed t-test are shown. irr: irrelevant, mut: mutated. (F) Mutated peptide p53 R248W and the corresponding wt peptide p53 R248 wt enhance antigen-specific T reg cell activity when used for vaccination. The antigen-specific activity of T reg cells purified from the spleen and lymph nodes of C57BL/6 mice vaccinated with mutated or wt peptides was analyzed in T reg specificity assays. Groups of n = 3 mice were vaccinated with either wt or mutated peptide mixes. Purified T reg cells were re-stimulated on CD11c + DCs pulsed with single peptides of the same mix used for vaccination and corresponding wt or mutated peptides. The next day OVA 323-339 antigen-specifically activated, proliferating OT-II CD4 + conventional T cells were added to the culture and proliferation was measured additional 2 days later via the uptake of radioactive labeled 3 H-thymidine employing a scintillation counter. Respective control samples containing only peptide pulsed DCs and activated conventional OT-II T cells but no purified regulatory T cells were handled identically. This leads to two sets of triplicate data per tested peptide: one with T reg cells added and one without T reg cells. Percentages of specific suppression were calculated by using c.p.m. values of the different assay plates. Differences were tested for by unpaired, two-tailed t-test. ns: not significant.
    Figure Legend Snippet: Tumor protection after vaccination with highly immunogenic peptides can be hampered by induction of mutation-specific regulatory T cells. (A) Vaccination schedule for tumor challenge experiments. Depot: IFA-based formulation, Boost: boost vaccination containing CpG ODN 1668 and peptides in PBS (water-based formulation). (B) Tumor growth curves of differently vaccinated A2.DR1 dtg mice inoculated with a 1:1 mixture of 2277-NS clones 5.2.2.1 and 5.2.2.2. In total 5 × 10 5 tumor cells were subcutaneously administered in 100 µl of Matrigel on the right flank of each animal on day 0. Three groups of 5 A2.DR1 dtg mice each (n = 5), have been vaccinated prior to the challenge according to the vaccination schedule shown in (A) with either mutated (‘mut’ group: p53 R248W, Kras G12V), wt (‘wt’ group: p53 R248 wt, Kras G12 wt), or irrelevant (‘irr’ group: IgG 47–81 , IgG 273-304 ) pept ides. Beginning on day 7 after tumor inoculation all groups of mice were fed 2 g/l DOX in the drinking water ad libitum until the end of the challenge experiment. Mice were boosted twice with respective water-based peptide/CpG formulations during the challenge. n: number of biological replicates; error bars: mean ± SEM (C)/(D) T cell responses against mutated and wt peptide sequences tested for in A2.DR1 dtg mice immunized with p53 R248W and Kras G12V mutated peptides or non-vaccinated mice either challenged with 2277-NS clone 5.2.2.2, parental line NS-2277 or from tumor-free mice are shown. In vitro recall responses were obtained from two-color cytokine secretion assays (IL-2, IFN-γ) with pan-T cells purified from immunized or non-vaccinated animals Percentages of IFN-γ or IFN-γ/IL-2 positive CD8 + and CD4 + T cells upon in vitro recall against single wt and mutated peptides presented by CD11c + DCs are displayed. Each peptide and control sample was tested in triplicates. Results are plotted as means of triplicate assays ± SEM. (E) Percentage of splenic T reg cells in differentially vaccinated tumor bearing mice compared to non-tumor bearing mice on the day of sacrifice (day 38 of the tumor challenge experiment). T reg cells were stained for in whole splenocyte suspensions with fluorescent-labeled mAbs as CD4 + CD3 + CD25 + Foxp3 + living cells in FACS. P values as per unpaired, two-tailed t-test are shown. irr: irrelevant, mut: mutated. (F) Mutated peptide p53 R248W and the corresponding wt peptide p53 R248 wt enhance antigen-specific T reg cell activity when used for vaccination. The antigen-specific activity of T reg cells purified from the spleen and lymph nodes of C57BL/6 mice vaccinated with mutated or wt peptides was analyzed in T reg specificity assays. Groups of n = 3 mice were vaccinated with either wt or mutated peptide mixes. Purified T reg cells were re-stimulated on CD11c + DCs pulsed with single peptides of the same mix used for vaccination and corresponding wt or mutated peptides. The next day OVA 323-339 antigen-specifically activated, proliferating OT-II CD4 + conventional T cells were added to the culture and proliferation was measured additional 2 days later via the uptake of radioactive labeled 3 H-thymidine employing a scintillation counter. Respective control samples containing only peptide pulsed DCs and activated conventional OT-II T cells but no purified regulatory T cells were handled identically. This leads to two sets of triplicate data per tested peptide: one with T reg cells added and one without T reg cells. Percentages of specific suppression were calculated by using c.p.m. values of the different assay plates. Differences were tested for by unpaired, two-tailed t-test. ns: not significant.

    Techniques Used: Mutagenesis, Immunofluorescence, Mouse Assay, Clone Assay, In Vitro, Purification, Staining, Labeling, FACS, Two Tailed Test, Activity Assay

    2) Product Images from "FlexiBAC: a versatile, open-source baculovirus vector system for protein expression, secretion, and proteolytic processing"

    Article Title: FlexiBAC: a versatile, open-source baculovirus vector system for protein expression, secretion, and proteolytic processing

    Journal: BMC Biotechnology

    doi: 10.1186/s12896-019-0512-z

    Efficient production of mature TGF-β member Activin A using FlexiBAC. a Sf9 insect cells were infected with recombinant baculovirus generated using the commercial Bac-to-Bac system (ThermoFisher Scientific) or the FlexiBAC system. Cell supernatants were collected at the indicated times after infection, resolved on 4–20% gradient SDS-PAGE gels under reducing conditions, then analyzed by western blot with anti-Activin A IgG. Bands corresponding to pro-Activin A (uncleaved) and mature Activin A (cleaved) are indicated. b Activin A secretion from insect cells infected with baculovirus generated using the precursor backbone for the FlexiBAC system (called “DefBac-H092”, which expresses viral chitinase and cathepsin) or the current backbone (called “DefBac”, which does not express viral chitinase and cathepsin). c Activin A maturation and secretion from insect cells infected with DefBac-derived baculovirus vs. DefBac Fur+ -derived baculovirus. In addition to expressing the target protein of interest, DefBac Fur+ expresses furin convertase, which converts pro-Activin A to its mature form. d Insect cells were either singly infected or co-infected with the following virus: pFastBac::Activin A (lane 1), DefBac-H092::Activin A (lane 2), DefBac::Activin A (lane 3), DefBac Fur+ ::Activin A (lane 4), DefBac::Activin A and DefBac::polh::Furin (lane 5), DefBac::Activin A and DefBac::p6.9::Furin (lane6). Each virus was added to insect cells at MOI = 0.2 except for DefBac::p6.9::Furin (MOI = 2). The conditioned media was analyzed by western blot. Samples taken from peak Activin A expression times are shown (96 hpi for conditions 1–5, 72 hpi for condition 6). e Multi-step purification of mature Activin A from conditioned media from insect cells infected with DefBac Fur+ ::Activin A. Samples were resolved on an SDS-PAGE gel and stained with coomassie blue. Samples 1–5 were reduced with DTT prior to loading. f To assess activity, purified mature Activin A was added to epiblast derived stem cells (EpiSCs) cultured on fibronectin. Fold changes in gene expression, normalized to beta-actin, were determined over 11 days by quantitative polymerase chain reaction (qPCR) for the pluripotency makers Oct4, Nanog, Fgf5, and for the lineage marker, Pax6 (mean +/− S.D.; n = 3 separate experiments). Activin A from a commercial source was used as a control (grey box)
    Figure Legend Snippet: Efficient production of mature TGF-β member Activin A using FlexiBAC. a Sf9 insect cells were infected with recombinant baculovirus generated using the commercial Bac-to-Bac system (ThermoFisher Scientific) or the FlexiBAC system. Cell supernatants were collected at the indicated times after infection, resolved on 4–20% gradient SDS-PAGE gels under reducing conditions, then analyzed by western blot with anti-Activin A IgG. Bands corresponding to pro-Activin A (uncleaved) and mature Activin A (cleaved) are indicated. b Activin A secretion from insect cells infected with baculovirus generated using the precursor backbone for the FlexiBAC system (called “DefBac-H092”, which expresses viral chitinase and cathepsin) or the current backbone (called “DefBac”, which does not express viral chitinase and cathepsin). c Activin A maturation and secretion from insect cells infected with DefBac-derived baculovirus vs. DefBac Fur+ -derived baculovirus. In addition to expressing the target protein of interest, DefBac Fur+ expresses furin convertase, which converts pro-Activin A to its mature form. d Insect cells were either singly infected or co-infected with the following virus: pFastBac::Activin A (lane 1), DefBac-H092::Activin A (lane 2), DefBac::Activin A (lane 3), DefBac Fur+ ::Activin A (lane 4), DefBac::Activin A and DefBac::polh::Furin (lane 5), DefBac::Activin A and DefBac::p6.9::Furin (lane6). Each virus was added to insect cells at MOI = 0.2 except for DefBac::p6.9::Furin (MOI = 2). The conditioned media was analyzed by western blot. Samples taken from peak Activin A expression times are shown (96 hpi for conditions 1–5, 72 hpi for condition 6). e Multi-step purification of mature Activin A from conditioned media from insect cells infected with DefBac Fur+ ::Activin A. Samples were resolved on an SDS-PAGE gel and stained with coomassie blue. Samples 1–5 were reduced with DTT prior to loading. f To assess activity, purified mature Activin A was added to epiblast derived stem cells (EpiSCs) cultured on fibronectin. Fold changes in gene expression, normalized to beta-actin, were determined over 11 days by quantitative polymerase chain reaction (qPCR) for the pluripotency makers Oct4, Nanog, Fgf5, and for the lineage marker, Pax6 (mean +/− S.D.; n = 3 separate experiments). Activin A from a commercial source was used as a control (grey box)

    Techniques Used: Infection, Recombinant, Generated, BAC Assay, SDS Page, Western Blot, Derivative Assay, Expressing, Purification, Staining, Activity Assay, Cell Culture, Real-time Polymerase Chain Reaction, Marker

    Overview of the FlexiBAC baculovirus expression system. a Recombination between a SbfI-linearized defective viral backbone (“DefBac”) and a shuttle vector (“pOCC”, which contains the target gene of interest) creates a viral genome capable of producing infectious virus. Recombination occurs between complementary lef2 and AcORF1629 truncations located on the pOCC vector and the DefBac viral backbone. Recombination generates full-length versions of lef2 and AcORF1629 genes, which are needed for baculovirus production. No virus is produced without proper recombination, thus eliminating the need for post-production screening for recombinant virus. The DefBac viral backbone also includes deletions in the genes encoding cathepsin and chitinase. A second version of DefBac, called DefBac Fur+ , expresses the convertase furin. b Each pOCC shuttle vector contains a modular expression cassette that allows insertion and swapping of the gene of interest, N-terminal tags, and C-terminal tags using classic cloning techniques (restriction sites are shown with arrowheads). A gene encoding the ccdB toxin selects against plasmids lacking the gene of interest. c pOCC shuttle plasmids encode a variety of tags that can be appended to the target protein of interest. Tags are easily combined and swapped to create customizable N-terminal or C-terminal fusions. Descriptions of each tag and the available combinations (143) are shown in Table 1 (see Additional file 1 ) and available upon request. The most commonly used plasmids (52) are shown in Table 2 (see Additional file 2 ) and are available at www.addgene.org . d Timeline for production of recombinant baculovirus using the FlexiBAC system. On day 1, the user transfects Sf9 insect cells with pOCC shuttle vector (with target gene of interest) and linearized DefBac DNA. Within some insect cells, pOCC and DefBac will recombine and this event generates an infectious baculovirus that propagates throughout the culture. On day 5, the user collects the conditioned media (which contains released baculovirus) and uses it to infect fresh Sf9 insect cells. On day 10, the user uses the conditioned media again to infect fresh Sf9 cells. On day 13, the user harvests the infected Sf9 cells containing the target protein of interest (represented by green, GFP+ cells). For secreted protein targets the conditioned medium is collected after this phase
    Figure Legend Snippet: Overview of the FlexiBAC baculovirus expression system. a Recombination between a SbfI-linearized defective viral backbone (“DefBac”) and a shuttle vector (“pOCC”, which contains the target gene of interest) creates a viral genome capable of producing infectious virus. Recombination occurs between complementary lef2 and AcORF1629 truncations located on the pOCC vector and the DefBac viral backbone. Recombination generates full-length versions of lef2 and AcORF1629 genes, which are needed for baculovirus production. No virus is produced without proper recombination, thus eliminating the need for post-production screening for recombinant virus. The DefBac viral backbone also includes deletions in the genes encoding cathepsin and chitinase. A second version of DefBac, called DefBac Fur+ , expresses the convertase furin. b Each pOCC shuttle vector contains a modular expression cassette that allows insertion and swapping of the gene of interest, N-terminal tags, and C-terminal tags using classic cloning techniques (restriction sites are shown with arrowheads). A gene encoding the ccdB toxin selects against plasmids lacking the gene of interest. c pOCC shuttle plasmids encode a variety of tags that can be appended to the target protein of interest. Tags are easily combined and swapped to create customizable N-terminal or C-terminal fusions. Descriptions of each tag and the available combinations (143) are shown in Table 1 (see Additional file 1 ) and available upon request. The most commonly used plasmids (52) are shown in Table 2 (see Additional file 2 ) and are available at www.addgene.org . d Timeline for production of recombinant baculovirus using the FlexiBAC system. On day 1, the user transfects Sf9 insect cells with pOCC shuttle vector (with target gene of interest) and linearized DefBac DNA. Within some insect cells, pOCC and DefBac will recombine and this event generates an infectious baculovirus that propagates throughout the culture. On day 5, the user collects the conditioned media (which contains released baculovirus) and uses it to infect fresh Sf9 insect cells. On day 10, the user uses the conditioned media again to infect fresh Sf9 cells. On day 13, the user harvests the infected Sf9 cells containing the target protein of interest (represented by green, GFP+ cells). For secreted protein targets the conditioned medium is collected after this phase

    Techniques Used: Expressing, Plasmid Preparation, Produced, Recombinant, Clone Assay, Infection

    3) Product Images from "High-Throughput System for the Presentation of Secreted and Surface-Exposed Proteins from Gram-Positive Bacteria in Functional Metagenomics Studies"

    Article Title: High-Throughput System for the Presentation of Secreted and Surface-Exposed Proteins from Gram-Positive Bacteria in Functional Metagenomics Studies

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0065956

    Schematic representation of the high-throughput cloning strategy. A. B. subtilis Gateway expression vector pDG148-GW with an inducible P spac promoter. lacI, lac repressor gene; AmpR, kanR, phlR, CmR, genes providing resistance to ampicilin, kanamycin, phleomycin, or chloramphenicol, respectively; ccdB, gene coding for the cytotoxic CcdB protein. B. Full-length coding sequences (CDS) are amplified by nested PCR using a set of CDS-specific (primary) primers and a set of universal (secondary) primers. The resulting PCR product contains the CDS preceded by a synthetic SD sequence (brackets) and a Sap I restriction site (underlined). att B1.1 and att B2.1 sites for site-specific recombination are indicated by braces; start and stop codons of the CDS, in italic-bold.
    Figure Legend Snippet: Schematic representation of the high-throughput cloning strategy. A. B. subtilis Gateway expression vector pDG148-GW with an inducible P spac promoter. lacI, lac repressor gene; AmpR, kanR, phlR, CmR, genes providing resistance to ampicilin, kanamycin, phleomycin, or chloramphenicol, respectively; ccdB, gene coding for the cytotoxic CcdB protein. B. Full-length coding sequences (CDS) are amplified by nested PCR using a set of CDS-specific (primary) primers and a set of universal (secondary) primers. The resulting PCR product contains the CDS preceded by a synthetic SD sequence (brackets) and a Sap I restriction site (underlined). att B1.1 and att B2.1 sites for site-specific recombination are indicated by braces; start and stop codons of the CDS, in italic-bold.

    Techniques Used: High Throughput Screening Assay, Clone Assay, Expressing, Plasmid Preparation, Amplification, Nested PCR, Polymerase Chain Reaction, Sequencing

    4) Product Images from "Respiratory Syncytial Virus Fusion Glycoprotein Expressed in Insect Cells Form Protein Nanoparticles That Induce Protective Immunity in Cotton Rats"

    Article Title: Respiratory Syncytial Virus Fusion Glycoprotein Expressed in Insect Cells Form Protein Nanoparticles That Induce Protective Immunity in Cotton Rats

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0050852

    RSV A2 F gene modifications. (A) RSV F cleavage site mutation where introduced at the proteolytic furin cleavage site II (KKRKRR) and site I (RARR) of wild type RSV F gene (wt). (B) RSV F clone 2 (#514) with a mutation of cleavage site II was further modified with increasing deletions in the fusion peptide starting at Phe137 to Val154 with Δ2, Δ4, Δ6, Δ8, Δ10, Δ12, Δ14, Δ16 and Δ18 amino acid deletions. (C) The modified full length RSV F gene (#683) with a modified cleavage site II (KKQKQQ) and Phe137 - Ser146 fusion domain deletion including RSV F cleavable signal peptide (sp), 27 amino acid peptide [23] , hydrophobic transmembrane (tm), and F2 and F1 polypeptides covalently linked by two disulfides.
    Figure Legend Snippet: RSV A2 F gene modifications. (A) RSV F cleavage site mutation where introduced at the proteolytic furin cleavage site II (KKRKRR) and site I (RARR) of wild type RSV F gene (wt). (B) RSV F clone 2 (#514) with a mutation of cleavage site II was further modified with increasing deletions in the fusion peptide starting at Phe137 to Val154 with Δ2, Δ4, Δ6, Δ8, Δ10, Δ12, Δ14, Δ16 and Δ18 amino acid deletions. (C) The modified full length RSV F gene (#683) with a modified cleavage site II (KKQKQQ) and Phe137 - Ser146 fusion domain deletion including RSV F cleavable signal peptide (sp), 27 amino acid peptide [23] , hydrophobic transmembrane (tm), and F2 and F1 polypeptides covalently linked by two disulfides.

    Techniques Used: Mutagenesis, Modification

    5) Product Images from "Acute Inhibition of PI3K-PDK1-Akt Pathway Potentiates Insulin Secretion through Upregulation of Newcomer Granule Fusions in Pancreatic ?-Cells"

    Article Title: Acute Inhibition of PI3K-PDK1-Akt Pathway Potentiates Insulin Secretion through Upregulation of Newcomer Granule Fusions in Pancreatic ?-Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0047381

    Akt mediated the potentiating effect of PIK-75 on the glucose-induced secretion. Cultured islets transfected with PKCζ(ΔPS) (A; n = 6 for each group), myr-Akt1 (D; n = 6 for each group) and PDK1(A280V) (H; n = 6 for each group) pretreated with or without 0.5 µM PIK-75 or 1 µM Akti-1/2 for 30 min were stimulated with 16 mM glucose. Alternatively, insulin secretion from cultured islets pretreated with PKCζ-PS (B; n = 8 for each group) or Akti-1/2 (F; n = 8 for each group) for 30 min were stimulated with 16 mM glucose. COS7 cells transfected with myr-Akt1 (C) or PDK1(A280V) (G) were treated with or without 0.5 µM PIK-75 or 1 µM Akti-1/2 for 30 min and subjected to immunoblotting using anti-Pi-GSK3β and α-tubulin antibodies. (E) Cultured islets pretreated with Akti-1/2 for 30 min were subjected to immunoblotting using anti-Pi-GSK3β and α-tubulin antibodies. Data are represented as a mean ± S.E.M. *; p
    Figure Legend Snippet: Akt mediated the potentiating effect of PIK-75 on the glucose-induced secretion. Cultured islets transfected with PKCζ(ΔPS) (A; n = 6 for each group), myr-Akt1 (D; n = 6 for each group) and PDK1(A280V) (H; n = 6 for each group) pretreated with or without 0.5 µM PIK-75 or 1 µM Akti-1/2 for 30 min were stimulated with 16 mM glucose. Alternatively, insulin secretion from cultured islets pretreated with PKCζ-PS (B; n = 8 for each group) or Akti-1/2 (F; n = 8 for each group) for 30 min were stimulated with 16 mM glucose. COS7 cells transfected with myr-Akt1 (C) or PDK1(A280V) (G) were treated with or without 0.5 µM PIK-75 or 1 µM Akti-1/2 for 30 min and subjected to immunoblotting using anti-Pi-GSK3β and α-tubulin antibodies. (E) Cultured islets pretreated with Akti-1/2 for 30 min were subjected to immunoblotting using anti-Pi-GSK3β and α-tubulin antibodies. Data are represented as a mean ± S.E.M. *; p

    Techniques Used: Cell Culture, Transfection

    6) Product Images from "Empty Pericarp5 Encodes a Pentatricopeptide Repeat Protein That Is Required for Mitochondrial RNA Editing and Seed Development in Maize [W]"

    Article Title: Empty Pericarp5 Encodes a Pentatricopeptide Repeat Protein That Is Required for Mitochondrial RNA Editing and Seed Development in Maize [W]

    Journal: The Plant Cell

    doi: 10.1105/tpc.112.106781

    Os EMP5 Is a Mitochondrion-Localized PPR-DYW Protein.
    Figure Legend Snippet: Os EMP5 Is a Mitochondrion-Localized PPR-DYW Protein.

    Techniques Used:

    Knockdown Analysis of Os Emp5 Expression in Transgenic Rice.
    Figure Legend Snippet: Knockdown Analysis of Os Emp5 Expression in Transgenic Rice.

    Techniques Used: Expressing, Transgenic Assay

    The Basal Transfer Cell Development in the emp5-1 Kernels Is Arrested.
    Figure Legend Snippet: The Basal Transfer Cell Development in the emp5-1 Kernels Is Arrested.

    Techniques Used:

    Insertion of a Mu1 Element in the E+ Domain in the emp5-4 Allele Reduces Editing Efficiency.
    Figure Legend Snippet: Insertion of a Mu1 Element in the E+ Domain in the emp5-4 Allele Reduces Editing Efficiency.

    Techniques Used:

    RT-PCR Analysis Indicates Expression of Emp5 in Multiple Organs and during Seed Development in Maize.
    Figure Legend Snippet: RT-PCR Analysis Indicates Expression of Emp5 in Multiple Organs and during Seed Development in Maize.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing

    Emp5 Gene Cloning.
    Figure Legend Snippet: Emp5 Gene Cloning.

    Techniques Used: Clone Assay

    EMP5 Is a Mitochondrion-Localized PPR-DYW Protein.
    Figure Legend Snippet: EMP5 Is a Mitochondrion-Localized PPR-DYW Protein.

    Techniques Used:

    Mutant emp5-1 Kernels Abort Early in Seed Development.
    Figure Legend Snippet: Mutant emp5-1 Kernels Abort Early in Seed Development.

    Techniques Used: Mutagenesis

    Os EMP5 Is Required for rpl16 Editing in Rice Mitochondria.
    Figure Legend Snippet: Os EMP5 Is Required for rpl16 Editing in Rice Mitochondria.

    Techniques Used:

    RNA Editing Defects of Mitochondria Genes in the emp5-1 Mutant.
    Figure Legend Snippet: RNA Editing Defects of Mitochondria Genes in the emp5-1 Mutant.

    Techniques Used: Mutagenesis

    7) Product Images from "Empty Pericarp5 Encodes a Pentatricopeptide Repeat Protein That Is Required for Mitochondrial RNA Editing and Seed Development in Maize [W]"

    Article Title: Empty Pericarp5 Encodes a Pentatricopeptide Repeat Protein That Is Required for Mitochondrial RNA Editing and Seed Development in Maize [W]

    Journal: The Plant Cell

    doi: 10.1105/tpc.112.106781

    Os EMP5 Is a Mitochondrion-Localized PPR-DYW Protein.
    Figure Legend Snippet: Os EMP5 Is a Mitochondrion-Localized PPR-DYW Protein.

    Techniques Used:

    Knockdown Analysis of Os Emp5 Expression in Transgenic Rice.
    Figure Legend Snippet: Knockdown Analysis of Os Emp5 Expression in Transgenic Rice.

    Techniques Used: Expressing, Transgenic Assay

    The Basal Transfer Cell Development in the emp5-1 Kernels Is Arrested.
    Figure Legend Snippet: The Basal Transfer Cell Development in the emp5-1 Kernels Is Arrested.

    Techniques Used:

    Insertion of a Mu1 Element in the E+ Domain in the emp5-4 Allele Reduces Editing Efficiency.
    Figure Legend Snippet: Insertion of a Mu1 Element in the E+ Domain in the emp5-4 Allele Reduces Editing Efficiency.

    Techniques Used:

    RT-PCR Analysis Indicates Expression of Emp5 in Multiple Organs and during Seed Development in Maize.
    Figure Legend Snippet: RT-PCR Analysis Indicates Expression of Emp5 in Multiple Organs and during Seed Development in Maize.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing

    Emp5 Gene Cloning.
    Figure Legend Snippet: Emp5 Gene Cloning.

    Techniques Used: Clone Assay

    EMP5 Is a Mitochondrion-Localized PPR-DYW Protein.
    Figure Legend Snippet: EMP5 Is a Mitochondrion-Localized PPR-DYW Protein.

    Techniques Used:

    Mutant emp5-1 Kernels Abort Early in Seed Development.
    Figure Legend Snippet: Mutant emp5-1 Kernels Abort Early in Seed Development.

    Techniques Used: Mutagenesis

    Os EMP5 Is Required for rpl16 Editing in Rice Mitochondria.
    Figure Legend Snippet: Os EMP5 Is Required for rpl16 Editing in Rice Mitochondria.

    Techniques Used:

    RNA Editing Defects of Mitochondria Genes in the emp5-1 Mutant.
    Figure Legend Snippet: RNA Editing Defects of Mitochondria Genes in the emp5-1 Mutant.

    Techniques Used: Mutagenesis

    8) Product Images from "Different Roles For KIF17 and Kinesin II In Photoreceptor Development and Maintenance"

    Article Title: Different Roles For KIF17 and Kinesin II In Photoreceptor Development and Maintenance

    Journal: Developmental dynamics : an official publication of the American Association of Anatomists

    doi: 10.1002/dvdy.21956

    Accumulation of large vacuoles and dense material in the IS of cones expressing DNKIF3B
    Figure Legend Snippet: Accumulation of large vacuoles and dense material in the IS of cones expressing DNKIF3B

    Techniques Used: Expressing

    Localization of Ta-CP directed expression of GFP, DNKIF3B and DNKIF17 and cone opsin localization at 5 dpf
    Figure Legend Snippet: Localization of Ta-CP directed expression of GFP, DNKIF3B and DNKIF17 and cone opsin localization at 5 dpf

    Techniques Used: Expressing

    Light microscopy of retinae of control, DNKIF3B and DNKIF17 embryos at 5 dpf
    Figure Legend Snippet: Light microscopy of retinae of control, DNKIF3B and DNKIF17 embryos at 5 dpf

    Techniques Used: Light Microscopy

    Lack of synaptic ribbons in cone pedicles of DNKIF3B expressing embryos
    Figure Legend Snippet: Lack of synaptic ribbons in cone pedicles of DNKIF3B expressing embryos

    Techniques Used: Expressing

    Summary of the structural phenotypes observed in DNKIF3B and DNKIF17 embryos
    Figure Legend Snippet: Summary of the structural phenotypes observed in DNKIF3B and DNKIF17 embryos

    Techniques Used:

    9) Product Images from "Enhancer hijacking activates oncogenic transcription factor NR4A3 in acinic cell carcinomas of the salivary glands"

    Article Title: Enhancer hijacking activates oncogenic transcription factor NR4A3 in acinic cell carcinomas of the salivary glands

    Journal: Nature Communications

    doi: 10.1038/s41467-018-08069-x

    Functional impact of NR4A3 upregulation in AciCCs. a Hierarchical clustering of ten AciCCs and three normal parotid gland samples based on significantly up- and downregulated genes (deSeq2 47 ; FDR = 0.01). Each row represents a gene, and each column represents a sample, with color-coding of gene expression levels. With the exception of one case, the tumors cluster separately from the normal tissues. Functional enrichment analysis reveals seven annotation clusters among upregulated genes, and two annotation clusters among downregulated genes. Genes associated with annotation clusters and differential H3K27ac and NR4A3 peaks are indicated by bars. Red and blue bars encode up- and downregulated genes associated with functional annotation clusters (left), and genes associated with up- and downregulated H3K27ac and NR4A3 peaks (right), respectively. b The NBRE motif is the only significantly enriched known motif at sites with upregulated H3K27ac peaks in the tumor samples (HOMER 54 ; P
    Figure Legend Snippet: Functional impact of NR4A3 upregulation in AciCCs. a Hierarchical clustering of ten AciCCs and three normal parotid gland samples based on significantly up- and downregulated genes (deSeq2 47 ; FDR = 0.01). Each row represents a gene, and each column represents a sample, with color-coding of gene expression levels. With the exception of one case, the tumors cluster separately from the normal tissues. Functional enrichment analysis reveals seven annotation clusters among upregulated genes, and two annotation clusters among downregulated genes. Genes associated with annotation clusters and differential H3K27ac and NR4A3 peaks are indicated by bars. Red and blue bars encode up- and downregulated genes associated with functional annotation clusters (left), and genes associated with up- and downregulated H3K27ac and NR4A3 peaks (right), respectively. b The NBRE motif is the only significantly enriched known motif at sites with upregulated H3K27ac peaks in the tumor samples (HOMER 54 ; P

    Techniques Used: Functional Assay, Expressing

    Identification of recurrent rearrangements t(4;9)(q13;q31) in AciCCs. a Plots of copy number changes in four AciCCs with paired tumor-normal whole genome sequencing (WGS) show gains (green) and losses (red) in the individual tumors. b Circos plots of translocations in the four cases, with recurrent rearrangements t(4;9)(q13;q31) highlighted in red. c Upper panel: Detailed mapping of t(4;9)(q13;q31) chromosomal breakpoints of the four AciCCs with paired tumor-normal WGS and two AciCCs with only tumor WGS demonstrate the distribution of 4q13 breakpoints among ~ 340 kbps spanning eight different genes at the SCPP gene cluster (left side), and clustering of the 9q31 breakpoints upstream of the NR4A3 gene locus (right side). Middle panel: Detailed mapping of t(4;9)(q13;q31) chromosomal breakpoints of nine additional AciCCs with tumor hybrid capture sequencing data confirms the pattern of 4q13 breakpoints within the SCPP gene cluster (left) and upstream of the NR4A3 gene locus (right). Lower panel: SCPP gene cluster (left side), NR4A3 and neighboring genes (right side) with green and orange bars indicating the location of NR4A3 break apart FISH probes. d Absolute number of cases with genomic rearrangements of the NR4A3 gene locus in 28 AciCCs and 75 other salivary gland neoplasms analyzed by FISH. e mRNA expression (log2 FPKM values) of NR4A3 and neighboring genes in ten tumor samples and three normal parotid gland samples, with only NR4A3 showing a significant upregulation (deSeq2 47 ; *** P
    Figure Legend Snippet: Identification of recurrent rearrangements t(4;9)(q13;q31) in AciCCs. a Plots of copy number changes in four AciCCs with paired tumor-normal whole genome sequencing (WGS) show gains (green) and losses (red) in the individual tumors. b Circos plots of translocations in the four cases, with recurrent rearrangements t(4;9)(q13;q31) highlighted in red. c Upper panel: Detailed mapping of t(4;9)(q13;q31) chromosomal breakpoints of the four AciCCs with paired tumor-normal WGS and two AciCCs with only tumor WGS demonstrate the distribution of 4q13 breakpoints among ~ 340 kbps spanning eight different genes at the SCPP gene cluster (left side), and clustering of the 9q31 breakpoints upstream of the NR4A3 gene locus (right side). Middle panel: Detailed mapping of t(4;9)(q13;q31) chromosomal breakpoints of nine additional AciCCs with tumor hybrid capture sequencing data confirms the pattern of 4q13 breakpoints within the SCPP gene cluster (left) and upstream of the NR4A3 gene locus (right). Lower panel: SCPP gene cluster (left side), NR4A3 and neighboring genes (right side) with green and orange bars indicating the location of NR4A3 break apart FISH probes. d Absolute number of cases with genomic rearrangements of the NR4A3 gene locus in 28 AciCCs and 75 other salivary gland neoplasms analyzed by FISH. e mRNA expression (log2 FPKM values) of NR4A3 and neighboring genes in ten tumor samples and three normal parotid gland samples, with only NR4A3 showing a significant upregulation (deSeq2 47 ; *** P

    Techniques Used: Sequencing, Fluorescence In Situ Hybridization, Expressing

    Genomic breakpoints in AciCCs correlate with active chromatin marks and NR4A3 binding sites at the 4q13 SCPP gene cluster. Summary of (top to bottom) mRNA expression (log2(FPKM)), gene loci (Genes), genomic translocation breakpoints (TXs), copy-number variations (CNVs), active (H3K27ac, H3K4me3) and repressive (H3K27me3) histone marks, NR4A3 binding sites, CTCF binding sites, DNA methylation, topologically associated domains (TADs), and chromatin contacts (HiC) 10 for the chromosomal regions surrounding the 4q13 (left panel) and 9q31 (right panel) breakpoints in normal parotid gland and AciCC tumor tissues. mRNA expression is shown for ten AciCC tumors and three normal parotid gland samples in red and blue, respectively (Box-plot centre line: median; bounds of box: 25 and 75% quantiles; whiskers: extend to last value greater than Q1–1.5*IQR, and last value less than Q3+1.5*IQR respectively. Here IQR is the inter quartile range, Q1 is the first, and Q3 the third quartile). Black bars demonstrating the translocations correspond to genomic material included in the rearrangement, with red and blue bars indicating gains and losses, respectively. For each ChIP-seq experiment, ChIP signals (barcharts), as well as corresponding peaks (directly below ChIP signals) are shown. For H3K27ac, the super-enhancer peaks are shown in addition (purple). Furthermore, CTCF motifs within CTCF peaks are shown (below CTCF peaks). Blue arrows indicate motifs on the forward strand, whereas red arrows indicate motifs on the reverse strand. The DNA methylation tracks show the average methylation within 1 kb binned regions. Different TADs are indicated in different colors
    Figure Legend Snippet: Genomic breakpoints in AciCCs correlate with active chromatin marks and NR4A3 binding sites at the 4q13 SCPP gene cluster. Summary of (top to bottom) mRNA expression (log2(FPKM)), gene loci (Genes), genomic translocation breakpoints (TXs), copy-number variations (CNVs), active (H3K27ac, H3K4me3) and repressive (H3K27me3) histone marks, NR4A3 binding sites, CTCF binding sites, DNA methylation, topologically associated domains (TADs), and chromatin contacts (HiC) 10 for the chromosomal regions surrounding the 4q13 (left panel) and 9q31 (right panel) breakpoints in normal parotid gland and AciCC tumor tissues. mRNA expression is shown for ten AciCC tumors and three normal parotid gland samples in red and blue, respectively (Box-plot centre line: median; bounds of box: 25 and 75% quantiles; whiskers: extend to last value greater than Q1–1.5*IQR, and last value less than Q3+1.5*IQR respectively. Here IQR is the inter quartile range, Q1 is the first, and Q3 the third quartile). Black bars demonstrating the translocations correspond to genomic material included in the rearrangement, with red and blue bars indicating gains and losses, respectively. For each ChIP-seq experiment, ChIP signals (barcharts), as well as corresponding peaks (directly below ChIP signals) are shown. For H3K27ac, the super-enhancer peaks are shown in addition (purple). Furthermore, CTCF motifs within CTCF peaks are shown (below CTCF peaks). Blue arrows indicate motifs on the forward strand, whereas red arrows indicate motifs on the reverse strand. The DNA methylation tracks show the average methylation within 1 kb binned regions. Different TADs are indicated in different colors

    Techniques Used: Binding Assay, Expressing, Translocation Assay, DNA Methylation Assay, Hydrophobic Interaction Chromatography, Chromatin Immunoprecipitation, Methylation

    Rearrangements t(4;9)(q13;q31) in AciCCs juxtapose the NR4A3 gene locus proximal to active enhancers and NR4A3 binding sites. Detailed presentation of active (H3K27ac, H3K4me3) and repressive (H3K27me3) histone marks, NR4A3 binding sites, CTCF binding sites, and DNA methylation levels in normal parotid gland ( a ) and three distinct AciCC tumor samples AciCC3 ( b ), AciCC1 ( c ) and AciCC2 ( d ). For each ChIP-seq experiment, ChIP signals (barcharts) as well as corresponding peaks (directly below ChIP signals) are shown. For H3K27ac, the super-enhancer peaks are shown in addition (purple). Furthermore, CTCF motifs within CTCF peaks are shown (below CTCF peaks). Blue arrows indicate motifs on the forward strand, whereas red arrows indicate motifs on the reverse strand. The DNA methylation tracks show the average methylation within 1 kb binned regions
    Figure Legend Snippet: Rearrangements t(4;9)(q13;q31) in AciCCs juxtapose the NR4A3 gene locus proximal to active enhancers and NR4A3 binding sites. Detailed presentation of active (H3K27ac, H3K4me3) and repressive (H3K27me3) histone marks, NR4A3 binding sites, CTCF binding sites, and DNA methylation levels in normal parotid gland ( a ) and three distinct AciCC tumor samples AciCC3 ( b ), AciCC1 ( c ) and AciCC2 ( d ). For each ChIP-seq experiment, ChIP signals (barcharts) as well as corresponding peaks (directly below ChIP signals) are shown. For H3K27ac, the super-enhancer peaks are shown in addition (purple). Furthermore, CTCF motifs within CTCF peaks are shown (below CTCF peaks). Blue arrows indicate motifs on the forward strand, whereas red arrows indicate motifs on the reverse strand. The DNA methylation tracks show the average methylation within 1 kb binned regions

    Techniques Used: Binding Assay, DNA Methylation Assay, Chromatin Immunoprecipitation, Methylation

    Detailed characterization of rearrangements t(4;9)(q13;q31) in 15 AciCCs identify three different breakpoint patterns. Detailed presentation of rearrangements in 15 AciCCs with t(4;9)(q13;q31), with black bars indicating genomic material included in the rearrangement. Active (H3K27ac, H3K4me3) and repressive (H3K27me3) histone marks, NR4A3 binding sites and CTCF binding sites in normal parotid gland tissue are presented for comparison. Source data for translocation breakpoints are provided as a Source Data file
    Figure Legend Snippet: Detailed characterization of rearrangements t(4;9)(q13;q31) in 15 AciCCs identify three different breakpoint patterns. Detailed presentation of rearrangements in 15 AciCCs with t(4;9)(q13;q31), with black bars indicating genomic material included in the rearrangement. Active (H3K27ac, H3K4me3) and repressive (H3K27me3) histone marks, NR4A3 binding sites and CTCF binding sites in normal parotid gland tissue are presented for comparison. Source data for translocation breakpoints are provided as a Source Data file

    Techniques Used: Binding Assay, Translocation Assay

    10) Product Images from "Antibodies anti-Shiga toxin 2 B subunit from chicken egg yolk: Isolation, purification and neutralization efficacy"

    Article Title: Antibodies anti-Shiga toxin 2 B subunit from chicken egg yolk: Isolation, purification and neutralization efficacy

    Journal: Toxicon

    doi: 10.1016/j.toxicon.2011.07.009

    Detection of antibody binding to Stx2 holotoxin in solution by a sandwich ELISA. Plates were coated with purified IgY or IgG antibodies, followed by incubation with 3-fold serial dilutions of Stx2 supernatant. Anti-Stx2B IgG POD was used as the second antibody. DH5α supernatant was used as negative control.
    Figure Legend Snippet: Detection of antibody binding to Stx2 holotoxin in solution by a sandwich ELISA. Plates were coated with purified IgY or IgG antibodies, followed by incubation with 3-fold serial dilutions of Stx2 supernatant. Anti-Stx2B IgG POD was used as the second antibody. DH5α supernatant was used as negative control.

    Techniques Used: Binding Assay, Sandwich ELISA, Purification, Incubation, Negative Control

    Recombinant Stx2B protein purified by affinity chromatography. A. SDS-PAGE (12.5% acrylamide, under reducing conditions). Lane 1. Purified recombinant Stx2B protein. Lane M. Protein standard. Gel was stained with Coomassie Blue. B. Western immunoblot. Lane 1. Purified recombinant Stx2B protein. Lane M. Prestained protein standard. Membrane was incubated with anti-His antibody and anti-mouse ECL. Arrow : Stx2B subunit position.
    Figure Legend Snippet: Recombinant Stx2B protein purified by affinity chromatography. A. SDS-PAGE (12.5% acrylamide, under reducing conditions). Lane 1. Purified recombinant Stx2B protein. Lane M. Protein standard. Gel was stained with Coomassie Blue. B. Western immunoblot. Lane 1. Purified recombinant Stx2B protein. Lane M. Prestained protein standard. Membrane was incubated with anti-His antibody and anti-mouse ECL. Arrow : Stx2B subunit position.

    Techniques Used: Recombinant, Purification, Affinity Chromatography, SDS Page, Staining, Western Blot, Incubation

    Antibody recognition of recombinant Stx2B and native Stx2 holotoxin in solid phase. ELISA microplates coated with recombinant Stx2B (A) or Stx2 holotoxin (B) and incubated with 2-fold serial dilutions of purified IgY and IgG antibodies (at the same protein concentration). Preimmune IgY, and preimmune IgG correspond, respectively, to purified antibodies from eggs and sera collected before immunization.
    Figure Legend Snippet: Antibody recognition of recombinant Stx2B and native Stx2 holotoxin in solid phase. ELISA microplates coated with recombinant Stx2B (A) or Stx2 holotoxin (B) and incubated with 2-fold serial dilutions of purified IgY and IgG antibodies (at the same protein concentration). Preimmune IgY, and preimmune IgG correspond, respectively, to purified antibodies from eggs and sera collected before immunization.

    Techniques Used: Recombinant, Enzyme-linked Immunosorbent Assay, Incubation, Purification, Protein Concentration

    Recognition of Stx2B and Stx2 holotoxin by IgY and IgG antibodies using Western immunoblotting. Lanes 1 and 3. Purified recombinant Stx2B protein. Lanes 2 and 4. Stx2 holotoxin. Lane M. prestained protein standard. Membrane was incubated with purified anti-Stx2B IgY and anti-IgY POD (A) or rabbit sera and anti-IgG POD (B). Arrow : Stx2B subunit position.
    Figure Legend Snippet: Recognition of Stx2B and Stx2 holotoxin by IgY and IgG antibodies using Western immunoblotting. Lanes 1 and 3. Purified recombinant Stx2B protein. Lanes 2 and 4. Stx2 holotoxin. Lane M. prestained protein standard. Membrane was incubated with purified anti-Stx2B IgY and anti-IgY POD (A) or rabbit sera and anti-IgG POD (B). Arrow : Stx2B subunit position.

    Techniques Used: Western Blot, Purification, Recombinant, Incubation

    11) Product Images from "AMP Is a True Physiological Regulator of AMP-Activated Protein Kinase by Both Allosteric Activation and Enhancing Net Phosphorylation"

    Article Title: AMP Is a True Physiological Regulator of AMP-Activated Protein Kinase by Both Allosteric Activation and Enhancing Net Phosphorylation

    Journal: Cell Metabolism

    doi: 10.1016/j.cmet.2013.08.019

    Evidence that ACC Phosphorylation in G361 Cells Is Mediated by AMPK, and Effects of A23187 and Berberine in AMPK Knockout MEFs Expressing α1-T172D Mutant (A) FLAG-tagged inactive (D157A) mutant of AMPK-α2 was stably expressed by homologous recombination in G361 cells carrying an Flp recombinase target site (see Experimental Procedures ) to generate dominant-negative (DN) cells. The graph shows AMPK activity (mean ± SEM, n = 4) measured in immunoprecipitates from control (WT) and DN cells with and without treatment with 10 μM A23187, while the pictures below show results of western blotting to determine expression and phosphorylation of various proteins. (B) As in (A), except the cells were treated with increasing concentrations of A769662 (30, 100, 300, 500, 1000 μM) or 10 μM A23187. (C) Effects of A23187 and berberine on AMPK activity and ACC phosphorylation in AMPK KO MEFs that were either untransfected or had been transfected with DNAs encoding myc-tagged AMPK-α1 (wild-type or T172D mutant), AMPK-β2, and AMPK-γ1. Data are mean ± SEM (n = 4). Significant differences from control without A23187 or berberine are shown.
    Figure Legend Snippet: Evidence that ACC Phosphorylation in G361 Cells Is Mediated by AMPK, and Effects of A23187 and Berberine in AMPK Knockout MEFs Expressing α1-T172D Mutant (A) FLAG-tagged inactive (D157A) mutant of AMPK-α2 was stably expressed by homologous recombination in G361 cells carrying an Flp recombinase target site (see Experimental Procedures ) to generate dominant-negative (DN) cells. The graph shows AMPK activity (mean ± SEM, n = 4) measured in immunoprecipitates from control (WT) and DN cells with and without treatment with 10 μM A23187, while the pictures below show results of western blotting to determine expression and phosphorylation of various proteins. (B) As in (A), except the cells were treated with increasing concentrations of A769662 (30, 100, 300, 500, 1000 μM) or 10 μM A23187. (C) Effects of A23187 and berberine on AMPK activity and ACC phosphorylation in AMPK KO MEFs that were either untransfected or had been transfected with DNAs encoding myc-tagged AMPK-α1 (wild-type or T172D mutant), AMPK-β2, and AMPK-γ1. Data are mean ± SEM (n = 4). Significant differences from control without A23187 or berberine are shown.

    Techniques Used: Knock-Out, Expressing, Mutagenesis, Stable Transfection, Homologous Recombination, Dominant Negative Mutation, Activity Assay, Western Blot, Transfection

    12) Product Images from "Coarse-Grained/Molecular Mechanics of the TAS2R38 Bitter Taste Receptor: Experimentally-Validated Detailed Structural Prediction of Agonist Binding"

    Article Title: Coarse-Grained/Molecular Mechanics of the TAS2R38 Bitter Taste Receptor: Experimentally-Validated Detailed Structural Prediction of Agonist Binding

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0064675

    Dose-response curves. Dose-response curves of TAS2R38 wild type and mutants after stimulation with increasing PTC and PROP concentrations (0 to 1000 µM). Each point corresponds to the mean ± standard deviation. The mean is calculated from at least three independent experiments. A–D) PTC application, E–H) PROP application.
    Figure Legend Snippet: Dose-response curves. Dose-response curves of TAS2R38 wild type and mutants after stimulation with increasing PTC and PROP concentrations (0 to 1000 µM). Each point corresponds to the mean ± standard deviation. The mean is calculated from at least three independent experiments. A–D) PTC application, E–H) PROP application.

    Techniques Used: Standard Deviation

    Dose-response curves. Dose-response curves of TAS2R38 wild type and mutants after stimulation with increasing PTC and PROP concentrations (0 to 1000 µM). Each point corresponds to the mean ± standard deviation. The mean is calculated from at least three independent experiments. A–C) PTC application, D–F) PROP application.
    Figure Legend Snippet: Dose-response curves. Dose-response curves of TAS2R38 wild type and mutants after stimulation with increasing PTC and PROP concentrations (0 to 1000 µM). Each point corresponds to the mean ± standard deviation. The mean is calculated from at least three independent experiments. A–C) PTC application, D–F) PROP application.

    Techniques Used: Standard Deviation

    Dose-response curves. Dose-response curves of TAS2R38 wild type and mutants after stimulation with increasing PTC and PROP concentrations (0 to 1000 µM). Each point corresponds to the mean ± standard deviation. The mean is calculated from at least three independent experiments. A-E) PTC application, F-J) PROP application.
    Figure Legend Snippet: Dose-response curves. Dose-response curves of TAS2R38 wild type and mutants after stimulation with increasing PTC and PROP concentrations (0 to 1000 µM). Each point corresponds to the mean ± standard deviation. The mean is calculated from at least three independent experiments. A-E) PTC application, F-J) PROP application.

    Techniques Used: Standard Deviation

    Agonists binding. Binding of PTC and PROP to the TAS2R38 bitter receptor as emerging from MM/CG simulations and experiments. Residues forming hydrophobic interactions and H-bonds with the agonists are indicated in blue and red, respectively. Residues shaping the cavities are in black color. The ECL2 loop does not interact directly with the agonists.
    Figure Legend Snippet: Agonists binding. Binding of PTC and PROP to the TAS2R38 bitter receptor as emerging from MM/CG simulations and experiments. Residues forming hydrophobic interactions and H-bonds with the agonists are indicated in blue and red, respectively. Residues shaping the cavities are in black color. The ECL2 loop does not interact directly with the agonists.

    Techniques Used: Binding Assay

    13) Product Images from "Luqin-like RYamide peptides regulate food-evoked responses in C. elegans"

    Article Title: Luqin-like RYamide peptides regulate food-evoked responses in C. elegans

    Journal: eLife

    doi: 10.7554/eLife.28877

    Expression patterns of npr-22 . ( A ) Expression pattern of npr-22 prom ::Venus reporter in an adult worm. White arrowheads, ventral nerve cord neurons. ( B ) Co-expression of npr-22 prom ::mCherry and flp-15 prom ::Venus in I2. ( C ) Co-expression of npr-22 prom ::mCherry and ceh-19 prom ::Venus in MC. ( D ) Co-expression of npr-22 prom ::mCherry and cat-1 prom ::Venus in RIH. ( E ) Co-expression of npr-22 prom ::mCherry and slt-1 prom ::Venus in RIH. ( F ) Co-expression of npr-22 prom ::Venus and ins-1 prom ::mCherry in AIA. ( G ) Co-expression of npr-22 prom ::mCherry and npr-1 prom ::Venus in AUA. ( H ) Co-expression of npr-22 prom ::mCherry and acr-5 prom ::Venus in B-type motor neurons. ( A–H ) Yellow scale bars, 100 µm. White scale bars, 20 µm.
    Figure Legend Snippet: Expression patterns of npr-22 . ( A ) Expression pattern of npr-22 prom ::Venus reporter in an adult worm. White arrowheads, ventral nerve cord neurons. ( B ) Co-expression of npr-22 prom ::mCherry and flp-15 prom ::Venus in I2. ( C ) Co-expression of npr-22 prom ::mCherry and ceh-19 prom ::Venus in MC. ( D ) Co-expression of npr-22 prom ::mCherry and cat-1 prom ::Venus in RIH. ( E ) Co-expression of npr-22 prom ::mCherry and slt-1 prom ::Venus in RIH. ( F ) Co-expression of npr-22 prom ::Venus and ins-1 prom ::mCherry in AIA. ( G ) Co-expression of npr-22 prom ::mCherry and npr-1 prom ::Venus in AUA. ( H ) Co-expression of npr-22 prom ::mCherry and acr-5 prom ::Venus in B-type motor neurons. ( A–H ) Yellow scale bars, 100 µm. White scale bars, 20 µm.

    Techniques Used: Expressing

    14) Product Images from "Large-Scale Phenomics Identifies Primary and Fine-Tuning Roles for CRKs in Responses Related to Oxidative Stress"

    Article Title: Large-Scale Phenomics Identifies Primary and Fine-Tuning Roles for CRKs in Responses Related to Oxidative Stress

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1005373

    Stomatal development and responses are impaired in specific crks . (A) A subset of the crk mutants showed altered water loss (shown as decrease of fresh weight) compared to Col-0 wild type plants after detachment of shoots from roots as evaluated from rosette weight. Complementation of the crk2 (B) , crk5 (C) or crk45 (D) mutants restored a wild type-like water loss phenotype as interpreted from decrease of fresh weight of excised rosettes. Asterisks indicate differences between crk mutants or complementation lines and Col-0 with statistical significance at * P
    Figure Legend Snippet: Stomatal development and responses are impaired in specific crks . (A) A subset of the crk mutants showed altered water loss (shown as decrease of fresh weight) compared to Col-0 wild type plants after detachment of shoots from roots as evaluated from rosette weight. Complementation of the crk2 (B) , crk5 (C) or crk45 (D) mutants restored a wild type-like water loss phenotype as interpreted from decrease of fresh weight of excised rosettes. Asterisks indicate differences between crk mutants or complementation lines and Col-0 with statistical significance at * P

    Techniques Used:

    Phylogenetic clustering of the Arabidopsis thaliana CRK group of RLKs and summary of the crk T-DNA insertion collection. (A) The coding region of the CRKs of Arabidopsis thaliana (including the truncated CRK9 At4g23170 and the putative pseudogene CRK35 At4g11500 ) was aligned using Muscle. The maximum-likelihood phylogenetic tree was estimated in MEGA6 using all sites (no gap penalty). The initial guide tree was constructed using maximum parsimony. Values at branch nodes represent bootstrap values (1000 replicates). CRK43 (At1g70740), CRK44 (At4g00960) and CRK45 (At4g11890) lack signal peptide, CRK ectodomain (ED) and transmembrane domain. (B) Information on T-DNA insertion lines for corresponding crk mutants is summarized: location of the T-DNA insertion in the gene (detailed information in S3 Fig ), number of T-DNA insertions per line (determined by quantitative PCR; S1 Table ) and transcript level of the corresponding crk mutant (according to semi-quantitative RT-PCR and qPCR; detailed information in S1 Table ). For two additional crk10 alleles ( crk10-1 and crk10-3 ) information can be found in S1 Table .
    Figure Legend Snippet: Phylogenetic clustering of the Arabidopsis thaliana CRK group of RLKs and summary of the crk T-DNA insertion collection. (A) The coding region of the CRKs of Arabidopsis thaliana (including the truncated CRK9 At4g23170 and the putative pseudogene CRK35 At4g11500 ) was aligned using Muscle. The maximum-likelihood phylogenetic tree was estimated in MEGA6 using all sites (no gap penalty). The initial guide tree was constructed using maximum parsimony. Values at branch nodes represent bootstrap values (1000 replicates). CRK43 (At1g70740), CRK44 (At4g00960) and CRK45 (At4g11890) lack signal peptide, CRK ectodomain (ED) and transmembrane domain. (B) Information on T-DNA insertion lines for corresponding crk mutants is summarized: location of the T-DNA insertion in the gene (detailed information in S3 Fig ), number of T-DNA insertions per line (determined by quantitative PCR; S1 Table ) and transcript level of the corresponding crk mutant (according to semi-quantitative RT-PCR and qPCR; detailed information in S1 Table ). For two additional crk10 alleles ( crk10-1 and crk10-3 ) information can be found in S1 Table .

    Techniques Used: Construct, Real-time Polymerase Chain Reaction, Mutagenesis, Quantitative RT-PCR

    15) Product Images from "Sulfation of Eggshell Proteins by Pipe Defines Dorsal-Ventral Polarity in the Drosophila embryo"

    Article Title: Sulfation of Eggshell Proteins by Pipe Defines Dorsal-Ventral Polarity in the Drosophila embryo

    Journal: Current biology : CB

    doi: 10.1016/j.cub.2009.05.050

    VML is expressed in follicle cells and becomes stably localized in the vitelline membrane layer of the eggshell Whole mount in situ hybridization to Vml mRNA in stage 10 egg chambers from wild-type (A) and Vml EPgy2 /Vml EPgy2 mutant (B) females. Distribution of VML-RFP expressed under the control of CY2-Gal4 in eggs (C, D) and vitelline membranes (E, F). Asterisks indicate the position of an egg and a vitelline membrane from non-expressing females. Distribution of E4-Gal4 driven VML-RFP in a stage 10 egg chamber (G, H) and egg (I, J). Distribution of 55B-Gal4 driven VML-RFP in a stage 10 egg chamber (K, L) and egg (M, N). Bright field images of eggs (C, I, M), empty vitelline membranes (E) and stage 10 egg chambers (G, K) are shown at left, while corresponding fluorescent images are shown in panels D, J, N, F, H, and L, respectively.
    Figure Legend Snippet: VML is expressed in follicle cells and becomes stably localized in the vitelline membrane layer of the eggshell Whole mount in situ hybridization to Vml mRNA in stage 10 egg chambers from wild-type (A) and Vml EPgy2 /Vml EPgy2 mutant (B) females. Distribution of VML-RFP expressed under the control of CY2-Gal4 in eggs (C, D) and vitelline membranes (E, F). Asterisks indicate the position of an egg and a vitelline membrane from non-expressing females. Distribution of E4-Gal4 driven VML-RFP in a stage 10 egg chamber (G, H) and egg (I, J). Distribution of 55B-Gal4 driven VML-RFP in a stage 10 egg chamber (K, L) and egg (M, N). Bright field images of eggs (C, I, M), empty vitelline membranes (E) and stage 10 egg chambers (G, K) are shown at left, while corresponding fluorescent images are shown in panels D, J, N, F, H, and L, respectively.

    Techniques Used: Stable Transfection, In Situ Hybridization, Mutagenesis, Expressing

    16) Product Images from "Herpes Simplex Virus 1 UL37 Protein Tyrosine Residues Conserved among All Alphaherpesviruses Are Required for Interactions with Glycoprotein K, Cytoplasmic Virion Envelopment, and Infectious Virus Production"

    Article Title: Herpes Simplex Virus 1 UL37 Protein Tyrosine Residues Conserved among All Alphaherpesviruses Are Required for Interactions with Glycoprotein K, Cytoplasmic Virion Envelopment, and Infectious Virus Production

    Journal: Journal of Virology

    doi: 10.1128/JVI.01202-16

    Delineation of UL37 amino acids involved in infectious virus production. (A) Schematic of the UL37 protein depicting known functional domains and the approximate locations of nine single- and double-amino-acid replacements constructed to assess their role in infectious virus production. (B) Images of viral plaques produced in the transfection-infection complementation of the UL37-null virus. Vero cells were transfected with each plasmid. After 36 h, plasmid-transfected cells were infected with UL37-null virus at an MOI of 5 and virus stocks were collected at 24 hpi. Viral plaques were visualized by immunohistochemistry at 48 hpi (see Materials and Methods). The plasmids encoding mutations in the amino acids of UL37 that were able to complement the UL37-null virus are marked with a green plus, and the mutations which were not able to complement are marked by a red minus. (C) Viral titers obtained in the transfection-infection complementation assay. Titers of virus stocks collected at 24 hpi with the UL37-null virus were determined on the BD45 cell line, which expresses the UL37 protein in trans . A plasmid expressing the wild-type UL37 protein was used as a positive control. A second positive control consisted of mock transfection, followed by infection with wild-type HSV-1, while a UL20-expressing plasmid was used as a negative control.
    Figure Legend Snippet: Delineation of UL37 amino acids involved in infectious virus production. (A) Schematic of the UL37 protein depicting known functional domains and the approximate locations of nine single- and double-amino-acid replacements constructed to assess their role in infectious virus production. (B) Images of viral plaques produced in the transfection-infection complementation of the UL37-null virus. Vero cells were transfected with each plasmid. After 36 h, plasmid-transfected cells were infected with UL37-null virus at an MOI of 5 and virus stocks were collected at 24 hpi. Viral plaques were visualized by immunohistochemistry at 48 hpi (see Materials and Methods). The plasmids encoding mutations in the amino acids of UL37 that were able to complement the UL37-null virus are marked with a green plus, and the mutations which were not able to complement are marked by a red minus. (C) Viral titers obtained in the transfection-infection complementation assay. Titers of virus stocks collected at 24 hpi with the UL37-null virus were determined on the BD45 cell line, which expresses the UL37 protein in trans . A plasmid expressing the wild-type UL37 protein was used as a positive control. A second positive control consisted of mock transfection, followed by infection with wild-type HSV-1, while a UL20-expressing plasmid was used as a negative control.

    Techniques Used: Functional Assay, Construct, Produced, Transfection, Infection, Plasmid Preparation, Immunohistochemistry, Expressing, Positive Control, Negative Control

    Predicted structure and dynamics of the HSV-1 UL37 protein. (A) Space-filling predictive model of 570 amino acids in the amino terminus of pUL37 in HSV-1 based on the known crystal structure of a corresponding amino-terminal region of PRV UL37. Blue, Y476-Y477 and Y480; orange, P262-L263; red, P408; green, P519; magenta, G419-F420. (B) Sequence logo depicts the relative conservation of amino acids 407 to 411, 473 to 484, and 518 to 520 (top portion of panel B). Approximate distances between the aromatic residues Y474, Y480, and F484 and P408 and P519 (bottom portion of panel B). (C) In silico alanine-scanning mutagenesis. The difference between the free Gibbs energy before and after the mutation (ΔΔ G ) is shown on the y axis. Values are reported as the deviation from the median ΔΔ G of UL37 tyrosine-to-alanine mutations. Negative values indicate stabilizing mutations (green). Positive values indicate destabilizing mutations (red).
    Figure Legend Snippet: Predicted structure and dynamics of the HSV-1 UL37 protein. (A) Space-filling predictive model of 570 amino acids in the amino terminus of pUL37 in HSV-1 based on the known crystal structure of a corresponding amino-terminal region of PRV UL37. Blue, Y476-Y477 and Y480; orange, P262-L263; red, P408; green, P519; magenta, G419-F420. (B) Sequence logo depicts the relative conservation of amino acids 407 to 411, 473 to 484, and 518 to 520 (top portion of panel B). Approximate distances between the aromatic residues Y474, Y480, and F484 and P408 and P519 (bottom portion of panel B). (C) In silico alanine-scanning mutagenesis. The difference between the free Gibbs energy before and after the mutation (ΔΔ G ) is shown on the y axis. Values are reported as the deviation from the median ΔΔ G of UL37 tyrosine-to-alanine mutations. Negative values indicate stabilizing mutations (green). Positive values indicate destabilizing mutations (red).

    Techniques Used: Sequencing, In Silico, Mutagenesis

    Effect of the DC474-480 mutations on UL37 interactions with gK. (A) Lysates of Vero cells infected with either wild-type HSV-1(F), VC1, or DC474-480 viruses were collected at 24 hpi, electrophoretically separated, blotted onto nitrocellulose membranes, and reacted with either anti-V5 (gK), anti-UL37, or anti-VP5 antibodies. The lanes in the blot for anti-UL37 and anti-V5 panels were spliced from different sections of the same blot, identified by the white line separating the lanes. (B) Lysates prepared as described for panel A were immunoprecipitated with the anti-V5 (gK) antibody. Electrophoretically separated proteins of the immunoprecipitates were blotted onto nitrocellulose membranes, and the presence of UL37 gK, UL20, or UL37 protein was detected by reacting the blots with either anti-V5, anti-FLAG, or anti-UL37 antibodies, respectively. No VP5 was detected when the immunoprecipitate was probed with anti-VP5 antibody (negative control).
    Figure Legend Snippet: Effect of the DC474-480 mutations on UL37 interactions with gK. (A) Lysates of Vero cells infected with either wild-type HSV-1(F), VC1, or DC474-480 viruses were collected at 24 hpi, electrophoretically separated, blotted onto nitrocellulose membranes, and reacted with either anti-V5 (gK), anti-UL37, or anti-VP5 antibodies. The lanes in the blot for anti-UL37 and anti-V5 panels were spliced from different sections of the same blot, identified by the white line separating the lanes. (B) Lysates prepared as described for panel A were immunoprecipitated with the anti-V5 (gK) antibody. Electrophoretically separated proteins of the immunoprecipitates were blotted onto nitrocellulose membranes, and the presence of UL37 gK, UL20, or UL37 protein was detected by reacting the blots with either anti-V5, anti-FLAG, or anti-UL37 antibodies, respectively. No VP5 was detected when the immunoprecipitate was probed with anti-VP5 antibody (negative control).

    Techniques Used: Infection, Immunoprecipitation, Negative Control

    Construction and characterization of UL37 mutant viruses. (A) Schematic representation of the UL37 mutant viruses constructed on the viral genomic background via double-Red mutagenesis on the HSV-1(F) and VC1 genomes cloned as a bacterial artificial chromosome. The approximate locations of the constructed mutations are shown. (B to E) Replication kinetics of wild-type and selected mutant viruses on Vero and BD45 cells. Viruses were adsorbed on nearly confluent monolayers of Vero or BD45 cells. Cells were infected with each virus at an MOI of 2. Virus stocks were collected at the indicated times, and titers were determined on both Vero and BD45 cells. Virus titers from three independent cultures were averaged, and the standard deviation was calculated for each time point.
    Figure Legend Snippet: Construction and characterization of UL37 mutant viruses. (A) Schematic representation of the UL37 mutant viruses constructed on the viral genomic background via double-Red mutagenesis on the HSV-1(F) and VC1 genomes cloned as a bacterial artificial chromosome. The approximate locations of the constructed mutations are shown. (B to E) Replication kinetics of wild-type and selected mutant viruses on Vero and BD45 cells. Viruses were adsorbed on nearly confluent monolayers of Vero or BD45 cells. Cells were infected with each virus at an MOI of 2. Virus stocks were collected at the indicated times, and titers were determined on both Vero and BD45 cells. Virus titers from three independent cultures were averaged, and the standard deviation was calculated for each time point.

    Techniques Used: Mutagenesis, Construct, Clone Assay, Infection, Standard Deviation

    Multiple-sequence alignment of 20 alphaherpesvirus-encoded UL37 proteins. A sequence alignment of the UL37 protein from 20 different alphaherpesviruses encompassing the amino-terminal half of UL37 corresponding to the portion of PRV UL37 with a published crystal structure ( 38 ) is shown. Amino acid residues are colored according to their side chain chemistry. Red arrowheads indicate the highly conserved residues that were mutated to alanines.
    Figure Legend Snippet: Multiple-sequence alignment of 20 alphaherpesvirus-encoded UL37 proteins. A sequence alignment of the UL37 protein from 20 different alphaherpesviruses encompassing the amino-terminal half of UL37 corresponding to the portion of PRV UL37 with a published crystal structure ( 38 ) is shown. Amino acid residues are colored according to their side chain chemistry. Red arrowheads indicate the highly conserved residues that were mutated to alanines.

    Techniques Used: Sequencing

    Sequence alignment of alpha-, beta-, and gammaherpesvirus UL37 proteins. Sequence alignment of HSV-1, HSV-2, HCMV, and EBV UL37 proteins was performed as described in Materials and Methods. The region is similar to the aa 470-to-485 codon region of Fig. 1 . The consensus sequence logo depicts the relative conservation of each residue. Orange highlights conserved proline, and yellow highlights conserved phenylalanine. The region Y551-Y557 corresponding to Y474-Y480 shown in Fig. 1 is highlighted in blue.
    Figure Legend Snippet: Sequence alignment of alpha-, beta-, and gammaherpesvirus UL37 proteins. Sequence alignment of HSV-1, HSV-2, HCMV, and EBV UL37 proteins was performed as described in Materials and Methods. The region is similar to the aa 470-to-485 codon region of Fig. 1 . The consensus sequence logo depicts the relative conservation of each residue. Orange highlights conserved proline, and yellow highlights conserved phenylalanine. The region Y551-Y557 corresponding to Y474-Y480 shown in Fig. 1 is highlighted in blue.

    Techniques Used: Sequencing

    17) Product Images from "Identification of cytochrome P450 monooxygenase genes from the white-rot fungus Phlebia brevispora"

    Article Title: Identification of cytochrome P450 monooxygenase genes from the white-rot fungus Phlebia brevispora

    Journal: AMB Express

    doi: 10.1186/2191-0855-2-8

    Amino acid sequence alignments of CYP pb-1 , pb -2 and pb -3 from P. brevispora . The degenerate forward and reverse primers used for the searching for partial CYP cDNAs were constructed based on the consensus motifs squared in the alignments.
    Figure Legend Snippet: Amino acid sequence alignments of CYP pb-1 , pb -2 and pb -3 from P. brevispora . The degenerate forward and reverse primers used for the searching for partial CYP cDNAs were constructed based on the consensus motifs squared in the alignments.

    Techniques Used: Sequencing, Construct

    18) Product Images from "Flexible pseudotyping of retrovirus using recombinase-mediated cassette exchange"

    Article Title: Flexible pseudotyping of retrovirus using recombinase-mediated cassette exchange

    Journal: Biotechnology Letters

    doi: 10.1007/s10529-018-2515-6

    Generation of the recombinant retrovirus producer cell line with exchangeable transgene and envelope expression cassettes. a Schematic representation of cell line development strategy, HEK293-derived cells stably transfected with MLV gag-pol gene and tagged with a Flp/ FRT ), were tagged with a Cre/ Lox RMCE cassette for flexible envelope expression. Orange-filled boxes represent gag - pol introduced with random integration; Blue and Green colored boxes with small white flags represent both RMCE systems introduced for flexible transgene and envelope exchange; Pink, brown and yellow colored boxes with crossed flags represent envelope expression cassettes after RMCE. b Schematic representation of pTagLoxPGFP-zeo plasmid containing a CMV promoter, a GFP-zeo reporter gene, two polyadenylation sequences, two Lox sites and a promoterless puromycin resistance gene. c Schematic representation of the targeting plasmid containing, CRE/ Lox recombination sites, a CMV promoter, Rabbit beta-globin intron, the envelope of interest, a polyadenylation sequence and a composite promoter (SV40/FerH/mEF1α5’UTR) to drive puromycin expression after successful RMCE. d ). Error bars correspond to standard deviations ( n ≥ 3)
    Figure Legend Snippet: Generation of the recombinant retrovirus producer cell line with exchangeable transgene and envelope expression cassettes. a Schematic representation of cell line development strategy, HEK293-derived cells stably transfected with MLV gag-pol gene and tagged with a Flp/ FRT ), were tagged with a Cre/ Lox RMCE cassette for flexible envelope expression. Orange-filled boxes represent gag - pol introduced with random integration; Blue and Green colored boxes with small white flags represent both RMCE systems introduced for flexible transgene and envelope exchange; Pink, brown and yellow colored boxes with crossed flags represent envelope expression cassettes after RMCE. b Schematic representation of pTagLoxPGFP-zeo plasmid containing a CMV promoter, a GFP-zeo reporter gene, two polyadenylation sequences, two Lox sites and a promoterless puromycin resistance gene. c Schematic representation of the targeting plasmid containing, CRE/ Lox recombination sites, a CMV promoter, Rabbit beta-globin intron, the envelope of interest, a polyadenylation sequence and a composite promoter (SV40/FerH/mEF1α5’UTR) to drive puromycin expression after successful RMCE. d ). Error bars correspond to standard deviations ( n ≥ 3)

    Techniques Used: Recombinant, Expressing, Derivative Assay, Stable Transfection, Transfection, Plasmid Preparation, Sequencing

    19) Product Images from "Collagen COL22A1 maintains vascular stability and mutations in COL22A1 are potentially associated with intracranial aneurysms"

    Article Title: Collagen COL22A1 maintains vascular stability and mutations in COL22A1 are potentially associated with intracranial aneurysms

    Journal: Disease Models & Mechanisms

    doi: 10.1242/dmm.033654

    The E736D mutation affects COL22A1 function and results in an increased percentage of embryos with hemorrhages. (A) Transient overexpression of the human E736D variant of COL22A1 causes hemorrhagic phenotypes in WT embryo background. Compared with the uninjected embryos and WT hsp70:COL22A1 plasmid DNA-injected embryos, the human E736D variant hsp70:COL22A1 DNA-injected embryos exhibited a higher percentage of hemorrhages after COL22A1 expression was induced by heat shock. (B) The human E736D COL22A1 construct fails to rescue the zebrafish col22a1 −/− mutant phenotype. In contrast, heat-shock-inducible overexpression of human WT COL22A1 partially rescues the hemorrhagic phenotype in col22a1 −/− mutant embryos. (C,D) MMP9 mediates hemorrhage formation in E736D COL22A1 -overexpressing embryos. (C) qPCR analysis of mmp9 expression in control uninjected embryos, in embryos injected with human WT and E736D hsp70:COL22A1 constructs, and in stable transgenic WT and E736D hsp70:COL22A1 embryos following the heat shock. There was an increase in mmp9 expression in E736D COL22A1 -overexpressing transgenic embryos. The level of expression in uninjected embryos was normalized to 1. (D) Inhibition of MMPs with a chemical GM6001 treatment rescues the hemorrhagic phenotype in human E736D hsp70:COL22A1 -overexpressing embryos. There was a reduced percentage of embryos with hemorrhages among GM6001-treated embryos that were injected with E736D hsp70:COL22A1 DNA construct compared with DMSO-treated embryos that were injected with the same construct. * P
    Figure Legend Snippet: The E736D mutation affects COL22A1 function and results in an increased percentage of embryos with hemorrhages. (A) Transient overexpression of the human E736D variant of COL22A1 causes hemorrhagic phenotypes in WT embryo background. Compared with the uninjected embryos and WT hsp70:COL22A1 plasmid DNA-injected embryos, the human E736D variant hsp70:COL22A1 DNA-injected embryos exhibited a higher percentage of hemorrhages after COL22A1 expression was induced by heat shock. (B) The human E736D COL22A1 construct fails to rescue the zebrafish col22a1 −/− mutant phenotype. In contrast, heat-shock-inducible overexpression of human WT COL22A1 partially rescues the hemorrhagic phenotype in col22a1 −/− mutant embryos. (C,D) MMP9 mediates hemorrhage formation in E736D COL22A1 -overexpressing embryos. (C) qPCR analysis of mmp9 expression in control uninjected embryos, in embryos injected with human WT and E736D hsp70:COL22A1 constructs, and in stable transgenic WT and E736D hsp70:COL22A1 embryos following the heat shock. There was an increase in mmp9 expression in E736D COL22A1 -overexpressing transgenic embryos. The level of expression in uninjected embryos was normalized to 1. (D) Inhibition of MMPs with a chemical GM6001 treatment rescues the hemorrhagic phenotype in human E736D hsp70:COL22A1 -overexpressing embryos. There was a reduced percentage of embryos with hemorrhages among GM6001-treated embryos that were injected with E736D hsp70:COL22A1 DNA construct compared with DMSO-treated embryos that were injected with the same construct. * P

    Techniques Used: Mutagenesis, Over Expression, Variant Assay, Plasmid Preparation, Injection, Expressing, Construct, Real-time Polymerase Chain Reaction, Transgenic Assay, Inhibition

    20) Product Images from "Multiple expression cassette exchange via TP901‐1, R4, and Bxb1 integrase systems on a mouse artificial chromosome"

    Article Title: Multiple expression cassette exchange via TP901‐1, R4, and Bxb1 integrase systems on a mouse artificial chromosome

    Journal: FEBS Open Bio

    doi: 10.1002/2211-5463.12169

    Construction of the MEEVS reporter on PAC vector. (A) Construction of donor vectors for components of MEEVS expression units. All donor vectors contain a pair of LR Clonase recognition sites (L1–L4 or R3/R4) for the Gateway system. The first donor vector contains CAG promoter ( pCAG ), and second donor vectors contain luciferase genes (Gluc, CL uc, or EL uc) together with a polyadenylation signal ( pA ) that is flanked by integrase recognition sites for TP 901, R4, or Bxb1 (colored arrowheads). The third vectors contain fluorescent protein expression cassettes ( GFP , OFP , or RFP followed by pA ). (B) Assembling the donor vectors on pDEST vector using the Gateway system. Each MEEVS reporter unit was produced using LR Clonase that contained pCAG , luciferase between the integrase recognition sites and a fluorescent protein expression cassette. Then, an insulator sequence, DN ase I hypersensitive 4 ( HS 4) site of chicken β‐globin, was added to each of MEEVS reporter unit. (C) Assembling MEEVS reporter units on a PAC vector. Using a Nhe I restriction enzyme site, each MEEVS reporter unit was sequentially inserted into the PAC vector that comprises an HS 4 insulator, loxP sequence, and 3′ part of the HPRT gene, which are required for the subsequent transfer of the resulting pPAC ‐ MEEVS reporter into mouse artificial chromosome (MAC).
    Figure Legend Snippet: Construction of the MEEVS reporter on PAC vector. (A) Construction of donor vectors for components of MEEVS expression units. All donor vectors contain a pair of LR Clonase recognition sites (L1–L4 or R3/R4) for the Gateway system. The first donor vector contains CAG promoter ( pCAG ), and second donor vectors contain luciferase genes (Gluc, CL uc, or EL uc) together with a polyadenylation signal ( pA ) that is flanked by integrase recognition sites for TP 901, R4, or Bxb1 (colored arrowheads). The third vectors contain fluorescent protein expression cassettes ( GFP , OFP , or RFP followed by pA ). (B) Assembling the donor vectors on pDEST vector using the Gateway system. Each MEEVS reporter unit was produced using LR Clonase that contained pCAG , luciferase between the integrase recognition sites and a fluorescent protein expression cassette. Then, an insulator sequence, DN ase I hypersensitive 4 ( HS 4) site of chicken β‐globin, was added to each of MEEVS reporter unit. (C) Assembling MEEVS reporter units on a PAC vector. Using a Nhe I restriction enzyme site, each MEEVS reporter unit was sequentially inserted into the PAC vector that comprises an HS 4 insulator, loxP sequence, and 3′ part of the HPRT gene, which are required for the subsequent transfer of the resulting pPAC ‐ MEEVS reporter into mouse artificial chromosome (MAC).

    Techniques Used: Plasmid Preparation, Expressing, Luciferase, Produced, Sequencing

    Site‐specific insertion of the MEEVS reporter into a mouse artificial chromosome ( MAC ). (A) pPAC ‐ MEEVS reporter and Cre recombinase expression plasmid were cotransfected into CHO cells ( hprt −/− ) carrying a MAC vector. The MEEVS reporter was integrated into the MAC and regenerated a functional HPRT gene. (B) and (C) FISH analysis of CHO carrying MAC vectors. The white arrowhead and red signals (mouse Cot‐1 probe) indicate MAC vector; green signals indicate MEEVS reporter (probe of MEEVS vector labeled with FITC ). CHO cells harboring empty MAC vector (B) or MEEVS reporter‐containing MAC (C) were used.
    Figure Legend Snippet: Site‐specific insertion of the MEEVS reporter into a mouse artificial chromosome ( MAC ). (A) pPAC ‐ MEEVS reporter and Cre recombinase expression plasmid were cotransfected into CHO cells ( hprt −/− ) carrying a MAC vector. The MEEVS reporter was integrated into the MAC and regenerated a functional HPRT gene. (B) and (C) FISH analysis of CHO carrying MAC vectors. The white arrowhead and red signals (mouse Cot‐1 probe) indicate MAC vector; green signals indicate MEEVS reporter (probe of MEEVS vector labeled with FITC ). CHO cells harboring empty MAC vector (B) or MEEVS reporter‐containing MAC (C) were used.

    Techniques Used: Expressing, Plasmid Preparation, Functional Assay, Fluorescence In Situ Hybridization, Labeling

    21) Product Images from "Collagen COL22A1 maintains vascular stability and mutations in COL22A1 are potentially associated with intracranial aneurysms"

    Article Title: Collagen COL22A1 maintains vascular stability and mutations in COL22A1 are potentially associated with intracranial aneurysms

    Journal: Disease Models & Mechanisms

    doi: 10.1242/dmm.033654

    Overexpression of human E736D COL22A1 mRNA causes cell detachment during gastrulation, while the protein is retained in the cytoplasm leading to an increase in ER stress. (A,B) Cells fail to undergo epiboly and detach from the yolk in the E736D COL22A1 mRNA-injected embryo (B) during gastrulation compared with the human WT COL22A1 mRNA-injected embryo (A). (C-D″) Human E736D COL22A1 protein is retained in the cytoplasm during gastrulation, whereas WT COL22A1 is secreted into the extracellular space (arrows). Confocal microscopy analysis of human COL22A1 protein immunofluorescence (green, C,D) and phalloidin staining (red, C′,D′). Blue, nuclear DAPI staining. (E) Aggregation of human mutant COL22A1 in the cytoplasm induces ER stress. qPCR confirms the elevation of ER stress markers hsp5 and bip in human E736D COL22A1 mRNA-injected embryos compared with the human WT mRNA-injected embryos. Expression in the uninjected samples was normalized to 1. * P
    Figure Legend Snippet: Overexpression of human E736D COL22A1 mRNA causes cell detachment during gastrulation, while the protein is retained in the cytoplasm leading to an increase in ER stress. (A,B) Cells fail to undergo epiboly and detach from the yolk in the E736D COL22A1 mRNA-injected embryo (B) during gastrulation compared with the human WT COL22A1 mRNA-injected embryo (A). (C-D″) Human E736D COL22A1 protein is retained in the cytoplasm during gastrulation, whereas WT COL22A1 is secreted into the extracellular space (arrows). Confocal microscopy analysis of human COL22A1 protein immunofluorescence (green, C,D) and phalloidin staining (red, C′,D′). Blue, nuclear DAPI staining. (E) Aggregation of human mutant COL22A1 in the cytoplasm induces ER stress. qPCR confirms the elevation of ER stress markers hsp5 and bip in human E736D COL22A1 mRNA-injected embryos compared with the human WT mRNA-injected embryos. Expression in the uninjected samples was normalized to 1. * P

    Techniques Used: Over Expression, Injection, Confocal Microscopy, Immunofluorescence, Staining, Mutagenesis, Real-time Polymerase Chain Reaction, Expressing

    Identification of COL22A1 SNP variants. (A) The rs142175725 SNP predicted to result in the E736D amino acid substitution in COL22A1 segregates with affected individuals in the family. (B) Predicted protein structure of COL22A1 and specific amino acid position of SNPs (red asterisks) identified by WES and targeted genome sequencing. vWFA, von Willebrand factor; LamG, laminin G.
    Figure Legend Snippet: Identification of COL22A1 SNP variants. (A) The rs142175725 SNP predicted to result in the E736D amino acid substitution in COL22A1 segregates with affected individuals in the family. (B) Predicted protein structure of COL22A1 and specific amino acid position of SNPs (red asterisks) identified by WES and targeted genome sequencing. vWFA, von Willebrand factor; LamG, laminin G.

    Techniques Used: Sequencing

    The E736D mutation affects COL22A1 function and results in an increased percentage of embryos with hemorrhages. (A) Transient overexpression of the human E736D variant of COL22A1 causes hemorrhagic phenotypes in WT embryo background. Compared with the uninjected embryos and WT hsp70:COL22A1 plasmid DNA-injected embryos, the human E736D variant hsp70:COL22A1 DNA-injected embryos exhibited a higher percentage of hemorrhages after COL22A1 expression was induced by heat shock. (B) The human E736D COL22A1 construct fails to rescue the zebrafish col22a1 −/− mutant phenotype. In contrast, heat-shock-inducible overexpression of human WT COL22A1 partially rescues the hemorrhagic phenotype in col22a1 −/− mutant embryos. (C,D) MMP9 mediates hemorrhage formation in E736D COL22A1 -overexpressing embryos. (C) qPCR analysis of mmp9 expression in control uninjected embryos, in embryos injected with human WT and E736D hsp70:COL22A1 constructs, and in stable transgenic WT and E736D hsp70:COL22A1 embryos following the heat shock. There was an increase in mmp9 expression in E736D COL22A1 -overexpressing transgenic embryos. The level of expression in uninjected embryos was normalized to 1. (D) Inhibition of MMPs with a chemical GM6001 treatment rescues the hemorrhagic phenotype in human E736D hsp70:COL22A1 -overexpressing embryos. There was a reduced percentage of embryos with hemorrhages among GM6001-treated embryos that were injected with E736D hsp70:COL22A1 DNA construct compared with DMSO-treated embryos that were injected with the same construct. * P
    Figure Legend Snippet: The E736D mutation affects COL22A1 function and results in an increased percentage of embryos with hemorrhages. (A) Transient overexpression of the human E736D variant of COL22A1 causes hemorrhagic phenotypes in WT embryo background. Compared with the uninjected embryos and WT hsp70:COL22A1 plasmid DNA-injected embryos, the human E736D variant hsp70:COL22A1 DNA-injected embryos exhibited a higher percentage of hemorrhages after COL22A1 expression was induced by heat shock. (B) The human E736D COL22A1 construct fails to rescue the zebrafish col22a1 −/− mutant phenotype. In contrast, heat-shock-inducible overexpression of human WT COL22A1 partially rescues the hemorrhagic phenotype in col22a1 −/− mutant embryos. (C,D) MMP9 mediates hemorrhage formation in E736D COL22A1 -overexpressing embryos. (C) qPCR analysis of mmp9 expression in control uninjected embryos, in embryos injected with human WT and E736D hsp70:COL22A1 constructs, and in stable transgenic WT and E736D hsp70:COL22A1 embryos following the heat shock. There was an increase in mmp9 expression in E736D COL22A1 -overexpressing transgenic embryos. The level of expression in uninjected embryos was normalized to 1. (D) Inhibition of MMPs with a chemical GM6001 treatment rescues the hemorrhagic phenotype in human E736D hsp70:COL22A1 -overexpressing embryos. There was a reduced percentage of embryos with hemorrhages among GM6001-treated embryos that were injected with E736D hsp70:COL22A1 DNA construct compared with DMSO-treated embryos that were injected with the same construct. * P

    Techniques Used: Mutagenesis, Over Expression, Variant Assay, Plasmid Preparation, Injection, Expressing, Construct, Real-time Polymerase Chain Reaction, Transgenic Assay, Inhibition

    22) Product Images from "A salt-regulated peptide derived from the CAP superfamily protein negatively regulates salt-stress tolerance in Arabidopsis"

    Article Title: A salt-regulated peptide derived from the CAP superfamily protein negatively regulates salt-stress tolerance in Arabidopsis

    Journal: Journal of Experimental Botany

    doi: 10.1093/jxb/erv263

    Production of AtCAPE1 is mainly derived from root tissues and is regulated by salt. (A) Transcriptional levels of PROAtCAPE1 in different tissues were determined by RT-PCR. Total RNA was extracted from root (R), cotyledon (Co), ros ette leaf (RL), cauline leaf (CL), stem (St), flower (F) and silique (Si). 18S rRNA transcripts were used as internal control. (B) Salt response of the transcriptional levels of PROAtCAPE1 in shoots and roots. Ten-d-old seedlings of wild type (Ler) were treated with 125mM NaCl for 0, 3, and 24h. The transcripts of PROAtCAPE1 from the harvested roots and shoots were determined by RT-qPCR. Shown are the average values of (2 -∆Ct x1000) from four biological repeats. Error bars, means±SE ( PROAtCAPE1 transcripts in shoots versus PROAtCAPE1 transcripts in roots at different time points; Student’s t -test, ** P ≤0.01). (C) Relative level of endogenous AtCAPE1 in shoots and roots. Seedlings grown for 24h without (1/2 MS) and with 125mM NaCl were subjected to quantitative LC-MS/MS analysis. IS, internal standard. The average values from two biological repeats are shown. Error bars, means±SE. Asterisks indicate statistically significant differences between salt-treated and untreated samples (Student’s t -test; ** P ≤0.01). (D) Post-translational regulation of AtCAPE1 production. Protein extracts from the transgenic lines (CAPE1ox CNYD ) harbouring the AtCAPE1-eYFP fusion grown with (+) and without (-) 125mM NaCl for the indicated times were subjected to western blot analysis. The upper and lower bands with approximate size of 45.7 KDa and 26.3 KDa represent the expected size of the PROAtCAPE1-eYFP fusion protein and the AtCAPE1-eYFP fusion protein, respectively. The fusion proteins were detected by anti-GFP antibody. α-tubulin, loading control.
    Figure Legend Snippet: Production of AtCAPE1 is mainly derived from root tissues and is regulated by salt. (A) Transcriptional levels of PROAtCAPE1 in different tissues were determined by RT-PCR. Total RNA was extracted from root (R), cotyledon (Co), ros ette leaf (RL), cauline leaf (CL), stem (St), flower (F) and silique (Si). 18S rRNA transcripts were used as internal control. (B) Salt response of the transcriptional levels of PROAtCAPE1 in shoots and roots. Ten-d-old seedlings of wild type (Ler) were treated with 125mM NaCl for 0, 3, and 24h. The transcripts of PROAtCAPE1 from the harvested roots and shoots were determined by RT-qPCR. Shown are the average values of (2 -∆Ct x1000) from four biological repeats. Error bars, means±SE ( PROAtCAPE1 transcripts in shoots versus PROAtCAPE1 transcripts in roots at different time points; Student’s t -test, ** P ≤0.01). (C) Relative level of endogenous AtCAPE1 in shoots and roots. Seedlings grown for 24h without (1/2 MS) and with 125mM NaCl were subjected to quantitative LC-MS/MS analysis. IS, internal standard. The average values from two biological repeats are shown. Error bars, means±SE. Asterisks indicate statistically significant differences between salt-treated and untreated samples (Student’s t -test; ** P ≤0.01). (D) Post-translational regulation of AtCAPE1 production. Protein extracts from the transgenic lines (CAPE1ox CNYD ) harbouring the AtCAPE1-eYFP fusion grown with (+) and without (-) 125mM NaCl for the indicated times were subjected to western blot analysis. The upper and lower bands with approximate size of 45.7 KDa and 26.3 KDa represent the expected size of the PROAtCAPE1-eYFP fusion protein and the AtCAPE1-eYFP fusion protein, respectively. The fusion proteins were detected by anti-GFP antibody. α-tubulin, loading control.

    Techniques Used: Derivative Assay, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Mass Spectrometry, Liquid Chromatography with Mass Spectroscopy, Transgenic Assay, Western Blot

    Expression of various salt-inducible genes is downregulated by AtCAPE1. Ten-day-old seedlings were treated without and with salt for 12h. The transcript levels of the selected salt-inducible genes in wild-type (Ler) and proatcape1 mutant seedlings were determined by qRT-PCR: ACTIN2 (A), AREB1 and ABI5 (B), and RD29B , RD20 , ALDH7B4 , GolS2 , RD22 , and P5CS1 (C). Zero hours means that the seedlings were subjected to the medium indicated and harvested immediately. For proatcape1 , the mutants were subjected to either 125mM NaCl ( proatcape1 _Salt) or 125mM NaCl in the presence of 500nM AtCAPE1 peptide ( proatcape1 _Salt+AtCAPE1 peptide). The mean values from four biological repeats are shown. Error bars are means±SEM ( proatcape1 versus Ler upon salt treatment; Student’s t -test: ** P ≤0.01, * P ≤0.05).
    Figure Legend Snippet: Expression of various salt-inducible genes is downregulated by AtCAPE1. Ten-day-old seedlings were treated without and with salt for 12h. The transcript levels of the selected salt-inducible genes in wild-type (Ler) and proatcape1 mutant seedlings were determined by qRT-PCR: ACTIN2 (A), AREB1 and ABI5 (B), and RD29B , RD20 , ALDH7B4 , GolS2 , RD22 , and P5CS1 (C). Zero hours means that the seedlings were subjected to the medium indicated and harvested immediately. For proatcape1 , the mutants were subjected to either 125mM NaCl ( proatcape1 _Salt) or 125mM NaCl in the presence of 500nM AtCAPE1 peptide ( proatcape1 _Salt+AtCAPE1 peptide). The mean values from four biological repeats are shown. Error bars are means±SEM ( proatcape1 versus Ler upon salt treatment; Student’s t -test: ** P ≤0.01, * P ≤0.05).

    Techniques Used: Expressing, Mutagenesis, Quantitative RT-PCR

    Levels of PROAtCAPE1 transcripts under salinity. (A) Ten-day-old wild-type (Ler) seedlings were subjected to 150mM NaCl, 150mM KCl, 30mM LiCl, 300mM mannitol, and 100 μM abscisic acid (ABA). Relative transcripts indicate the normalized PROAtCAPE1 level ( PROAtCAPE1 / ACTIN2 ) from each sample compared with that in wild type in medium alone (1/2MS) at 0h. The bar shown here is the mean of three biological repeats. Error bars indicate means±SEM (stress-treated wild-type versus untreated wild-type at different time points; Student’s t -test: ** P ≤0.01, * P ≤0.05). (B) Ten-day-old wild-type seedlings were treated without (1/2MS) or with 125mM NaCl. Zero hours means that the seedlings were subjected to medium alone and harvested immediately. The bars shown here are the means from four biological repeats. Error bars indicate means±SEM (salt-treated wild-type versus untreated wild-type at different time points; Student’s t -test: ** P ,≤0.01, * P ,≤0.05).
    Figure Legend Snippet: Levels of PROAtCAPE1 transcripts under salinity. (A) Ten-day-old wild-type (Ler) seedlings were subjected to 150mM NaCl, 150mM KCl, 30mM LiCl, 300mM mannitol, and 100 μM abscisic acid (ABA). Relative transcripts indicate the normalized PROAtCAPE1 level ( PROAtCAPE1 / ACTIN2 ) from each sample compared with that in wild type in medium alone (1/2MS) at 0h. The bar shown here is the mean of three biological repeats. Error bars indicate means±SEM (stress-treated wild-type versus untreated wild-type at different time points; Student’s t -test: ** P ≤0.01, * P ≤0.05). (B) Ten-day-old wild-type seedlings were treated without (1/2MS) or with 125mM NaCl. Zero hours means that the seedlings were subjected to medium alone and harvested immediately. The bars shown here are the means from four biological repeats. Error bars indicate means±SEM (salt-treated wild-type versus untreated wild-type at different time points; Student’s t -test: ** P ,≤0.01, * P ,≤0.05).

    Techniques Used:

    Identification of AtCAPE1 in Arabidopsis . (A) Deduced amino acid sequence of the PROAtCAPE1 product. The predicted secretion signal peptide is underlined. The CAP domain is shaded in grey. The putative AtCAPE1 peptide is shaded in red. The cleavage site predicted to produce AtCAPE1 is indicated with an arrowhead. The putative cleavage signal motif is double-underlined. (B) LC-MS/MS spectrum of the synthetic AtCAPE1. The y-ion is the C-terminal fragments after peptide bond cleavage while the b-ion is the N-terminal fragments. (C) LC-MS/MS spectrum of the identified AtCAPE1 in Arabidopsis . (D) Schema representing the construct used for constitutive overexpression of enhanced yellow fluorescent protein (eYFP)-tagged PROAtCAPE1. The green box shows the CNYx motif. The putative CAPE is shown in red. The numbers indicate the predicted molecular weight of precursor protein tagged with eYFP (45.7kDa) and the cleaved precursor tagged with eYFP (26.3kDa). (E) Production of the precursor PROAtCAPE1 and the cleaved PROAtCAPE1 in CAPE1ox CNYD and CAPE1ox CNAD transgenic plants, where eYFP was fused to PROAtCAPE1 containing wild type (CNYD) and the mutated (CNAD) junction sequence, respectively. T3 seedlings derived from independent transgenic lines were sampled for western blotting with anti-GFP antibody. Coomassie blue staining was used for protein loading control. The lower panel shows the presence of the T-DNA insertions in the transgenic plants by genomic DNA PCR with the primer pair 35S-F’ and eYFP-R’ shown in (D).
    Figure Legend Snippet: Identification of AtCAPE1 in Arabidopsis . (A) Deduced amino acid sequence of the PROAtCAPE1 product. The predicted secretion signal peptide is underlined. The CAP domain is shaded in grey. The putative AtCAPE1 peptide is shaded in red. The cleavage site predicted to produce AtCAPE1 is indicated with an arrowhead. The putative cleavage signal motif is double-underlined. (B) LC-MS/MS spectrum of the synthetic AtCAPE1. The y-ion is the C-terminal fragments after peptide bond cleavage while the b-ion is the N-terminal fragments. (C) LC-MS/MS spectrum of the identified AtCAPE1 in Arabidopsis . (D) Schema representing the construct used for constitutive overexpression of enhanced yellow fluorescent protein (eYFP)-tagged PROAtCAPE1. The green box shows the CNYx motif. The putative CAPE is shown in red. The numbers indicate the predicted molecular weight of precursor protein tagged with eYFP (45.7kDa) and the cleaved precursor tagged with eYFP (26.3kDa). (E) Production of the precursor PROAtCAPE1 and the cleaved PROAtCAPE1 in CAPE1ox CNYD and CAPE1ox CNAD transgenic plants, where eYFP was fused to PROAtCAPE1 containing wild type (CNYD) and the mutated (CNAD) junction sequence, respectively. T3 seedlings derived from independent transgenic lines were sampled for western blotting with anti-GFP antibody. Coomassie blue staining was used for protein loading control. The lower panel shows the presence of the T-DNA insertions in the transgenic plants by genomic DNA PCR with the primer pair 35S-F’ and eYFP-R’ shown in (D).

    Techniques Used: Sequencing, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Construct, Over Expression, Molecular Weight, Transgenic Assay, Derivative Assay, Western Blot, Staining, Polymerase Chain Reaction

    AtCAPE1 negatively regulates the salt-tolerance response. (A) Growth response of proatcape1 mutants to salt stress and to AtCAPE1. Five-day-old seedlings were treated with various concentrations of NaCl in the absence (–) and presence (+) of various concentrations of synthetic AtCAPE1. The photograph was taken after treatment for another 10 d. (B) Semi-quantitative analysis of the phenotype of plants shown in (A). Each bar represents the mean percentage of the phenotypic pattern from two independent experiments. Error bars indicate means±SD. The phenotypic pattern according to leaf number and colour of seedlings was defined into categories I–IV as shown in the diagram (salt- and peptide- treated proatcape1 versus salt-treated wild-type Ler; Student’s t -test: ** P ≤0.01, * P ≤0.05). (C) Germination rates of proatcape1 mutant and PROAtCAPE1ox in proatcape1 transgenic plant seeds compared with the corresponding wild-type (Ler) seeds. Each value represents the percentage of germination (with 40 seeds) for four independent tests. Error bars indicate the means±SEM. (Student’s t -test: ** P ≤0.01, * P ≤0.05). (D) Three-week-old plants were irrigated without (Control) and with 300mM NaCl three times for every second day. After that, plants were recovered with water for another one week. The photograph was taken then. (E) Shoot fresh weight was measured after treatments from (D). Data are shown as an average fresh weight from 36 plants. Error bars indicate means±SD. An asterisk indicates significant differences (* P ≤0.05) between proatcape1 mutant and wild-type Ler plants upon 300mM NaCl treatment.
    Figure Legend Snippet: AtCAPE1 negatively regulates the salt-tolerance response. (A) Growth response of proatcape1 mutants to salt stress and to AtCAPE1. Five-day-old seedlings were treated with various concentrations of NaCl in the absence (–) and presence (+) of various concentrations of synthetic AtCAPE1. The photograph was taken after treatment for another 10 d. (B) Semi-quantitative analysis of the phenotype of plants shown in (A). Each bar represents the mean percentage of the phenotypic pattern from two independent experiments. Error bars indicate means±SD. The phenotypic pattern according to leaf number and colour of seedlings was defined into categories I–IV as shown in the diagram (salt- and peptide- treated proatcape1 versus salt-treated wild-type Ler; Student’s t -test: ** P ≤0.01, * P ≤0.05). (C) Germination rates of proatcape1 mutant and PROAtCAPE1ox in proatcape1 transgenic plant seeds compared with the corresponding wild-type (Ler) seeds. Each value represents the percentage of germination (with 40 seeds) for four independent tests. Error bars indicate the means±SEM. (Student’s t -test: ** P ≤0.01, * P ≤0.05). (D) Three-week-old plants were irrigated without (Control) and with 300mM NaCl three times for every second day. After that, plants were recovered with water for another one week. The photograph was taken then. (E) Shoot fresh weight was measured after treatments from (D). Data are shown as an average fresh weight from 36 plants. Error bars indicate means±SD. An asterisk indicates significant differences (* P ≤0.05) between proatcape1 mutant and wild-type Ler plants upon 300mM NaCl treatment.

    Techniques Used: Mutagenesis, Transgenic Assay

    Number of genes differentially expressed in wild type (Ler) and the proatcape1 mutant under high salt. (A) Numbers indicate the genes with significantly differential expression ( P ≤0.05 and a greater than 1.5-fold change) between the indicated data sets derived from microarray analysis. (B) Number of genes with differential expression levels between wild type and the proatcape1 mutant under normal and salt (12h of treatment in 125mM NaCl) conditions ( P ≤0.05 and a greater than 1.5-fold change).
    Figure Legend Snippet: Number of genes differentially expressed in wild type (Ler) and the proatcape1 mutant under high salt. (A) Numbers indicate the genes with significantly differential expression ( P ≤0.05 and a greater than 1.5-fold change) between the indicated data sets derived from microarray analysis. (B) Number of genes with differential expression levels between wild type and the proatcape1 mutant under normal and salt (12h of treatment in 125mM NaCl) conditions ( P ≤0.05 and a greater than 1.5-fold change).

    Techniques Used: Mutagenesis, Expressing, Derivative Assay, Microarray

    23) Product Images from "An SMC-like protein binds and regulates Caenorhabditis elegans condensins"

    Article Title: An SMC-like protein binds and regulates Caenorhabditis elegans condensins

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1006614

    smcl-1 deletion does not cause condensin loss-of-function phenotypes, but can partially suppress lethality and sterility of a dpy-28 mutant. (A) PCR and Western blot analyses confirming genomic deletion of smcl-1 by a MosDEL strategy (see Methods ). (B-D) smcl-1(0) worms were assayed for phenotypes associated with condensin loss-of-function. (B) Viable progeny count: The number of total viable progeny produced throughout the lifetime of a hermaphrodite was counted from 20 wild-type and 20 smcl-1(0) worms. (C) X nondisjunction: Hermaphrodite and male progeny of unmated wild-type or smcl-1(0) hermaphrodite worms were counted to assay for an increase in spontaneous production of males, which indicates mis-segregation of the X chromosome. ~6,600 progeny were counted from each strain in four trials. (D) Hermaphrodite vs. male ratio: Hermaphrodite and male progeny of 10 mated wild-type or smcl-1(0) hermaphrodite worms were counted to assay for hermaphrodite-specific lethality. (E-F) The effect of deleting smcl-1 in the dpy-28(y1) hypomorphic, temperature-sensitive (ts) strain was assayed. (E) Viable progeny count: The number of total viable progeny produced throughout the lifetime of the worm was counted from 33 hermaphrodite worms of each specified genotype raised at the semi-permissive temperature of 18°C. (F) Brood size: The number of embryos laid throughout the lifetime of the worm was counted from 33 hermaphrodite worms of each genotype raised at the semi-permissive temperature of 18°C. Non-parametric Mann-Whitney test was used for all statistical analyses. *** denotes p ≤ 0.001; ** denotes p ≤ 0.01; * denotes p ≤0.05; ns = not significant. Bars represent 95% confidence intervals.
    Figure Legend Snippet: smcl-1 deletion does not cause condensin loss-of-function phenotypes, but can partially suppress lethality and sterility of a dpy-28 mutant. (A) PCR and Western blot analyses confirming genomic deletion of smcl-1 by a MosDEL strategy (see Methods ). (B-D) smcl-1(0) worms were assayed for phenotypes associated with condensin loss-of-function. (B) Viable progeny count: The number of total viable progeny produced throughout the lifetime of a hermaphrodite was counted from 20 wild-type and 20 smcl-1(0) worms. (C) X nondisjunction: Hermaphrodite and male progeny of unmated wild-type or smcl-1(0) hermaphrodite worms were counted to assay for an increase in spontaneous production of males, which indicates mis-segregation of the X chromosome. ~6,600 progeny were counted from each strain in four trials. (D) Hermaphrodite vs. male ratio: Hermaphrodite and male progeny of 10 mated wild-type or smcl-1(0) hermaphrodite worms were counted to assay for hermaphrodite-specific lethality. (E-F) The effect of deleting smcl-1 in the dpy-28(y1) hypomorphic, temperature-sensitive (ts) strain was assayed. (E) Viable progeny count: The number of total viable progeny produced throughout the lifetime of the worm was counted from 33 hermaphrodite worms of each specified genotype raised at the semi-permissive temperature of 18°C. (F) Brood size: The number of embryos laid throughout the lifetime of the worm was counted from 33 hermaphrodite worms of each genotype raised at the semi-permissive temperature of 18°C. Non-parametric Mann-Whitney test was used for all statistical analyses. *** denotes p ≤ 0.001; ** denotes p ≤ 0.01; * denotes p ≤0.05; ns = not significant. Bars represent 95% confidence intervals.

    Techniques Used: Sterility, Mutagenesis, Polymerase Chain Reaction, Western Blot, Produced, MANN-WHITNEY

    24) Product Images from "Allosteric changes of the NMDA receptor trap diffusible dopamine 1 receptors in spines"

    Article Title: Allosteric changes of the NMDA receptor trap diffusible dopamine 1 receptors in spines

    Journal:

    doi: 10.1073/pnas.0505557103

    Role of D1R C terminus on receptor localization and binding to NR-1. ( a ) Representative confocal images of neurons transfected with WT D1R, ΔA419, or ΔL390, fused to Venus. Truncation of the C terminus and binding sites for NMDA receptor
    Figure Legend Snippet: Role of D1R C terminus on receptor localization and binding to NR-1. ( a ) Representative confocal images of neurons transfected with WT D1R, ΔA419, or ΔL390, fused to Venus. Truncation of the C terminus and binding sites for NMDA receptor

    Techniques Used: Binding Assay, Transfection

    25) Product Images from "Improving the Immunogenicity of the Mycobacterium bovis BCG Vaccine by Non-Genetic Bacterial Surface Decoration Using the Avidin-Biotin System"

    Article Title: Improving the Immunogenicity of the Mycobacterium bovis BCG Vaccine by Non-Genetic Bacterial Surface Decoration Using the Avidin-Biotin System

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0145833

    Construction of a recombination cloning plasmid for the production of avidin fusion proteins. (A) Gene for mAvidin was synthesized with restriction sites NdeI and NotI and subcloned into pDEST17 between the 6x histidine and the gateway cassette to generate p17-Avi plasmid. OVA peptide 323-339 and ESAT6 DNA sequences terminated with att B sites were cloned into pDONR221 via BP Clonase reaction. Thereafter, genes of interest were subcloned into p17-Avi by mean of one step LR Clonase reaction. (B) E . coli BL21 was transformed with p17-Avi encoding ESAT6 and OVA peptide 323-339 . Recombinant Avi-proteins were purified from inclusion bodies and subjected to 12% SDS-PAGE gel and EZ blue staining to analyze the quality of fusion protein preparations. Expected sizes for Avi-ESAT6 and Avi-OVA 757-1037 are 26.8 and 27.3 kDa respectively.
    Figure Legend Snippet: Construction of a recombination cloning plasmid for the production of avidin fusion proteins. (A) Gene for mAvidin was synthesized with restriction sites NdeI and NotI and subcloned into pDEST17 between the 6x histidine and the gateway cassette to generate p17-Avi plasmid. OVA peptide 323-339 and ESAT6 DNA sequences terminated with att B sites were cloned into pDONR221 via BP Clonase reaction. Thereafter, genes of interest were subcloned into p17-Avi by mean of one step LR Clonase reaction. (B) E . coli BL21 was transformed with p17-Avi encoding ESAT6 and OVA peptide 323-339 . Recombinant Avi-proteins were purified from inclusion bodies and subjected to 12% SDS-PAGE gel and EZ blue staining to analyze the quality of fusion protein preparations. Expected sizes for Avi-ESAT6 and Avi-OVA 757-1037 are 26.8 and 27.3 kDa respectively.

    Techniques Used: Clone Assay, Plasmid Preparation, Avidin-Biotin Assay, Synthesized, Transformation Assay, Recombinant, Purification, SDS Page, Staining

    26) Product Images from "Fusobacterium nucleatum Causes Microbial Dysbiosis and Exacerbates Visceral Hypersensitivity in a Colonization-Independent Manner"

    Article Title: Fusobacterium nucleatum Causes Microbial Dysbiosis and Exacerbates Visceral Hypersensitivity in a Colonization-Independent Manner

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2020.01281

    Detection of specific IgA against F. nucleatum in fecal supernatants (FSN) of patients and identification of FomA. The IgA against F. nucleatum was detected by western blotting, and Ponceau S staining was used as loading control (A) . The quantified proportional signals from reactive bands were evaluated at 40 (B) and 130 kDa (C) . The Spearman correlation was calculated between the Self-rating Anxiety Scale (SAS) and the quantified proportional signals from band at 130 (D) and 40 kDa (E) , Self-rating Depression Scale (SDS), and signals from band at 130 (F) and 40 kDa (G) . (H) The specific IgA in the FSN against E. coli BL21 (DE3) with or without expression of FomA gene. ** P
    Figure Legend Snippet: Detection of specific IgA against F. nucleatum in fecal supernatants (FSN) of patients and identification of FomA. The IgA against F. nucleatum was detected by western blotting, and Ponceau S staining was used as loading control (A) . The quantified proportional signals from reactive bands were evaluated at 40 (B) and 130 kDa (C) . The Spearman correlation was calculated between the Self-rating Anxiety Scale (SAS) and the quantified proportional signals from band at 130 (D) and 40 kDa (E) , Self-rating Depression Scale (SDS), and signals from band at 130 (F) and 40 kDa (G) . (H) The specific IgA in the FSN against E. coli BL21 (DE3) with or without expression of FomA gene. ** P

    Techniques Used: Western Blot, Staining, Expressing

    27) Product Images from "Constitutive overexpression of RAM1 increases arbuscule density during arbuscular mycorrhizal symbiosis in Brachypodium distachyon"

    Article Title: Constitutive overexpression of RAM1 increases arbuscule density during arbuscular mycorrhizal symbiosis in Brachypodium distachyon

    Journal: bioRxiv

    doi: 10.1101/2020.06.15.146233

    Expression of hormone biosynthesis genes is altered in the RAM1 overexpressors. A) B. distachyon orthologs of three genes involved in the Strigolactone biosynthesis pathway ( BdD27, BdD17, Bd10 ) are down-regulated in non-colonized roots ectopically overexpressing BdRAM1 ( 35S:BdRAM1 ox line#1, denoted as “ox1”) relative to 35S:NLS-GFP (“GFP”) control roots. B) Two genes with a putative function in Gibberellic acid biosynthesis ( BdGA3ox1, BdGA20ox1 ) are down-regulated in 35S:BdRAM1 ox roots. C) Two B. distachyon genes orthologous to known Brassinosteroid biosynthesis genes ( BdCPD, BdD2/BdCYP91D ) are induced in 35S:BdRAM1 ox roots. A third gene, BdDWF4 , is not affected. Bar graphs show the mean, error bars the standard deviation. Single points represent individual measurements. Pairwise comparisons were estimated using the Student’s t-test. Significance codes: ***p
    Figure Legend Snippet: Expression of hormone biosynthesis genes is altered in the RAM1 overexpressors. A) B. distachyon orthologs of three genes involved in the Strigolactone biosynthesis pathway ( BdD27, BdD17, Bd10 ) are down-regulated in non-colonized roots ectopically overexpressing BdRAM1 ( 35S:BdRAM1 ox line#1, denoted as “ox1”) relative to 35S:NLS-GFP (“GFP”) control roots. B) Two genes with a putative function in Gibberellic acid biosynthesis ( BdGA3ox1, BdGA20ox1 ) are down-regulated in 35S:BdRAM1 ox roots. C) Two B. distachyon genes orthologous to known Brassinosteroid biosynthesis genes ( BdCPD, BdD2/BdCYP91D ) are induced in 35S:BdRAM1 ox roots. A third gene, BdDWF4 , is not affected. Bar graphs show the mean, error bars the standard deviation. Single points represent individual measurements. Pairwise comparisons were estimated using the Student’s t-test. Significance codes: ***p

    Techniques Used: Expressing, Standard Deviation

    Ectopic overexpression of BdRAM1 promotes arbuscule formation and expression of AM marker genes. A) Gene expression levels of B. distachyon orthologs of BdRAM1 target genes in non-colonized 35S:NLS-GFP (denoted as “GFP”) and 35S:BdRAM1 ox line #1 (denoted as “ox1”) roots. 35S:BdRAM1 ox roots display induced expression of BdRAM1 , as well as BdRAM2, BdPT7, BdFatM1 , and BdFatM2 in the absence of symbiosis relative to 35S:NLS-GFP control roots. BdSTR gene expression is not affected in these roots. B) Gene expression of B. distachyon RAD1 and WRI5 orthologs. Only expression of BdWRI5 . 1 is induced in non-colonized roots over-expressing BdRAM1 ( 35S:BdRAM1 ox ) relative to 35S:NLS-GFP control roots. A), B), Bar graphs show the mean, error bars the standard deviation. Single points represent individual measurements. Pairwise comparisons were estimated using the Student’s t-test. Significance codes: ***p
    Figure Legend Snippet: Ectopic overexpression of BdRAM1 promotes arbuscule formation and expression of AM marker genes. A) Gene expression levels of B. distachyon orthologs of BdRAM1 target genes in non-colonized 35S:NLS-GFP (denoted as “GFP”) and 35S:BdRAM1 ox line #1 (denoted as “ox1”) roots. 35S:BdRAM1 ox roots display induced expression of BdRAM1 , as well as BdRAM2, BdPT7, BdFatM1 , and BdFatM2 in the absence of symbiosis relative to 35S:NLS-GFP control roots. BdSTR gene expression is not affected in these roots. B) Gene expression of B. distachyon RAD1 and WRI5 orthologs. Only expression of BdWRI5 . 1 is induced in non-colonized roots over-expressing BdRAM1 ( 35S:BdRAM1 ox ) relative to 35S:NLS-GFP control roots. A), B), Bar graphs show the mean, error bars the standard deviation. Single points represent individual measurements. Pairwise comparisons were estimated using the Student’s t-test. Significance codes: ***p

    Techniques Used: Over Expression, Expressing, Marker, Standard Deviation

    RAM1 overexpressors show altered shoot development and constitutively express root AM marker genes in their shoots. A) Photograph of 4.5 week-old B. distachyon plants transformed with 35S:NLS-GFP or 35S:BdRAM1 . The three independent transformant lines overexpressing BdRAM1 (“ox1”, “ox2”, “ox3”) display a bushy stature, whereas the 35S:BdRAM1 -transformant line not overexpressing BdRAM1 (“WT”) resembles the 35S:NLS-GFP control plant. B) Gene expression of BdRAM1 and of several root AM marker genes and BdWRI5 . 1 is strongly induced in in 4.5-week shoots of three 35S:BdRAM1 ox lines (“ox1”, “ox2”, “ox3”) relative to control plants transformed with 35S:NLS-GFP (“GFP”) or the 35S:BdRAM1 -transformant line not overexpressing BdRAM1 (“WT”). Bar graphs show the mean, error bars the standard deviation. Single points represent individual measurements. Significance values (ANOVA) for each gene are indicated in the figure. Pairwise comparisons were conducted using Tukey’s HSD post-hoc test; different letters denote significant differences.
    Figure Legend Snippet: RAM1 overexpressors show altered shoot development and constitutively express root AM marker genes in their shoots. A) Photograph of 4.5 week-old B. distachyon plants transformed with 35S:NLS-GFP or 35S:BdRAM1 . The three independent transformant lines overexpressing BdRAM1 (“ox1”, “ox2”, “ox3”) display a bushy stature, whereas the 35S:BdRAM1 -transformant line not overexpressing BdRAM1 (“WT”) resembles the 35S:NLS-GFP control plant. B) Gene expression of BdRAM1 and of several root AM marker genes and BdWRI5 . 1 is strongly induced in in 4.5-week shoots of three 35S:BdRAM1 ox lines (“ox1”, “ox2”, “ox3”) relative to control plants transformed with 35S:NLS-GFP (“GFP”) or the 35S:BdRAM1 -transformant line not overexpressing BdRAM1 (“WT”). Bar graphs show the mean, error bars the standard deviation. Single points represent individual measurements. Significance values (ANOVA) for each gene are indicated in the figure. Pairwise comparisons were conducted using Tukey’s HSD post-hoc test; different letters denote significant differences.

    Techniques Used: Marker, Transformation Assay, Expressing, Standard Deviation

    28) Product Images from "miR-24 Inhibition Increases Menin Expression and Decreases Cholangiocarcinoma Proliferation"

    Article Title: miR-24 Inhibition Increases Menin Expression and Decreases Cholangiocarcinoma Proliferation

    Journal: The American Journal of Pathology

    doi: 10.1016/j.ajpath.2016.10.021

    Increased menin expression decreases proliferation. Mz-ChA-1 cells overexpressing menin with pCMV6-MEN1 vector exhibit a decrease in Ki-67 proliferative marker expression. A – C: Increased menin expression in pCMV6-MEN1 Mz-ChA-1 cells by real-time PCR ( A ) and flow cytometry ( B ) decreased Ki-67 proliferative marker expression by real-time PCR ( C ). D: Decreased cell migration as measured by wound healing assay. E: Decreased cell invasion as measured by Boyden chamber assay in pCMV6-MEN1 Mz-ChA-1 cells. Data are expressed as means ± SEM performed in triplicate ( A–E ). ∗ P
    Figure Legend Snippet: Increased menin expression decreases proliferation. Mz-ChA-1 cells overexpressing menin with pCMV6-MEN1 vector exhibit a decrease in Ki-67 proliferative marker expression. A – C: Increased menin expression in pCMV6-MEN1 Mz-ChA-1 cells by real-time PCR ( A ) and flow cytometry ( B ) decreased Ki-67 proliferative marker expression by real-time PCR ( C ). D: Decreased cell migration as measured by wound healing assay. E: Decreased cell invasion as measured by Boyden chamber assay in pCMV6-MEN1 Mz-ChA-1 cells. Data are expressed as means ± SEM performed in triplicate ( A–E ). ∗ P

    Techniques Used: Expressing, Plasmid Preparation, Marker, Real-time Polymerase Chain Reaction, Flow Cytometry, Migration, Wound Healing Assay, Boyden Chamber Assay

    Menin expression negatively regulates angiogenesis. A: By real-time PCR, Mz-ChA-1 MEN1 knockout cells increased expression of angiogenic factors compared to Mz-ChA-1 control cells. B: By real-time PCR, pCMV6-MEN1 Mz-ChA-1 cells decreased expression of angiogenic factors compared to Mz-ChA-1 control cells. Data are expressed as means ± SEM performed in triplicate ( A and B ). ∗ P
    Figure Legend Snippet: Menin expression negatively regulates angiogenesis. A: By real-time PCR, Mz-ChA-1 MEN1 knockout cells increased expression of angiogenic factors compared to Mz-ChA-1 control cells. B: By real-time PCR, pCMV6-MEN1 Mz-ChA-1 cells decreased expression of angiogenic factors compared to Mz-ChA-1 control cells. Data are expressed as means ± SEM performed in triplicate ( A and B ). ∗ P

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Knock-Out

    29) Product Images from "Characterization and Expression Profiling of Camellia sinensis Cinnamate 4-hydroxylase Genes in Phenylpropanoid Pathways"

    Article Title: Characterization and Expression Profiling of Camellia sinensis Cinnamate 4-hydroxylase Genes in Phenylpropanoid Pathways

    Journal: Genes

    doi: 10.3390/genes8080193

    Heterologous expression in yeast and enzymatic activity analysis of Cs C4H proteins. ( A ) The expression vector of pYES-DEST52- Cs C4Hs; and ( B ) The hydroxylation of t -cinnamate to p -coumarate was catalyzed by Cs C4H. ( C ) The left panel shows the HPLC results of standard t -cinnamate and p -coumarate and the reaction products of WAT11 (pYES-DEST52- Cs C4Hs) using t -cinnamate as the substrate; the right panel shows the HPLC results of the control empty vector and WAT11 (pYES-DEST52- Cs C4Hs) without t -cinnamate as the substrate. Detection was performed at 309 nm.
    Figure Legend Snippet: Heterologous expression in yeast and enzymatic activity analysis of Cs C4H proteins. ( A ) The expression vector of pYES-DEST52- Cs C4Hs; and ( B ) The hydroxylation of t -cinnamate to p -coumarate was catalyzed by Cs C4H. ( C ) The left panel shows the HPLC results of standard t -cinnamate and p -coumarate and the reaction products of WAT11 (pYES-DEST52- Cs C4Hs) using t -cinnamate as the substrate; the right panel shows the HPLC results of the control empty vector and WAT11 (pYES-DEST52- Cs C4Hs) without t -cinnamate as the substrate. Detection was performed at 309 nm.

    Techniques Used: Expressing, Activity Assay, Plasmid Preparation, High Performance Liquid Chromatography

    30) Product Images from "SIPP, a Novel Mitochondrial Phosphate Carrier, Mediates in Self-Incompatibility 1SIPP, a Novel Mitochondrial Phosphate Carrier, Mediates in Self-Incompatibility 1 [OPEN]"

    Article Title: SIPP, a Novel Mitochondrial Phosphate Carrier, Mediates in Self-Incompatibility 1SIPP, a Novel Mitochondrial Phosphate Carrier, Mediates in Self-Incompatibility 1 [OPEN]

    Journal: Plant Physiology

    doi: 10.1104/pp.16.01884

    NaSIPP is a phosphate transporter and partially complements the absence of Mir1 in S. cerevisiae . A, Growth curve of the yeast mutant Δmir1 , the wild-type (WT) strain, and the Δmir1 yeast transformed with the plasmid pYES-DEST52 (empty vector) and with construct Pic2 :: pYES-DEST52 , NaSIPP :: pYES-DEST52 , and Mir1 :: pYES-DEST52 . Yeast were grown on liquid glycerol medium at 30°C. B, Yeast were grown on solid glycerol medium at 30°C for 10 d. C, Yeast replica plated on solid Glc medium were incubated for 3 d at 30°C.
    Figure Legend Snippet: NaSIPP is a phosphate transporter and partially complements the absence of Mir1 in S. cerevisiae . A, Growth curve of the yeast mutant Δmir1 , the wild-type (WT) strain, and the Δmir1 yeast transformed with the plasmid pYES-DEST52 (empty vector) and with construct Pic2 :: pYES-DEST52 , NaSIPP :: pYES-DEST52 , and Mir1 :: pYES-DEST52 . Yeast were grown on liquid glycerol medium at 30°C. B, Yeast were grown on solid glycerol medium at 30°C for 10 d. C, Yeast replica plated on solid Glc medium were incubated for 3 d at 30°C.

    Techniques Used: Mutagenesis, Transformation Assay, Plasmid Preparation, Construct, Gas Chromatography, Incubation

    31) Product Images from "Increased MiR-221 expression in hepatocellular carcinoma tissues and its role in enhancing cell growth and inhibiting apoptosis in vitro"

    Article Title: Increased MiR-221 expression in hepatocellular carcinoma tissues and its role in enhancing cell growth and inhibiting apoptosis in vitro

    Journal: BMC Cancer

    doi: 10.1186/1471-2407-13-21

    Effect of miR-221 on cell viability of HCC cells by CellTiter-Blue Cell Viability Assay. HCC cells were incubated in the presence of miR-221 inhibitor, mimic and different controls for 0, 24, 48, 72 and 96 hrs, and the cell viability was measured using the CellTiter-Blue Cell Viability Assay. * P
    Figure Legend Snippet: Effect of miR-221 on cell viability of HCC cells by CellTiter-Blue Cell Viability Assay. HCC cells were incubated in the presence of miR-221 inhibitor, mimic and different controls for 0, 24, 48, 72 and 96 hrs, and the cell viability was measured using the CellTiter-Blue Cell Viability Assay. * P

    Techniques Used: Viability Assay, Incubation

    Effect of miR-221 on cell growth of HCC cells by Hoechst 33342/propidium iodide (PI) double fluorescent chromatin staining. HCC cells were treated the same as in Figure 5 and the cell growth was monitored with Hoechst 33342/PI double fluorescent chromatin staining. * P
    Figure Legend Snippet: Effect of miR-221 on cell growth of HCC cells by Hoechst 33342/propidium iodide (PI) double fluorescent chromatin staining. HCC cells were treated the same as in Figure 5 and the cell growth was monitored with Hoechst 33342/PI double fluorescent chromatin staining. * P

    Techniques Used: Staining

    Effect of miR-221 on caspase-3/7 activity of HCC cells. HCC cells were treated the same as described in Figure 5 and the caspase-3/7 activity was detected using Apo-ONE Homogeneous Caspase-3/7 Assay. * P
    Figure Legend Snippet: Effect of miR-221 on caspase-3/7 activity of HCC cells. HCC cells were treated the same as described in Figure 5 and the caspase-3/7 activity was detected using Apo-ONE Homogeneous Caspase-3/7 Assay. * P

    Techniques Used: Activity Assay

    Effect of miR-221 on cell growth and apoptosis of HCC HepB3 cells by Hoechst 33342/propidium iodide (PI) double fluorescent chromatin staining. HCC HepB3 cells were transfected with miR-221 inhibitor, mimic and different controls for 96 hrs and the cells were observed under microscope with Hoechst 33342/PI double fluorescent chromatin staining, × 200.
    Figure Legend Snippet: Effect of miR-221 on cell growth and apoptosis of HCC HepB3 cells by Hoechst 33342/propidium iodide (PI) double fluorescent chromatin staining. HCC HepB3 cells were transfected with miR-221 inhibitor, mimic and different controls for 96 hrs and the cells were observed under microscope with Hoechst 33342/PI double fluorescent chromatin staining, × 200.

    Techniques Used: Staining, Transfection, Microscopy

    Effect of miR-221 on cell cycle of HCC HepB3 cells. HCC HepB3 cells were transfected with miR-221 mimic and negative mimic control for 96 hrs and the cell cycle was performed with flow cytometry.
    Figure Legend Snippet: Effect of miR-221 on cell cycle of HCC HepB3 cells. HCC HepB3 cells were transfected with miR-221 mimic and negative mimic control for 96 hrs and the cell cycle was performed with flow cytometry.

    Techniques Used: Transfection, Flow Cytometry

    Effect of miR-221 on apoptosis of HCC HepB3 cells by flow cytometry. HCC HepB3 cells were treated with miR-221 inhibitor, mimic and different controls for 96 hrs and the apoptosis was accessed with 7-Amino-actinomycin D (7-AAD) / APC Annexin V staining by flow cytometry.
    Figure Legend Snippet: Effect of miR-221 on apoptosis of HCC HepB3 cells by flow cytometry. HCC HepB3 cells were treated with miR-221 inhibitor, mimic and different controls for 96 hrs and the apoptosis was accessed with 7-Amino-actinomycin D (7-AAD) / APC Annexin V staining by flow cytometry.

    Techniques Used: Flow Cytometry, Staining

    Relationship of miR-221 relative expression and HCC clinicopathological features. MiR-221 levels accessed by real time RT-qPCR in HCCs and their adjacent noncancerous liver tissues. N: noncancerous liver tissues. I II: clinical TNM stage I and II, III IV: stage III and IV. ** P
    Figure Legend Snippet: Relationship of miR-221 relative expression and HCC clinicopathological features. MiR-221 levels accessed by real time RT-qPCR in HCCs and their adjacent noncancerous liver tissues. N: noncancerous liver tissues. I II: clinical TNM stage I and II, III IV: stage III and IV. ** P

    Techniques Used: Expressing, Quantitative RT-PCR

    Relationship between recurrence and expression of miR-221. Forty-eight cases were followed up and the patients with high expression of miR-221 had a shorter time-to-recurrence compared to those with low expression.
    Figure Legend Snippet: Relationship between recurrence and expression of miR-221. Forty-eight cases were followed up and the patients with high expression of miR-221 had a shorter time-to-recurrence compared to those with low expression.

    Techniques Used: Expressing

    Expression of CDKN1B/p27 and CDKN1C/p57 proteins after miR-221 mimic transfection. HCC Hep3B cells were transfected with miR-221 mimic and negative control for 96 hrs, and the protein levels of CDKN1B/p27 and CDKN1C/p57 were performed using western blot.
    Figure Legend Snippet: Expression of CDKN1B/p27 and CDKN1C/p57 proteins after miR-221 mimic transfection. HCC Hep3B cells were transfected with miR-221 mimic and negative control for 96 hrs, and the protein levels of CDKN1B/p27 and CDKN1C/p57 were performed using western blot.

    Techniques Used: Expressing, Transfection, Negative Control, Western Blot

    Effect of miR-221 on cell proliferation of HCC cells by CellTiter96 AQueous One Solution Cell Proliferation Assay. HCC cells were treated the same as described in Figure 5 and the cell proliferation was measured using the MTS assay (CellTiter96 AQueous One Solution Cell Proliferation Assay). * P
    Figure Legend Snippet: Effect of miR-221 on cell proliferation of HCC cells by CellTiter96 AQueous One Solution Cell Proliferation Assay. HCC cells were treated the same as described in Figure 5 and the cell proliferation was measured using the MTS assay (CellTiter96 AQueous One Solution Cell Proliferation Assay). * P

    Techniques Used: Proliferation Assay, MTS Assay

    MiR - 221 relative expression in HCC FFPE samples. MiR-221 levels accessed by real time RT-qPCR in HCCs and their adjacent noncancerous liver tissues. N: noncancerous liver tissues. ** P
    Figure Legend Snippet: MiR - 221 relative expression in HCC FFPE samples. MiR-221 levels accessed by real time RT-qPCR in HCCs and their adjacent noncancerous liver tissues. N: noncancerous liver tissues. ** P

    Techniques Used: Expressing, Formalin-fixed Paraffin-Embedded, Quantitative RT-PCR

    Effect of miR-221 on apoptosis of HCC cells by Hoechst 33342/propidium iodide (PI) double fluorescent chromatin staining. HCC cells were treated the same as above in Figure 5 and the apoptosis was monitored with Hoechst 33342/PI double fluorescent chromatin staining. * P
    Figure Legend Snippet: Effect of miR-221 on apoptosis of HCC cells by Hoechst 33342/propidium iodide (PI) double fluorescent chromatin staining. HCC cells were treated the same as above in Figure 5 and the apoptosis was monitored with Hoechst 33342/PI double fluorescent chromatin staining. * P

    Techniques Used: Staining

    32) Product Images from "Liesegang-like patterns of Toll crystals grown in gel"

    Article Title: Liesegang-like patterns of Toll crystals grown in gel

    Journal: Journal of Applied Crystallography

    doi: 10.1107/S0021889812051606

    Baculovirus expression construct. Drosophila melanogaster Toll receptor is a 1097-residue-long transmembrane protein with an ectodomain of leucine-rich repeats (28–801 residues), a helical transmembrane region (TM, residues 808–828) and an intracellular domain with a Toll-interleukin-1 receptor signalling domain (TIR domain, residues 857–996). The N-terminal region of the Toll ectodomain Met1–Leu228 is expressed as a chimera with the VLR C-terminal capping structure Asn133–Thr201, a TEV protease cleavage site and the constant fragment of human immunoglobulin G1 for purification (Gangloff et al. , 2013 ▶ ). The 24 residue-long consensus LRR sequence is given with X standing for any amino acid, L for Leu and N for Asn. The sequences of Toll and VLR are fused in the middle of the conserved leucine-rich repeat motif of LRR6 at Leu228.
    Figure Legend Snippet: Baculovirus expression construct. Drosophila melanogaster Toll receptor is a 1097-residue-long transmembrane protein with an ectodomain of leucine-rich repeats (28–801 residues), a helical transmembrane region (TM, residues 808–828) and an intracellular domain with a Toll-interleukin-1 receptor signalling domain (TIR domain, residues 857–996). The N-terminal region of the Toll ectodomain Met1–Leu228 is expressed as a chimera with the VLR C-terminal capping structure Asn133–Thr201, a TEV protease cleavage site and the constant fragment of human immunoglobulin G1 for purification (Gangloff et al. , 2013 ▶ ). The 24 residue-long consensus LRR sequence is given with X standing for any amino acid, L for Leu and N for Asn. The sequences of Toll and VLR are fused in the middle of the conserved leucine-rich repeat motif of LRR6 at Leu228.

    Techniques Used: Expressing, Construct, Purification, Sequencing

    33) Product Images from "Loading of the human 9-1-1 checkpoint complex onto DNA by the checkpoint clamp loader hRad17-replication factor C complex in vitro"

    Article Title: Loading of the human 9-1-1 checkpoint complex onto DNA by the checkpoint clamp loader hRad17-replication factor C complex in vitro

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.0437927100

    Rad9 mediates the Rad17-RFC/9-1-1 interaction. ( A ) Rad17 interacts with Rad9. H5 cells were coinfected with baculoviruses expressing either His-Rad17 alone (lane 1) or His-Rad17 together with Flag-Rad1 (lane 2), Flag-Rad9 (lane 3), Flag-Hus1 (lane 4), or Flag-Hus1, and untagged Rad1 and Rad9 (lane 5). The proteins were immunoaffinity purified with anti-Flag agarose, and proteins were analyzed by Western blotting with anti-Rad17 or anti-Flag antibodies. ( B ) Binding of the PCNA-like domain of Rad9 to Rad17. The following fragments of Rad9 were produced in H5 cells and bound to anti-Flag agarose resin: amino acids 1–130, lane A; amino acids 130–270, lane B; amino acids 1–270, lane C; amino acids 260–391, lane D; amino acids 130–391, lane E; and full length, lane F. The resin was then incubated with extracts made from H5 cells infected with either His-Rad17 or His-p140. After washing the resin, bound protein was eluted with Flag peptide and analyzed by Western blotting with anti-His and anti-Flag antibodies.
    Figure Legend Snippet: Rad9 mediates the Rad17-RFC/9-1-1 interaction. ( A ) Rad17 interacts with Rad9. H5 cells were coinfected with baculoviruses expressing either His-Rad17 alone (lane 1) or His-Rad17 together with Flag-Rad1 (lane 2), Flag-Rad9 (lane 3), Flag-Hus1 (lane 4), or Flag-Hus1, and untagged Rad1 and Rad9 (lane 5). The proteins were immunoaffinity purified with anti-Flag agarose, and proteins were analyzed by Western blotting with anti-Rad17 or anti-Flag antibodies. ( B ) Binding of the PCNA-like domain of Rad9 to Rad17. The following fragments of Rad9 were produced in H5 cells and bound to anti-Flag agarose resin: amino acids 1–130, lane A; amino acids 130–270, lane B; amino acids 1–270, lane C; amino acids 260–391, lane D; amino acids 130–391, lane E; and full length, lane F. The resin was then incubated with extracts made from H5 cells infected with either His-Rad17 or His-p140. After washing the resin, bound protein was eluted with Flag peptide and analyzed by Western blotting with anti-His and anti-Flag antibodies.

    Techniques Used: Expressing, Purification, Western Blot, Binding Assay, Produced, Incubation, Infection

    Purification of Rad17-RFC/9-1-1 checkpoint supercomplex. The checkpoint complexes were reconstituted in H5 cells by coinfection with: lane 1 (9-1-1 complex), three baculoviruses expressing Flag-Rad9, Hus1, and Rad1; lane 2 (Rad17-RFC), five baculoviruses expressing Flag-Rad17, p40, His-p38, p37, and p36; and lane 3 (supercomplex), eight baculoviruses expressing His-Rad17, p40, His-p38, p37, p36, Rad9, Flag-Hus1, and Rad1. Complexes were purified by chromatography with Ni-NTA and/or anti-Flag agarose as described in Materials and Methods , and proteins were visualized after SDS/PAGE by silver staining.
    Figure Legend Snippet: Purification of Rad17-RFC/9-1-1 checkpoint supercomplex. The checkpoint complexes were reconstituted in H5 cells by coinfection with: lane 1 (9-1-1 complex), three baculoviruses expressing Flag-Rad9, Hus1, and Rad1; lane 2 (Rad17-RFC), five baculoviruses expressing Flag-Rad17, p40, His-p38, p37, and p36; and lane 3 (supercomplex), eight baculoviruses expressing His-Rad17, p40, His-p38, p37, p36, Rad9, Flag-Hus1, and Rad1. Complexes were purified by chromatography with Ni-NTA and/or anti-Flag agarose as described in Materials and Methods , and proteins were visualized after SDS/PAGE by silver staining.

    Techniques Used: Purification, Expressing, Chromatography, SDS Page, Silver Staining

    34) Product Images from "Cloning and Biochemical Characterization of TAF-172, a Human Homolog of Yeast Mot1"

    Article Title: Cloning and Biochemical Characterization of TAF-172, a Human Homolog of Yeast Mot1

    Journal: Molecular and Cellular Biology

    doi:

    Purification of recombinant TAF-172. (A) Sf9 insect cells were infected with recombinant baculovirus containing the TAF-172 gene and six in-frame histidine codons at the amino terminus. Equal proportions of pooled fractions generated at each stage of the purification process were analyzed on an SDS–6% polyacrylamide gel in which the proteins were stained with silver. Molecular weight markers (M) are shown in lane 1. The crude cell lysate (CE; lane 2), the Ni 2+ ) (1.2 μg, lane 4) were electrophoresed on an SDS–6% polyacrylamide gel. Proteins were electroblotted to nitrocellulose and probed with affinity-purified TAF-172 antibodies.
    Figure Legend Snippet: Purification of recombinant TAF-172. (A) Sf9 insect cells were infected with recombinant baculovirus containing the TAF-172 gene and six in-frame histidine codons at the amino terminus. Equal proportions of pooled fractions generated at each stage of the purification process were analyzed on an SDS–6% polyacrylamide gel in which the proteins were stained with silver. Molecular weight markers (M) are shown in lane 1. The crude cell lysate (CE; lane 2), the Ni 2+ ) (1.2 μg, lane 4) were electrophoresed on an SDS–6% polyacrylamide gel. Proteins were electroblotted to nitrocellulose and probed with affinity-purified TAF-172 antibodies.

    Techniques Used: Purification, Recombinant, Infection, Generated, Staining, Molecular Weight, Affinity Purification

    35) Product Images from "HRS–WASH axis governs actin-mediated endosomal recycling and cell invasion"

    Article Title: HRS–WASH axis governs actin-mediated endosomal recycling and cell invasion

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.201710051

    HRS is required for the endosomal recruitment of WASH. (A) HeLa cells were treated with the indicated siRNA over 120 h before fixation in 4% PFA/PBS and labeling with antibodies targeting HRS and WASH. Maximum-projection images. (B) Airyscan single confocal slice images of HeLa cells fixed and labeled for WASH and HRS. (C and D) PLA of HeLa cells probed for both HRS and WASH or technical single WASH or HRS antibody controls. Data represented as mean number of signals per cell. Maximum-projection images (nuclei stained with DAPI). Bars, 20 µm. (E and F) HeLa S3 Flp-In cells stably transfected with GFP-HRS (mouse) were treated with siRNA targeting endogenous HRS over 120 h before fixation in 4% PFA/PBS or lysis in NP-40 buffer. Single confocal slice images. Molecular masses are given in kilodaltons. IB, immunoblot. (G) Quantification of Pearson’s R correlation between EEA1 and WASH ( > 150 cells total). (H and I) HeLa cells were treated with siRNA over 120 h before fixation in 4% PFA/PBS and labeling with antibodies targeting EEA1 and 647-phalloidin. Quantification of sum intensity of actin on endosome. Maximum-projection images ( > 30 cells total). n = 3; error bars indicate SEM. **, P
    Figure Legend Snippet: HRS is required for the endosomal recruitment of WASH. (A) HeLa cells were treated with the indicated siRNA over 120 h before fixation in 4% PFA/PBS and labeling with antibodies targeting HRS and WASH. Maximum-projection images. (B) Airyscan single confocal slice images of HeLa cells fixed and labeled for WASH and HRS. (C and D) PLA of HeLa cells probed for both HRS and WASH or technical single WASH or HRS antibody controls. Data represented as mean number of signals per cell. Maximum-projection images (nuclei stained with DAPI). Bars, 20 µm. (E and F) HeLa S3 Flp-In cells stably transfected with GFP-HRS (mouse) were treated with siRNA targeting endogenous HRS over 120 h before fixation in 4% PFA/PBS or lysis in NP-40 buffer. Single confocal slice images. Molecular masses are given in kilodaltons. IB, immunoblot. (G) Quantification of Pearson’s R correlation between EEA1 and WASH ( > 150 cells total). (H and I) HeLa cells were treated with siRNA over 120 h before fixation in 4% PFA/PBS and labeling with antibodies targeting EEA1 and 647-phalloidin. Quantification of sum intensity of actin on endosome. Maximum-projection images ( > 30 cells total). n = 3; error bars indicate SEM. **, P

    Techniques Used: Labeling, Proximity Ligation Assay, Staining, Stable Transfection, Transfection, Lysis

    36) Product Images from "Directed Engineering of a High-expression Chimeric Transgene as a Strategy for Gene Therapy of Hemophilia A"

    Article Title: Directed Engineering of a High-expression Chimeric Transgene as a Strategy for Gene Therapy of Hemophilia A

    Journal: Molecular Therapy: the Journal of the American Society of Gene Therapy

    doi: 10.1038/mt.2009.35

    Heterologous expression of fVIII transgenes. ( a ) Schematic of fVIII subunits. Full-length human with activation peptide indicated (top), B-domain deleted (BDD) human with the SQ-linker indicated (middle-top), BDD-porcine (middle-bottom), and HP-fVIII (bottom). Dark gray denotes porcine-specific sequences. ( b ) Human (BDDhfVIII), porcine (BDDpfVIII), and HP-fVIII transgenes were transfected into both BHK-M and Flp-In 293 cells. BHK-M cells were modified using Lipofectamine 2000 and ReNeo plasmid constructs. Flp-In 293 cells were modified by FLP recombinase-mediated site-specific recombination then screened by Southern blot in order to compare only those clones containing a correctly integrated single transgene. FVIII activity was measured from 19 to 33 BHK-M clones (black circles) and 13–22 singly integrated Flp-In clones (white circles) by one-stage coagulation assay. Mean HP-fVIII activity is depicted by a horizontal dotted line.
    Figure Legend Snippet: Heterologous expression of fVIII transgenes. ( a ) Schematic of fVIII subunits. Full-length human with activation peptide indicated (top), B-domain deleted (BDD) human with the SQ-linker indicated (middle-top), BDD-porcine (middle-bottom), and HP-fVIII (bottom). Dark gray denotes porcine-specific sequences. ( b ) Human (BDDhfVIII), porcine (BDDpfVIII), and HP-fVIII transgenes were transfected into both BHK-M and Flp-In 293 cells. BHK-M cells were modified using Lipofectamine 2000 and ReNeo plasmid constructs. Flp-In 293 cells were modified by FLP recombinase-mediated site-specific recombination then screened by Southern blot in order to compare only those clones containing a correctly integrated single transgene. FVIII activity was measured from 19 to 33 BHK-M clones (black circles) and 13–22 singly integrated Flp-In clones (white circles) by one-stage coagulation assay. Mean HP-fVIII activity is depicted by a horizontal dotted line.

    Techniques Used: Expressing, Activation Assay, Transfection, Modification, Plasmid Preparation, Construct, Southern Blot, Clone Assay, Activity Assay, Coagulation

    37) Product Images from "Differential HDAC1/2 network analysis reveals a role for prefoldin/CCT in HDAC1/2 complex assembly"

    Article Title: Differential HDAC1/2 network analysis reveals a role for prefoldin/CCT in HDAC1/2 complex assembly

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-32009-w

    HDAC1 associates with components of the prefoldin-mediated CCT folding pathway. ( A ) The established mechanism for prefoldin delivery of client proteins to the CCT complex 37 , 44 , 65 used to model possible HDAC1 processing by the prefoldin/CCT pathway in the nucleus. ( B ) Prefoldin subunit VBP1 interacts with HDAC1. HEK293T cell lysates expressing tagged VBP1 with or without Halo-tagged versions of HDAC1 were used for Halo affinity purification. Samples were analysed by SDS PAGE followed by Western blotting or Coomassie staining. SNAP-FLAG-VBP1 was detected using anti-FLAG mouse monoclonal primary antibody and IRDye® 680LT labeled goat anti-Mouse secondary antibody. Halo-tagged HDAC1 was detected using anti-HDAC1 rabbit polyclonal primary antibody and IRDye® 800CW labeled goat anti-Rabbit secondary antibody. Full length images are presented in Supplementary Figure 3 . ( C ) VBP1 colocalises with HDAC1 in the nucleus. Flp-In™-293 host cells stably expressing Halo-HDAC1 were transiently transfected with SNAP-FLAG-VBP1 and proteins imaged using HaloTag® TMRDirect™ ligand (Halo-HDAC1; red), SNAP-Cell® 505-Star ligand (SNAP-FLAG-VBP1; green), and Hoechst dye (nuclei; blue). ( D ) TCP1 and other CCT complex components interact with HDAC1. The STRING 38 network showing established TCP1 (CCT complex) interacting proteins was generated using the following settings: minimum required interaction score - medium confidence (0.4); maximum number of interactors - 50; active interaction source – Experiments; clustering method – kmeans (default settings). Clusters are indicated by node color.
    Figure Legend Snippet: HDAC1 associates with components of the prefoldin-mediated CCT folding pathway. ( A ) The established mechanism for prefoldin delivery of client proteins to the CCT complex 37 , 44 , 65 used to model possible HDAC1 processing by the prefoldin/CCT pathway in the nucleus. ( B ) Prefoldin subunit VBP1 interacts with HDAC1. HEK293T cell lysates expressing tagged VBP1 with or without Halo-tagged versions of HDAC1 were used for Halo affinity purification. Samples were analysed by SDS PAGE followed by Western blotting or Coomassie staining. SNAP-FLAG-VBP1 was detected using anti-FLAG mouse monoclonal primary antibody and IRDye® 680LT labeled goat anti-Mouse secondary antibody. Halo-tagged HDAC1 was detected using anti-HDAC1 rabbit polyclonal primary antibody and IRDye® 800CW labeled goat anti-Rabbit secondary antibody. Full length images are presented in Supplementary Figure 3 . ( C ) VBP1 colocalises with HDAC1 in the nucleus. Flp-In™-293 host cells stably expressing Halo-HDAC1 were transiently transfected with SNAP-FLAG-VBP1 and proteins imaged using HaloTag® TMRDirect™ ligand (Halo-HDAC1; red), SNAP-Cell® 505-Star ligand (SNAP-FLAG-VBP1; green), and Hoechst dye (nuclei; blue). ( D ) TCP1 and other CCT complex components interact with HDAC1. The STRING 38 network showing established TCP1 (CCT complex) interacting proteins was generated using the following settings: minimum required interaction score - medium confidence (0.4); maximum number of interactors - 50; active interaction source – Experiments; clustering method – kmeans (default settings). Clusters are indicated by node color.

    Techniques Used: Expressing, Affinity Purification, SDS Page, Western Blot, Staining, Labeling, Stable Transfection, Transfection, Generated

    38) Product Images from "Identification of T-cell epitopes in Francisella tularensis using an ordered protein array of serological targets"

    Article Title: Identification of T-cell epitopes in Francisella tularensis using an ordered protein array of serological targets

    Journal: Immunology

    doi: 10.1111/j.1365-2567.2010.03387.x

    Validation of the proteins in the Serological Target Subset (STS) array. (a) Schematic of a pBAD-DEST49 fusion protein. (b) Forty-five Francisella tularensis SchuS4 genes of interest were selected for the STS array. The grid represents the location within
    Figure Legend Snippet: Validation of the proteins in the Serological Target Subset (STS) array. (a) Schematic of a pBAD-DEST49 fusion protein. (b) Forty-five Francisella tularensis SchuS4 genes of interest were selected for the STS array. The grid represents the location within

    Techniques Used:

    39) Product Images from "The structure and catalytic mechanism of a poly(ADP-ribose) glycohydrolase"

    Article Title: The structure and catalytic mechanism of a poly(ADP-ribose) glycohydrolase

    Journal: Nature

    doi: 10.1038/nature10404

    Poly(ADP-ribose) hydrolytic activities of divergent and canonical PARGs a , A colorimetric PARG assay. b , Analysis of the hydrolysis of the PARP1-generated PAR substrate by anti-PAR antibodies ‘AF’ stands for A. fumigatus ; ‘DR’ D. radiodurans ; ‘HA’ H. aurantiacus ; ‘TC’ T. curvata ; ‘AV’ A. variabilis ; ‘HS’ H. sapiens ; ‘ED’ E. dispar . c , SDS-PAGE-based assay with [ 32 P]-automodified PARP1 substrate. PARGs are inhibited by ADP-HPD. d , TLC analysis of PARG activity on the [ 32 P]-PAR substrate. The right side of the TLC plate was visualised by shadowing under UV. e , Heterologously expressed A. fumigatus and D. radiodurans PARG hydrolyse PAR in hPARP1-expressing budding yeast cells.
    Figure Legend Snippet: Poly(ADP-ribose) hydrolytic activities of divergent and canonical PARGs a , A colorimetric PARG assay. b , Analysis of the hydrolysis of the PARP1-generated PAR substrate by anti-PAR antibodies ‘AF’ stands for A. fumigatus ; ‘DR’ D. radiodurans ; ‘HA’ H. aurantiacus ; ‘TC’ T. curvata ; ‘AV’ A. variabilis ; ‘HS’ H. sapiens ; ‘ED’ E. dispar . c , SDS-PAGE-based assay with [ 32 P]-automodified PARP1 substrate. PARGs are inhibited by ADP-HPD. d , TLC analysis of PARG activity on the [ 32 P]-PAR substrate. The right side of the TLC plate was visualised by shadowing under UV. e , Heterologously expressed A. fumigatus and D. radiodurans PARG hydrolyse PAR in hPARP1-expressing budding yeast cells.

    Techniques Used: PARG Assay, Generated, SDS Page, Thin Layer Chromatography, Activity Assay, Expressing

    Phylogeny and functional relationship between DUF2263 and canonical-type PARGs a , Multiple sequence alignment of different DUF2263 and PARG proteins from Thermomonospora curvata (Tcu), Herpetosiphon aurantiacus (Hau), Deinococcus radiodurans (Dra), Aspergillus fumigatus (Afu), Homo sapiens (Hsa), Bos taurus (Bta) and Entamoeba dispar (Edi). The two catalytic glutamates, a conserved glycine and tyrosine are marked with black asterisks, grey asterisk and black cross respectively. Secondary structure elements from the Tcu PARG structure are indicated above. b , YmdB-rooted phylogenetic tree of PARGs implied by the neighbour-joining method. Organisms devoid of PARP are marked in grey. c , H. aurantiacus (HA) PARP and PARG enzymes are active as shown by Western blotting with anti-PAR antibodies.
    Figure Legend Snippet: Phylogeny and functional relationship between DUF2263 and canonical-type PARGs a , Multiple sequence alignment of different DUF2263 and PARG proteins from Thermomonospora curvata (Tcu), Herpetosiphon aurantiacus (Hau), Deinococcus radiodurans (Dra), Aspergillus fumigatus (Afu), Homo sapiens (Hsa), Bos taurus (Bta) and Entamoeba dispar (Edi). The two catalytic glutamates, a conserved glycine and tyrosine are marked with black asterisks, grey asterisk and black cross respectively. Secondary structure elements from the Tcu PARG structure are indicated above. b , YmdB-rooted phylogenetic tree of PARGs implied by the neighbour-joining method. Organisms devoid of PARP are marked in grey. c , H. aurantiacus (HA) PARP and PARG enzymes are active as shown by Western blotting with anti-PAR antibodies.

    Techniques Used: Functional Assay, Sequencing, Western Blot

    40) Product Images from "Simian adenoviruses as vaccine vectors"

    Article Title: Simian adenoviruses as vaccine vectors

    Journal: Future Virology

    doi: 10.2217/fvl-2016-0070

    Insertion of an antigen-expression cassette into adenovirus vector using att recombination sites. A universal cassette expressing a bacteria antibiotic resistance gene and ccdB suicide gene flanked by the specific recombination sequences, att R1 and att R2 is located at the E1 locus and/or the E3 locus of the BAC-adenovirus genome clone. Shuttle plasmids containing an antigen-expression cassette flanked by specific recombination sites paired with those present in the adenovirus genome ( att L1/L2) allow site-specific recombination in the presence of an enzyme mixture containing bacteriophage λ integrase, integration host factor and excisionase. BAC: Bacterial artificial chromosome; ChAdOx2: E1/E3 deleted adenovirus vector derived from ChAd68 with a modified E4 region; CMV: Cytomegalovirus.
    Figure Legend Snippet: Insertion of an antigen-expression cassette into adenovirus vector using att recombination sites. A universal cassette expressing a bacteria antibiotic resistance gene and ccdB suicide gene flanked by the specific recombination sequences, att R1 and att R2 is located at the E1 locus and/or the E3 locus of the BAC-adenovirus genome clone. Shuttle plasmids containing an antigen-expression cassette flanked by specific recombination sites paired with those present in the adenovirus genome ( att L1/L2) allow site-specific recombination in the presence of an enzyme mixture containing bacteriophage λ integrase, integration host factor and excisionase. BAC: Bacterial artificial chromosome; ChAdOx2: E1/E3 deleted adenovirus vector derived from ChAd68 with a modified E4 region; CMV: Cytomegalovirus.

    Techniques Used: Expressing, Plasmid Preparation, BAC Assay, Derivative Assay, Modification

    Related Articles

    Clone Assay:

    Article Title: AIM2 inflammasome is activated by pharmacological disruption of nuclear envelope integrity
    Article Snippet: .. A human Flag-tagged AIM2 or TREX1 construct were cloned into the pENTR 1A dual selection vector (Invitrogen) and then cloned in the pINDUCER21, a GFP tet-inducible lentiviral vector plasmid. .. Lentiviruses were produced as previously described ( ).

    Article Title: A high resolution protein interaction map of the yeast Mediator complex
    Article Snippet: .. The Drosophila Mediator subunit open-reading-frames (ORF) were isolated from cDNA clones made by the Berkeley Drosophila Genome Project (BDGP) and inserted into the Invitrogen Gateway entry vector pENTR1A or a home-made derivative, termed pGATEN. .. The latter was derived from pENTR1A by inserting a SalI–KpnI cloning adapter made of the two complementary oligonucleotides GATEN1 (TCGACTGGGCCTCCATGGCCCAATTGACTAGTAGCGGATCCGGAGGCCTCTACGTAGGTA) and GATEN2 (CTACGTAGAGGCCTCCGGATCCGCTACTAGTCAATTGGGCCATGGAGGCCCAG), between the unique SalI and KpnI sites.

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Selection:

    Article Title: A mouse model for inducible overexpression of Prdm14 results in rapid-onset and highly penetrant T-cell acute lymphoblastic leukemia (T-ALL)
    Article Snippet: .. This fragment was ligated into the pENTR1A dual selection vector (Life Technologies) using the Dra I and Sal I restriction sites. .. Gateway recombination using LR Clonase II mix (Life Technologies) was used to transfer the Prdm14 -IRES-nls-EGFP fragment from the pENTR1A vector to pROSA26-DEST (Addgene plasmid 21189).

    Article Title: AIM2 inflammasome is activated by pharmacological disruption of nuclear envelope integrity
    Article Snippet: .. A human Flag-tagged AIM2 or TREX1 construct were cloned into the pENTR 1A dual selection vector (Invitrogen) and then cloned in the pINDUCER21, a GFP tet-inducible lentiviral vector plasmid. .. Lentiviruses were produced as previously described ( ).

    Isolation:

    Article Title: A high resolution protein interaction map of the yeast Mediator complex
    Article Snippet: .. The Drosophila Mediator subunit open-reading-frames (ORF) were isolated from cDNA clones made by the Berkeley Drosophila Genome Project (BDGP) and inserted into the Invitrogen Gateway entry vector pENTR1A or a home-made derivative, termed pGATEN. .. The latter was derived from pENTR1A by inserting a SalI–KpnI cloning adapter made of the two complementary oligonucleotides GATEN1 (TCGACTGGGCCTCCATGGCCCAATTGACTAGTAGCGGATCCGGAGGCCTCTACGTAGGTA) and GATEN2 (CTACGTAGAGGCCTCCGGATCCGCTACTAGTCAATTGGGCCATGGAGGCCCAG), between the unique SalI and KpnI sites.

    Construct:

    Article Title: AIM2 inflammasome is activated by pharmacological disruption of nuclear envelope integrity
    Article Snippet: .. A human Flag-tagged AIM2 or TREX1 construct were cloned into the pENTR 1A dual selection vector (Invitrogen) and then cloned in the pINDUCER21, a GFP tet-inducible lentiviral vector plasmid. .. Lentiviruses were produced as previously described ( ).

    Sequencing:

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Modification:

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Plasmid Preparation:

    Article Title: A mouse model for inducible overexpression of Prdm14 results in rapid-onset and highly penetrant T-cell acute lymphoblastic leukemia (T-ALL)
    Article Snippet: .. This fragment was ligated into the pENTR1A dual selection vector (Life Technologies) using the Dra I and Sal I restriction sites. .. Gateway recombination using LR Clonase II mix (Life Technologies) was used to transfer the Prdm14 -IRES-nls-EGFP fragment from the pENTR1A vector to pROSA26-DEST (Addgene plasmid 21189).

    Article Title: AIM2 inflammasome is activated by pharmacological disruption of nuclear envelope integrity
    Article Snippet: .. A human Flag-tagged AIM2 or TREX1 construct were cloned into the pENTR 1A dual selection vector (Invitrogen) and then cloned in the pINDUCER21, a GFP tet-inducible lentiviral vector plasmid. .. Lentiviruses were produced as previously described ( ).

    Article Title: A high resolution protein interaction map of the yeast Mediator complex
    Article Snippet: .. The Drosophila Mediator subunit open-reading-frames (ORF) were isolated from cDNA clones made by the Berkeley Drosophila Genome Project (BDGP) and inserted into the Invitrogen Gateway entry vector pENTR1A or a home-made derivative, termed pGATEN. .. The latter was derived from pENTR1A by inserting a SalI–KpnI cloning adapter made of the two complementary oligonucleotides GATEN1 (TCGACTGGGCCTCCATGGCCCAATTGACTAGTAGCGGATCCGGAGGCCTCTACGTAGGTA) and GATEN2 (CTACGTAGAGGCCTCCGGATCCGCTACTAGTCAATTGGGCCATGGAGGCCCAG), between the unique SalI and KpnI sites.

    Article Title: Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1 [OA]
    Article Snippet: .. The plasmids were digested with Xho I and Kpn I and ligated into the Gateway entry vector pENTR1A (Invitrogen). .. The inserts were cloned into the pGWB2 vector (provided by Dr. Tsuyoshi Nakagawa, Shimane University) by the LR reaction according to the manufacturer's protocol.

    Article Title: miR-24 Inhibition Increases Menin Expression and Decreases Cholangiocarcinoma Proliferation
    Article Snippet: .. The pCMV6-Entry vector without the Men1 insert was used as a control. .. Transfection efficacy was assessed by measuring menin expression by real-time quantitative PCR and flow cytometry., Cell proliferation was measured by Ki-67 real-time PCR expression, migration via wound healing, invasion via Boyden chamber, and angiogenesis via VEGF-A, VEGF-C, VEGFR-2, VEGFR-3, ANG-1, ANG-2, TIE-1, and TIE-2 real-time PCR expression.

    Article Title: Human Dicer preferentially cleaves dsRNAs at their termini without a requirement for ATP
    Article Snippet: .. Dicer and Dicer-HisC cDNAs were recloned from pBS plasmids into the pENTR1A vector, using the Gateway system (Life Technologies), yielding pENTR-Dicer and pENTR-Dicer-HisC. .. The non-tagged Dicer cDNA was then switched to the pDEST10 vector by the reaction catalysed by LR Clonase mix (Life Technologies), yielding pDEST10-Dicer, used for expression of the N-terminally His6 -tagged Dicer-HisN.

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher site specific gateway recombination technology
    Site Specific Gateway Recombination Technology, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/site specific gateway recombination technology/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    site specific gateway recombination technology - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    93
    Thermo Fisher site specific recombination gateway technology
    Site Specific Recombination Gateway Technology, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/site specific recombination gateway technology/product/Thermo Fisher
    Average 93 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    site specific recombination gateway technology - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    99
    Thermo Fisher site specific gateway recombination
    Site Specific Gateway Recombination, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/site specific gateway recombination/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    site specific gateway recombination - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results