sirna gpr50  (Santa Cruz Biotechnology)

Journal: PLoS ONE

Article Title: GPR50 Interacts with TIP60 to Modulate Glucocorticoid Receptor Signalling

doi: 10.1371/journal.pone.0023725

Figure Lengend Snippet: ( A–D ) Identification and cloning of full length and truncated GPR50. RT-PCR cloning of Gpr50 from mouse hypothalamus (hyp) and pituitary (pit) produced two bands, reflecting full length Gpr50 (∼1.8 kb) and a novel truncated transcript (∼1.7 kb; tGPR50; cDNA ladder shown in the first lane) ( A ). Western blotting of myc GPR50 ( B ) and myc tGPR50 ( C ) in HEK293 cells using an anti-myc antibody revealed proteins of the expected size (∼69 kDa for full length, ∼29 kDa for the truncated form). Filled and open arrowheads indicate the full-length and putative cleavage fragment of GPR50, respectively ( B ). Schematic of Gpr50 gene (black arrows indicate splicing sites) and GPR50 protein (purple indicates the portion of the protein lost in the truncated version of the receptor) ( D ). ( E–G ) Identification and verification of TIP60 as a binding partner of GPR50. Schematic representation of the region of TIP60 encoded by the positive interacting clones identified in yeast two hybrid screen. This region includes the zinc finger (ZF), histoneacetyltransferase (HAT) and nuclear hormone receptor (NHR) binding domains ( E ). HEK293 cells were transfected with flag Tip60 , or myc Gpr50 , or both (as indicated), and total cell lysates (TCL) were subject to immunoprecipitation ( IP ) using anti-myc antibody. Western blotting ( WB ) of immunoprecipitates using anti-Flag antibody, confirmed the specific association of flag TIP60 with myc GPR50 ( F ). Full-length and the c-terminal cleavage fragment of GPR50 were detected in the immunoprecipitate (filled and open arrowheads, respectively). No precipitation of TIP60 was observed when truncated GPR50 was used for IP ( G ).

Article Snippet: The correct sequences and reading frames of all constructs derived from PCR products were verified by DNA sequencing. shRNA against Gpr50 was purchased from Sigma ( CCGGGCCAGCTCTAATCATCTTCATCTCGAGATGAAGATGATTAGAGCTGGCTTTTT , TRCN0000025780).

Techniques: Clone Assay, Reverse Transcription Polymerase Chain Reaction, Produced, Western Blot, Binding Assay, Two Hybrid Screening, Transfection, Immunoprecipitation

Journal: PLoS ONE

Article Title: GPR50 Interacts with TIP60 to Modulate Glucocorticoid Receptor Signalling

doi: 10.1371/journal.pone.0023725

Figure Lengend Snippet: EGFP GPR50, EGFP tGPR50, and EGFP cGPR50 were expressed alone or in combination with HcRED TIP60 in HEK293 cells. When expressed alone (far left panels), full length GPR50 localised predominantly to the cell membrane ( B ), while tGP50 ( A ) and cGPR50 ( C ) remained cytoplasmic. HcRED TIP60 was confined to the nucleus when expressed with tGPR50 ( A ). In contrast, co-expression of TIP60 with full length GPR50 resulted in a pronounced perinuclear localisation of both proteins ( B , arrows), while co-expression with cGPR50 led to nuclear compartmentalisation of the receptor tail ( C ). Blue = DAPI counterstaining; Magnification Bar = 20 µm.

Article Snippet: The correct sequences and reading frames of all constructs derived from PCR products were verified by DNA sequencing. shRNA against Gpr50 was purchased from Sigma ( CCGGGCCAGCTCTAATCATCTTCATCTCGAGATGAAGATGATTAGAGCTGGCTTTTT , TRCN0000025780).

Techniques: Expressing

Journal: PLoS ONE

Article Title: GPR50 Interacts with TIP60 to Modulate Glucocorticoid Receptor Signalling

doi: 10.1371/journal.pone.0023725

Figure Lengend Snippet: ( A–B ) The impact of GPR50 on TIP60-mediated GR signalling was assayed in HEK293 cells using a luciferase-based transcriptional reporter for GR (TAT3::luc)( A ) and quantitative RT-PCR of a GR-responsive target gene (Fkbp5)( B ). Full-length Gpr50 , tGpr50, cGpr50 and/or Tip60 constructs were transfected alone or in combination as indicated.

Article Snippet: The correct sequences and reading frames of all constructs derived from PCR products were verified by DNA sequencing. shRNA against Gpr50 was purchased from Sigma ( CCGGGCCAGCTCTAATCATCTTCATCTCGAGATGAAGATGATTAGAGCTGGCTTTTT , TRCN0000025780).

Techniques: Luciferase, Quantitative RT-PCR, Construct, Transfection

Journal: PLoS ONE

Article Title: GPR50 Interacts with TIP60 to Modulate Glucocorticoid Receptor Signalling

doi: 10.1371/journal.pone.0023725

Figure Lengend Snippet: ( A–D ) Contribution of endogenous GPR50 and TIP60 to GR-signalling in GH3 cells. Expression of both Gpr50 and Tip60 was confirmed in GH3 cells ( A ). shGpr50 or siTip60 were efficient at attenuating the expression of their respective targets as demonstrated by reduced protein accumulation following transient transfection ( B ) and reduced levels of endogenous mRNA transcript ( C ). Importantly, knockdown of either GPR50 or TIP60 in GH3 cells attenuated the induction of TAT3::luc activity in response to Dex (100 nM), although no additive effect was observed with combined knockdown of both proteins ( C ). The potentiation of Dex-induced TAT3::luc activity by Gpr50 over-expression was also blocked by knockdown of endogenous TIP60 using siTip60 ( D ). Differences in lettering reflect statistically significant differences between treatment groups (two-way ANOVA, with Bonferroni's post hoc test). Data are representative of 3 independent experiments, each performed in triplicate.

Article Snippet: The correct sequences and reading frames of all constructs derived from PCR products were verified by DNA sequencing. shRNA against Gpr50 was purchased from Sigma ( CCGGGCCAGCTCTAATCATCTTCATCTCGAGATGAAGATGATTAGAGCTGGCTTTTT , TRCN0000025780).

Techniques: Expressing, Transfection, Activity Assay, Over Expression

Journal: PLoS ONE

Article Title: GPR50 Interacts with TIP60 to Modulate Glucocorticoid Receptor Signalling

doi: 10.1371/journal.pone.0023725

Figure Lengend Snippet: ( A ) RT-PCR profiling of Gpr50 and Tip60 mRNA expression in mouse tissues. Hp, hypothalamus; Pt, pituitary; Ht, heart; Lg, lung; E, eye; Th, thyroid; A, adrenal; F, white fat; T, testes; I, intestine; Lv, liver; K, kidney; Sp, spleen; St, stomach; Pa, pancreas. ( B–E ) The effects of dexamethasone (Dex, 0.1 mg/kg) were examined in WT and Gpr50 −/− mice, in terms of glucocorticoid feedback and glucose homeostasis. Pomc mRNA expression in the pituitary was reduced 5 hr after Dex treatment in WT, but not Gpr50 −/− mice ( B ). Circulating blood glucose was significantly increased in response to Dex only in WT mice ( C ). Similarly, Gpr50 −/− mice exhibited an attenuated induction of the liver gluconeogenic genes Pepck ( D ) and Tat ( E ) in response to Dex. Gene expression has been normalised to vehicle treated levels, and blood glucose presented as change from time 0 to 5 h post-injection. * = P<0.05, ** = P<0.01 versus vehicle treatment within genotype, # = P<0.05 versus WT Dex treatment, two-way ANOVA with Bonferroni's post hoc test. Data representative of two independent experiments n = 5 mice/group in each experiment for B–D .

Article Snippet: The correct sequences and reading frames of all constructs derived from PCR products were verified by DNA sequencing. shRNA against Gpr50 was purchased from Sigma ( CCGGGCCAGCTCTAATCATCTTCATCTCGAGATGAAGATGATTAGAGCTGGCTTTTT , TRCN0000025780).

Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing, Injection