Structured Review

GE Healthcare shrimp alkaline phosphatase
Shrimp Alkaline Phosphatase, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 75/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrimp alkaline phosphatase/product/GE Healthcare
Average 75 stars, based on 0 article reviews
Price from $9.99 to $1999.99
shrimp alkaline phosphatase - by Bioz Stars, 2019-12
75/100 stars

Images

Related Articles

Clone Assay:

Article Title: Human and Murine Clonal CD8+ T Cell Expansions Arise during Tuberculosis Because of TCR Selection
Article Snippet: For TCR product sequencing, a total of 12 μl of the products from the second round of the nested PCR amplification was combined with 1.5 μl of 10X shrimp alkaline phosphatase reaction buffer (200 mM Tris-HCl (pH 8.0) and 100 mM MgCl2), 1 U of shrimp alkaline phosphatase (Amersham Biosciences), and 1 U of exonuclease I (New England Biolabs), and water to total 15 μl. .. For TCR product sequencing, a total of 12 μl of the products from the second round of the nested PCR amplification was combined with 1.5 μl of 10X shrimp alkaline phosphatase reaction buffer (200 mM Tris-HCl (pH 8.0) and 100 mM MgCl2), 1 U of shrimp alkaline phosphatase (Amersham Biosciences), and 1 U of exonuclease I (New England Biolabs), and water to total 15 μl.

Amplification:

Article Title: Major pathologic response and RAD51 predict survival in lung cancer patients receiving neoadjuvant chemotherapy
Article Snippet: The EGFR primers used were as follows: exon 19: forward: 5′‐TGGTAACATCCACCCAGATC‐3′, reverse: 5′‐ATGAGAAAAGGTGGGCCTGA ‐3′; exon 21: forward: 5′‐CTCAGAGCCTGGCATGAACAT‐3′, reverse: 5′‐CAATACAGCTAGTGGGAAGGC‐3′. .. For direct sequencing, all PCR amplification products were incubated using exonuclease I and shrimp alkaline phosphatase (Amersham Biosciences, Piscataway, NJ) and sequenced by the MD Anderson Core Sequencing and Microarray Facility. .. Immunohistochemical staining for biomarkers was performed as described previously .

Article Title: Root-associated fungal communities in three Pyroleae species and their mycobiont sharing with surrounding trees in subalpine coniferous forests on Mount Fuji, Japan
Article Snippet: PCR products were assessed on 1.2% agarose gels (0.5× TBE buffer) using Gel Red (Biotium, Fremont, CA, USA) under UV light (Benchtop 2UV Transilluminator, UVP, Cambridge, UK). .. Amplification products were purified using a PCR clean-up kit containing exonuclease I and shrimp alkaline phosphatase (GE Healthcare, Hertfordshire, UK). .. Sanger sequencing was performed using the Big Dye Terminator version 3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA) and ITS1 or ITS4.

Article Title: Nutlin-3, the small-molecule inhibitor of MDM2, promotes senescence and radiosensitises laryngeal carcinoma cells harbouring wild-type p53
Article Snippet: Genomic DNA (50 ng) was amplified in triplicate using HotStarTaq plus DNA polymerase (Qiagen, Crawley, UK), using an initial 95°C for 5 min, followed by 35 cycles of 94°C for 30 s, 61–65°C for 30 s, 72°C for 60 s and a 10 min at 72°C final extension. .. Residual primers and dNTPs were removed by exonuclease I and shrimp alkaline phosphatase (ExoSAP-IT, GE Healthcare, Little Chalfont, UK).

Article Title: Epidemiology of Theileria bicornis among black and white rhinoceros metapopulation in Kenya
Article Snippet: Paragraph title: DNA isolation and PCR amplification ... PCR products were purified for direct sequencing by enzymatic treatment using exonuclease I and shrimp alkaline phosphatase (PCR Product Presequencing Kit, Amersham).

Article Title: Bias in effect size of systemic lupus erythematosus susceptibility loci across Europe: a case-control study
Article Snippet: DNA samples were amplified in a multiplex PCR with the KAPA2G fast HotStart (Kapa Biosystems, Woburn, MA, USA) in a final volume of 10 μl (20 ng genomic DNA), using 3 mM MgCl2 and 0.2 μM each primer. .. Products were purified by Exo-SAP digestion with exonuclease I (Epicentre, Madison, WI, USA) and shrimp alkaline phosphatase (GE Healthcare, Barcelona, Spain).

Article Title: Human and Murine Clonal CD8+ T Cell Expansions Arise during Tuberculosis Because of TCR Selection
Article Snippet: Contamination was monitored for all steps (sorting, reverse transcriptase, and PCR), by leaving 16 control wells empty per 96-well PCR plate sorted. .. For TCR product sequencing, a total of 12 μl of the products from the second round of the nested PCR amplification was combined with 1.5 μl of 10X shrimp alkaline phosphatase reaction buffer (200 mM Tris-HCl (pH 8.0) and 100 mM MgCl2), 1 U of shrimp alkaline phosphatase (Amersham Biosciences), and 1 U of exonuclease I (New England Biolabs), and water to total 15 μl. .. The reaction was then heated to 37°C 30 min, 80°C 10 min, and cooled to 4°C, and the product was subjected to automated sequencing (Dana-Farber/Harvard Cancer Center High-Throughput Sequencing Core).

Article Title: DNA damage predicts prognosis and treatment response in colorectal liver metastases superior to immunogenic cell death and T cells
Article Snippet: Briefly, genomic DNA was extracted from tissue blocks and exon 2 and 3 of the KRAS gene and exon 15 of the BRAF gene were polymerase chain reaction (PCR) amplified with AmpliTaq Gold® DNA polymerase (Applied Biosystems, Fisher Scientific, Vienna, Austria) and corresponding oligonucleotide primers ( Table ). .. Excess of primers and deoxynucleotides (dNTPs) was removed by incubation of 5 µL PCR product with 2.5 U exonuclease I (GE Healthcare Life Sciences, Vienna, Austria) and 2.5 U shrimp alkaline phosphatase (SAP; GE Healthcare Life Sciences) at 37°C for 1 h. Enzymes were further heat inactivated at 70°C for 15 min, following sequence analysis with 1-2 µL of the purified PCR product and 4 pmol primers using the BigDye™ Terminator Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer's instructions.

Article Title: DNMT3A Mutations in Patients with Acute Myeloid Leukemia in South Brazil
Article Snippet: The extracted DNA was amplified by PCR at the DNMT3A exons 19, 20, 21, 22, and 23, with primers described by Thol et al. [ ] ( ). .. After electrophoresis on 1.5 agarose gel, PCR products were subjected to purification using Exonuclease I and Shrimp Alkaline Phosphatase (EXO-SAP, GE Healthcare) and then sequenced.

Article Title: The conserved carboxyl domain of MorC, an inner membrane protein of Aggregatibacter actinomycetemcomitans, is essential for membrane function
Article Snippet: The cassette was ligated with pGP704 that had been digested with EcoRV and treated with shrimp alkaline phosphatase (Amersham Life Sciences, Buckinghamshire, UK). .. The cassette was ligated with pGP704 that had been digested with EcoRV and treated with shrimp alkaline phosphatase (Amersham Life Sciences, Buckinghamshire, UK).

Article Title: Interhomolog polymorphism shapes meiotic crossover within the Arabidopsis RAC1 and RPP13 disease resistance genes
Article Snippet: Recombination rate was calculated using the formula cM = (crossovers/(parentals+crossovers))×100. .. Amplified single crossover molecules were treated with exonuclease I (NEB, M0293) and shrimp alkaline phosphatase (Amersham, E70092), and then Sanger sequenced to identify recombination sites to the resolution of individual polymorphisms. .. For analysis we PCR amplified and sequenced the target regions from Col, Ler, Wl and Mh accessions, and used these data to generate Col×Ler, Col×Wl or Col×Mh panmolecules, which include all bases from both accessions ( ).

Filtration:

Article Title: Nutlin-3, the small-molecule inhibitor of MDM2, promotes senescence and radiosensitises laryngeal carcinoma cells harbouring wild-type p53
Article Snippet: Residual primers and dNTPs were removed by exonuclease I and shrimp alkaline phosphatase (ExoSAP-IT, GE Healthcare, Little Chalfont, UK). .. DNA sequencing was performed using DYEnamic ET Dye Terminators (GE Healthcare).

Construct:

Article Title: The conserved carboxyl domain of MorC, an inner membrane protein of Aggregatibacter actinomycetemcomitans, is essential for membrane function
Article Snippet: The plasmid constructed for conjugation in A. actinomycetemcomitans is based on the mobilizable plasmid pGP704 ( ). .. The cassette was ligated with pGP704 that had been digested with EcoRV and treated with shrimp alkaline phosphatase (Amersham Life Sciences, Buckinghamshire, UK).

Electrophoresis:

Article Title: Nutlin-3, the small-molecule inhibitor of MDM2, promotes senescence and radiosensitises laryngeal carcinoma cells harbouring wild-type p53
Article Snippet: Residual primers and dNTPs were removed by exonuclease I and shrimp alkaline phosphatase (ExoSAP-IT, GE Healthcare, Little Chalfont, UK). .. DNA sequencing was performed using DYEnamic ET Dye Terminators (GE Healthcare).

Article Title: DNMT3A Mutations in Patients with Acute Myeloid Leukemia in South Brazil
Article Snippet: The extracted DNA was amplified by PCR at the DNMT3A exons 19, 20, 21, 22, and 23, with primers described by Thol et al. [ ] ( ). .. After electrophoresis on 1.5 agarose gel, PCR products were subjected to purification using Exonuclease I and Shrimp Alkaline Phosphatase (EXO-SAP, GE Healthcare) and then sequenced. .. Samples were sequenced at the Unidade de Análises Moleculares e de Proteínas (Centro de Pesquisa Experimental, HCPA) using ABI 3500 Genetic Analyzer with 50 cm capillaries and POP7 polymer (Applied Biosystems).

Article Title: Cox-2 and IL-10 Polymorphisms and Association with Squamous Cell Carcinoma of The Head and Neck in a Korean Sample
Article Snippet: To clean-up the primer extension reaction products, 1 U shrimp alkaline phosphatase (Amersham Life Science, Cleveland, Ohio, USA) was added to the reaction mixture, and the mixture was incubated at 37℃ for one hour, followed by 15 min at 72℃ for enzyme inactivation. .. We added the amplified material and Genescan 120Liz size-standard solution (Applied Biosystems) in Hi-Di formamide (Applied Biosystems) and incubated the reaction at 95℃ for five minutes, followed by incubation on ice for five minutes.

Microarray:

Article Title: Major pathologic response and RAD51 predict survival in lung cancer patients receiving neoadjuvant chemotherapy
Article Snippet: The EGFR primers used were as follows: exon 19: forward: 5′‐TGGTAACATCCACCCAGATC‐3′, reverse: 5′‐ATGAGAAAAGGTGGGCCTGA ‐3′; exon 21: forward: 5′‐CTCAGAGCCTGGCATGAACAT‐3′, reverse: 5′‐CAATACAGCTAGTGGGAAGGC‐3′. .. For direct sequencing, all PCR amplification products were incubated using exonuclease I and shrimp alkaline phosphatase (Amersham Biosciences, Piscataway, NJ) and sequenced by the MD Anderson Core Sequencing and Microarray Facility. .. Immunohistochemical staining for biomarkers was performed as described previously .

Incubation:

Article Title: Major pathologic response and RAD51 predict survival in lung cancer patients receiving neoadjuvant chemotherapy
Article Snippet: The EGFR primers used were as follows: exon 19: forward: 5′‐TGGTAACATCCACCCAGATC‐3′, reverse: 5′‐ATGAGAAAAGGTGGGCCTGA ‐3′; exon 21: forward: 5′‐CTCAGAGCCTGGCATGAACAT‐3′, reverse: 5′‐CAATACAGCTAGTGGGAAGGC‐3′. .. For direct sequencing, all PCR amplification products were incubated using exonuclease I and shrimp alkaline phosphatase (Amersham Biosciences, Piscataway, NJ) and sequenced by the MD Anderson Core Sequencing and Microarray Facility. .. Immunohistochemical staining for biomarkers was performed as described previously .

Article Title: Antitumor activity of pan‐ HER inhibitors in HER2‐positive gastric cancer, et al. Antitumor activity of pan‐HER inhibitors in HER2‐positive gastric cancer
Article Snippet: 2.7 The direct sequencing of exon 8, the transmembrane domain (exon 17), and the kinase domain (exons 18‐24) of HER2 was carried out for each of the 12 cell lines and 123 primary gastric cancer samples. .. The sequences of the primers were the same as previously reported., The detailed PCR protocol has been previously reported, and all the PCR products were incubated using exonuclease I and shrimp alkaline phosphatase (Amersham Biosciences). .. DNA sequence alterations were evaluated using MutationTaster2.

Article Title: Exposure to Polycyclic Aromatic Hydrocarbons Among Never Smokers in Golestan Province, Iran, an Area of High Incidence of Esophageal Cancer - a Cross-Sectional Study with Repeated Measurement of Urinary 1-OHPG in Two Seasons
Article Snippet: Genotyping was performed by single base extension (SBE) method using SnaPShot (Applied Biosystems, Nieuwerkerk, a.d. IJssel, the Netherlands), and primer 3 and Netprimer software were used to design SBE primers. .. Following SBE, the samples were incubated at 37°C (1 h) with 1 unit shrimp alkaline phosphatase (Amersham) to degrade the unincorporated dideoxynucleotide triphosphates. .. Two multiplex genotyping experiments (as described above) were used for SBE reactions.

Article Title: DNA damage predicts prognosis and treatment response in colorectal liver metastases superior to immunogenic cell death and T cells
Article Snippet: Briefly, genomic DNA was extracted from tissue blocks and exon 2 and 3 of the KRAS gene and exon 15 of the BRAF gene were polymerase chain reaction (PCR) amplified with AmpliTaq Gold® DNA polymerase (Applied Biosystems, Fisher Scientific, Vienna, Austria) and corresponding oligonucleotide primers ( Table ). .. Excess of primers and deoxynucleotides (dNTPs) was removed by incubation of 5 µL PCR product with 2.5 U exonuclease I (GE Healthcare Life Sciences, Vienna, Austria) and 2.5 U shrimp alkaline phosphatase (SAP; GE Healthcare Life Sciences) at 37°C for 1 h. Enzymes were further heat inactivated at 70°C for 15 min, following sequence analysis with 1-2 µL of the purified PCR product and 4 pmol primers using the BigDye™ Terminator Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer's instructions. .. Excess of BigDye™ Terminator nucleotides was removed by centrifugation with Centri-Sep™ Spin Columns (Invitrogen, Fisher Scientific, Vienna, Austria).

Article Title: Identification and Genotyping of Mycobacterium tuberculosis Complex Species by Use of a SNaPshot Minisequencing-Based Assay
Article Snippet: Each SBE reaction was carried out in a 10 μl final volume containing 4 μl of SNaPshot multiplex ready reaction mixture (AB), 20 mM ammonium sulfate, 3 μl cleaned PCR products, and 0.13 to 0.58 μM each minisequencing primer. .. Extension was performed for 25 cycles of denaturation at 96°C for 10 s, annealing at 50°C for 5 s, and extension at 60°C for 30 s. Unincorporated ddNTPs were removed by addition of 1 U of shrimp alkaline phosphatase (GE Healthcare, Little Chalfont, United Kingdom) to the SBE mixtures and incubation at 37°C for 1 h, followed by incubation at 75°C for 15 min. .. Two microliters of the purified SBE products was mixed with 17.6 μl Hi-Di formamide (AB) and 0.4 μl of GeneScan-120 LIZ internal size standard (AB), and the mixture was further analyzed by capillary electrophoresis on an ABI Prism 3100 genetic analyzer (AB) with 36-cm capillary arrays and performance-optimized polymer 4 (POP-4) (AB).

Article Title: Cox-2 and IL-10 Polymorphisms and Association with Squamous Cell Carcinoma of The Head and Neck in a Korean Sample
Article Snippet: Using the SNaPshot ddNTP primer extension kit (Applied Biosystems), we performed the primer extension reaction. .. To clean-up the primer extension reaction products, 1 U shrimp alkaline phosphatase (Amersham Life Science, Cleveland, Ohio, USA) was added to the reaction mixture, and the mixture was incubated at 37℃ for one hour, followed by 15 min at 72℃ for enzyme inactivation. .. We added the amplified material and Genescan 120Liz size-standard solution (Applied Biosystems) in Hi-Di formamide (Applied Biosystems) and incubated the reaction at 95℃ for five minutes, followed by incubation on ice for five minutes.

Modification:

Article Title: Root-associated fungal communities in three Pyroleae species and their mycobiont sharing with surrounding trees in subalpine coniferous forests on Mount Fuji, Japan
Article Snippet: Briefly, each Pyroleae or ECM root tip was placed in a 2.0-ml tube, pulverized using a bead-beater, and DNA was extracted using a modified cetyl trimethyl ammonium bromide method. .. Amplification products were purified using a PCR clean-up kit containing exonuclease I and shrimp alkaline phosphatase (GE Healthcare, Hertfordshire, UK).

Allele-specific Oligonucleotide:

Article Title: Interhomolog polymorphism shapes meiotic crossover within the Arabidopsis RAC1 and RPP13 disease resistance genes
Article Snippet: Genomic DNA was extracted from hybrid F1 pollen (Col×Ler, Col×Wl or Col×Mh), and used for nested PCR amplifications using parental or crossover configurations of allele-specific oligonucleotide (ASO) primers ( and Tables). .. Amplified single crossover molecules were treated with exonuclease I (NEB, M0293) and shrimp alkaline phosphatase (Amersham, E70092), and then Sanger sequenced to identify recombination sites to the resolution of individual polymorphisms.

Derivative Assay:

Article Title: The conserved carboxyl domain of MorC, an inner membrane protein of Aggregatibacter actinomycetemcomitans, is essential for membrane function
Article Snippet: The cassette was ligated with pGP704 that had been digested with EcoRV and treated with shrimp alkaline phosphatase (Amersham Life Sciences, Buckinghamshire, UK). .. A. actinomycetemcomitans genomic DNA from VT1169 was purified using the Puregene genomic DNA isolation kit (Qiagen, Valencia, CA) and used as a template for PCR.

Conjugation Assay:

Article Title: The conserved carboxyl domain of MorC, an inner membrane protein of Aggregatibacter actinomycetemcomitans, is essential for membrane function
Article Snippet: The plasmid constructed for conjugation in A. actinomycetemcomitans is based on the mobilizable plasmid pGP704 ( ). .. The cassette was ligated with pGP704 that had been digested with EcoRV and treated with shrimp alkaline phosphatase (Amersham Life Sciences, Buckinghamshire, UK).

Inverse PCR:

Article Title: The conserved carboxyl domain of MorC, an inner membrane protein of Aggregatibacter actinomycetemcomitans, is essential for membrane function
Article Snippet: The cassette was ligated with pGP704 that had been digested with EcoRV and treated with shrimp alkaline phosphatase (Amersham Life Sciences, Buckinghamshire, UK). .. The ligation mixture was transformed into electrocompetent DH5α(λpir) E. coli cells.

Generated:

Article Title: The conserved carboxyl domain of MorC, an inner membrane protein of Aggregatibacter actinomycetemcomitans, is essential for membrane function
Article Snippet: An isogenic mutant of VT1169 with the morC gene deleted was generated by conjugation using a non-replicating broad host range plasmid ( ). .. The cassette was ligated with pGP704 that had been digested with EcoRV and treated with shrimp alkaline phosphatase (Amersham Life Sciences, Buckinghamshire, UK).

DNA Sequencing:

Article Title: Nutlin-3, the small-molecule inhibitor of MDM2, promotes senescence and radiosensitises laryngeal carcinoma cells harbouring wild-type p53
Article Snippet: Residual primers and dNTPs were removed by exonuclease I and shrimp alkaline phosphatase (ExoSAP-IT, GE Healthcare, Little Chalfont, UK). .. DNA sequencing was performed using DYEnamic ET Dye Terminators (GE Healthcare).

Sequencing:

Article Title: Major pathologic response and RAD51 predict survival in lung cancer patients receiving neoadjuvant chemotherapy
Article Snippet: The EGFR primers used were as follows: exon 19: forward: 5′‐TGGTAACATCCACCCAGATC‐3′, reverse: 5′‐ATGAGAAAAGGTGGGCCTGA ‐3′; exon 21: forward: 5′‐CTCAGAGCCTGGCATGAACAT‐3′, reverse: 5′‐CAATACAGCTAGTGGGAAGGC‐3′. .. For direct sequencing, all PCR amplification products were incubated using exonuclease I and shrimp alkaline phosphatase (Amersham Biosciences, Piscataway, NJ) and sequenced by the MD Anderson Core Sequencing and Microarray Facility. .. Immunohistochemical staining for biomarkers was performed as described previously .

Article Title: Antitumor activity of pan‐ HER inhibitors in HER2‐positive gastric cancer, et al. Antitumor activity of pan‐HER inhibitors in HER2‐positive gastric cancer
Article Snippet: Paragraph title: Direct sequencing assay ... The sequences of the primers were the same as previously reported., The detailed PCR protocol has been previously reported, and all the PCR products were incubated using exonuclease I and shrimp alkaline phosphatase (Amersham Biosciences).

Article Title: Root-associated fungal communities in three Pyroleae species and their mycobiont sharing with surrounding trees in subalpine coniferous forests on Mount Fuji, Japan
Article Snippet: Amplification products were purified using a PCR clean-up kit containing exonuclease I and shrimp alkaline phosphatase (GE Healthcare, Hertfordshire, UK). .. Sanger sequencing was performed using the Big Dye Terminator version 3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA) and ITS1 or ITS4.

Article Title: Nutlin-3, the small-molecule inhibitor of MDM2, promotes senescence and radiosensitises laryngeal carcinoma cells harbouring wild-type p53
Article Snippet: The PCR primers were designed to include the entire exon-coding sequence and exon–intron junctions (Primer3 v0.4.0, ) as summarised in Supplementary Data Table 1. .. Residual primers and dNTPs were removed by exonuclease I and shrimp alkaline phosphatase (ExoSAP-IT, GE Healthcare, Little Chalfont, UK).

Article Title: Epidemiology of Theileria bicornis among black and white rhinoceros metapopulation in Kenya
Article Snippet: The PCR was completed with a final extension step of 72°C for 9 min. PCR products showing successful amplification on agarose gel analysis were directly sequenced for both strands. .. PCR products were purified for direct sequencing by enzymatic treatment using exonuclease I and shrimp alkaline phosphatase (PCR Product Presequencing Kit, Amersham). .. All DNA sequencing was carried out by direct cycle sequencing on both strands of purified PCR DNA products from PCR amplification.

Article Title: Human and Murine Clonal CD8+ T Cell Expansions Arise during Tuberculosis Because of TCR Selection
Article Snippet: Contamination was monitored for all steps (sorting, reverse transcriptase, and PCR), by leaving 16 control wells empty per 96-well PCR plate sorted. .. For TCR product sequencing, a total of 12 μl of the products from the second round of the nested PCR amplification was combined with 1.5 μl of 10X shrimp alkaline phosphatase reaction buffer (200 mM Tris-HCl (pH 8.0) and 100 mM MgCl2), 1 U of shrimp alkaline phosphatase (Amersham Biosciences), and 1 U of exonuclease I (New England Biolabs), and water to total 15 μl. .. The reaction was then heated to 37°C 30 min, 80°C 10 min, and cooled to 4°C, and the product was subjected to automated sequencing (Dana-Farber/Harvard Cancer Center High-Throughput Sequencing Core).

Article Title: DNA damage predicts prognosis and treatment response in colorectal liver metastases superior to immunogenic cell death and T cells
Article Snippet: Briefly, genomic DNA was extracted from tissue blocks and exon 2 and 3 of the KRAS gene and exon 15 of the BRAF gene were polymerase chain reaction (PCR) amplified with AmpliTaq Gold® DNA polymerase (Applied Biosystems, Fisher Scientific, Vienna, Austria) and corresponding oligonucleotide primers ( Table ). .. Excess of primers and deoxynucleotides (dNTPs) was removed by incubation of 5 µL PCR product with 2.5 U exonuclease I (GE Healthcare Life Sciences, Vienna, Austria) and 2.5 U shrimp alkaline phosphatase (SAP; GE Healthcare Life Sciences) at 37°C for 1 h. Enzymes were further heat inactivated at 70°C for 15 min, following sequence analysis with 1-2 µL of the purified PCR product and 4 pmol primers using the BigDye™ Terminator Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer's instructions. .. Excess of BigDye™ Terminator nucleotides was removed by centrifugation with Centri-Sep™ Spin Columns (Invitrogen, Fisher Scientific, Vienna, Austria).

Article Title: Contrasting patterns of RUNX2 repeat variations are associated with palate shape in phyllostomid bats and New World primates
Article Snippet: Paragraph title: RUNX2 sequence data ... Shrimp alkaline phosphatase and exonuclease I enzymes (GE Healthcare, Chicago, IL, USA) were used to purify the PCR products.

Article Title: Characterization of the differentially methylated region of the Impact gene that exhibits Glires-specific imprinting
Article Snippet: Both PCR reactions were performed in the presence of 3.5% dimethyl sulfoxide (DMSO). .. PCR products were treated with exonuclease I and shrimp alkaline phosphatase (Amersham, London, UK) for subsequent direct sequencing. .. Sequence data from this article has been deposited as [GenBank: EF470590 - EF470605 ].

Article Title: Clinical relevance of KRAS mutation detection in metastatic colorectal cancer treated by Cetuximab plus chemotherapy
Article Snippet: The multiplex SNaPshot reaction was performed in a final volume of 10 μ l, containing one-fifth of the PCR reaction, 2.5 μ l of the SNaPshot Multiplex Ready Reaction Mix, 1 μ l of sequencing buffer from the Big Dye V3.1 Terminator Kit and SNaPshot primers at a concentration of 0.02–0.05 μ M . .. Cycling conditions were 25 cycles of rapid thermal ramp to 96°C, 96°C for 10 s; rapid thermal ramp to 50°C, 50°C for 5 s; and rapid thermal ramp to 60°C and 60°C for 30 s. SNaPshot products were then treated 1 h at 37°C with 3 U of shrimp alkaline phosphatase (Amersham Biosciences/GE Healthcare Europe GmbH, Saclay, France).

Article Title: Interhomolog polymorphism shapes meiotic crossover within the Arabidopsis RAC1 and RPP13 disease resistance genes
Article Snippet: Paragraph title: RPP13 and RAC1 pollen-typing and Sanger sequencing ... Amplified single crossover molecules were treated with exonuclease I (NEB, M0293) and shrimp alkaline phosphatase (Amersham, E70092), and then Sanger sequenced to identify recombination sites to the resolution of individual polymorphisms.

Dye Terminator Removal:

Article Title: Nutlin-3, the small-molecule inhibitor of MDM2, promotes senescence and radiosensitises laryngeal carcinoma cells harbouring wild-type p53
Article Snippet: Residual primers and dNTPs were removed by exonuclease I and shrimp alkaline phosphatase (ExoSAP-IT, GE Healthcare, Little Chalfont, UK). .. DNA sequencing was performed using DYEnamic ET Dye Terminators (GE Healthcare).

Cellular Antioxidant Activity Assay:

Article Title: Characterization of the differentially methylated region of the Impact gene that exhibits Glires-specific imprinting
Article Snippet: The first round of PCR was performed using primers 5'- ATG GCT GAR GDG GAM KYA GGG A -3' (forward) and 5'- CAA AGT GTC CAT TTG GGG TCA TC -3' (reverse). .. PCR products were treated with exonuclease I and shrimp alkaline phosphatase (Amersham, London, UK) for subsequent direct sequencing.

DNA Extraction:

Article Title: Major pathologic response and RAD51 predict survival in lung cancer patients receiving neoadjuvant chemotherapy
Article Snippet: Paragraph title: DNA extraction and mutation analysis ... For direct sequencing, all PCR amplification products were incubated using exonuclease I and shrimp alkaline phosphatase (Amersham Biosciences, Piscataway, NJ) and sequenced by the MD Anderson Core Sequencing and Microarray Facility.

Article Title: Root-associated fungal communities in three Pyroleae species and their mycobiont sharing with surrounding trees in subalpine coniferous forests on Mount Fuji, Japan
Article Snippet: DNA extraction and molecular identification followed that described elsewhere (Miyamoto et al. ). .. Amplification products were purified using a PCR clean-up kit containing exonuclease I and shrimp alkaline phosphatase (GE Healthcare, Hertfordshire, UK).

Article Title: Epidemiology of Theileria bicornis among black and white rhinoceros metapopulation in Kenya
Article Snippet: Paragraph title: DNA isolation and PCR amplification ... PCR products were purified for direct sequencing by enzymatic treatment using exonuclease I and shrimp alkaline phosphatase (PCR Product Presequencing Kit, Amersham).

Article Title: Cox-2 and IL-10 Polymorphisms and Association with Squamous Cell Carcinoma of The Head and Neck in a Korean Sample
Article Snippet: We performed DNA extraction from peripheral blood using the Wizard™ Genomic DNA purification kit (Promega, Madison, WI, USA). .. To clean-up the primer extension reaction products, 1 U shrimp alkaline phosphatase (Amersham Life Science, Cleveland, Ohio, USA) was added to the reaction mixture, and the mixture was incubated at 37℃ for one hour, followed by 15 min at 72℃ for enzyme inactivation.

Article Title: The conserved carboxyl domain of MorC, an inner membrane protein of Aggregatibacter actinomycetemcomitans, is essential for membrane function
Article Snippet: The cassette was ligated with pGP704 that had been digested with EcoRV and treated with shrimp alkaline phosphatase (Amersham Life Sciences, Buckinghamshire, UK). .. The resulting plasmid, pVT1460, was used as the template for inverse PCR to delete the β-lactamase gene as described previously ( ).

Mutagenesis:

Article Title: Major pathologic response and RAD51 predict survival in lung cancer patients receiving neoadjuvant chemotherapy
Article Snippet: Paragraph title: DNA extraction and mutation analysis ... For direct sequencing, all PCR amplification products were incubated using exonuclease I and shrimp alkaline phosphatase (Amersham Biosciences, Piscataway, NJ) and sequenced by the MD Anderson Core Sequencing and Microarray Facility.

Article Title: Nutlin-3, the small-molecule inhibitor of MDM2, promotes senescence and radiosensitises laryngeal carcinoma cells harbouring wild-type p53
Article Snippet: Paragraph title: TP53 gene mutation analysis ... Residual primers and dNTPs were removed by exonuclease I and shrimp alkaline phosphatase (ExoSAP-IT, GE Healthcare, Little Chalfont, UK).

Article Title: DNA damage predicts prognosis and treatment response in colorectal liver metastases superior to immunogenic cell death and T cells
Article Snippet: Paragraph title: Analysis of mutation status ... Excess of primers and deoxynucleotides (dNTPs) was removed by incubation of 5 µL PCR product with 2.5 U exonuclease I (GE Healthcare Life Sciences, Vienna, Austria) and 2.5 U shrimp alkaline phosphatase (SAP; GE Healthcare Life Sciences) at 37°C for 1 h. Enzymes were further heat inactivated at 70°C for 15 min, following sequence analysis with 1-2 µL of the purified PCR product and 4 pmol primers using the BigDye™ Terminator Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer's instructions.

Article Title: The conserved carboxyl domain of MorC, an inner membrane protein of Aggregatibacter actinomycetemcomitans, is essential for membrane function
Article Snippet: An isogenic mutant of VT1169 with the morC gene deleted was generated by conjugation using a non-replicating broad host range plasmid ( ). .. The cassette was ligated with pGP704 that had been digested with EcoRV and treated with shrimp alkaline phosphatase (Amersham Life Sciences, Buckinghamshire, UK).

Size-exclusion Chromatography:

Article Title: Epidemiology of Theileria bicornis among black and white rhinoceros metapopulation in Kenya
Article Snippet: The secondary PCR (Thermocycler, Veriti, ABI) was initiated with an initial denaturation at 95°C for 30 sec, followed by 30 cycles of 1 min each at 94°C, annealing at 55°C for 30 s and extension at 72°C for 1 min. .. PCR products were purified for direct sequencing by enzymatic treatment using exonuclease I and shrimp alkaline phosphatase (PCR Product Presequencing Kit, Amersham).

Purification:

Article Title: Major pathologic response and RAD51 predict survival in lung cancer patients receiving neoadjuvant chemotherapy
Article Snippet: Subsequently, the biotinylated PCR products were purified and made into single‐stranded DNA to which a sequencing primer was annealed using a vacuum prep tool (Pyrosequencing, Inc., Westborough, MA). .. For direct sequencing, all PCR amplification products were incubated using exonuclease I and shrimp alkaline phosphatase (Amersham Biosciences, Piscataway, NJ) and sequenced by the MD Anderson Core Sequencing and Microarray Facility.

Article Title: Root-associated fungal communities in three Pyroleae species and their mycobiont sharing with surrounding trees in subalpine coniferous forests on Mount Fuji, Japan
Article Snippet: PCR products were assessed on 1.2% agarose gels (0.5× TBE buffer) using Gel Red (Biotium, Fremont, CA, USA) under UV light (Benchtop 2UV Transilluminator, UVP, Cambridge, UK). .. Amplification products were purified using a PCR clean-up kit containing exonuclease I and shrimp alkaline phosphatase (GE Healthcare, Hertfordshire, UK). .. Sanger sequencing was performed using the Big Dye Terminator version 3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA) and ITS1 or ITS4.

Article Title: Nutlin-3, the small-molecule inhibitor of MDM2, promotes senescence and radiosensitises laryngeal carcinoma cells harbouring wild-type p53
Article Snippet: Residual primers and dNTPs were removed by exonuclease I and shrimp alkaline phosphatase (ExoSAP-IT, GE Healthcare, Little Chalfont, UK). .. DNA sequencing was performed using DYEnamic ET Dye Terminators (GE Healthcare).

Article Title: Epidemiology of Theileria bicornis among black and white rhinoceros metapopulation in Kenya
Article Snippet: The PCR was completed with a final extension step of 72°C for 9 min. PCR products showing successful amplification on agarose gel analysis were directly sequenced for both strands. .. PCR products were purified for direct sequencing by enzymatic treatment using exonuclease I and shrimp alkaline phosphatase (PCR Product Presequencing Kit, Amersham). .. All DNA sequencing was carried out by direct cycle sequencing on both strands of purified PCR DNA products from PCR amplification.

Article Title: Bias in effect size of systemic lupus erythematosus susceptibility loci across Europe: a case-control study
Article Snippet: DNA samples were amplified in a multiplex PCR with the KAPA2G fast HotStart (Kapa Biosystems, Woburn, MA, USA) in a final volume of 10 μl (20 ng genomic DNA), using 3 mM MgCl2 and 0.2 μM each primer. .. Products were purified by Exo-SAP digestion with exonuclease I (Epicentre, Madison, WI, USA) and shrimp alkaline phosphatase (GE Healthcare, Barcelona, Spain). .. Subsequently, single-base extension reactions were performed with the SNaPshot Multiplex kit (Applied Biosystems, Foster City, CA, USA).

Article Title: DNA damage predicts prognosis and treatment response in colorectal liver metastases superior to immunogenic cell death and T cells
Article Snippet: Briefly, genomic DNA was extracted from tissue blocks and exon 2 and 3 of the KRAS gene and exon 15 of the BRAF gene were polymerase chain reaction (PCR) amplified with AmpliTaq Gold® DNA polymerase (Applied Biosystems, Fisher Scientific, Vienna, Austria) and corresponding oligonucleotide primers ( Table ). .. Excess of primers and deoxynucleotides (dNTPs) was removed by incubation of 5 µL PCR product with 2.5 U exonuclease I (GE Healthcare Life Sciences, Vienna, Austria) and 2.5 U shrimp alkaline phosphatase (SAP; GE Healthcare Life Sciences) at 37°C for 1 h. Enzymes were further heat inactivated at 70°C for 15 min, following sequence analysis with 1-2 µL of the purified PCR product and 4 pmol primers using the BigDye™ Terminator Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer's instructions. .. Excess of BigDye™ Terminator nucleotides was removed by centrifugation with Centri-Sep™ Spin Columns (Invitrogen, Fisher Scientific, Vienna, Austria).

Article Title: DNMT3A Mutations in Patients with Acute Myeloid Leukemia in South Brazil
Article Snippet: The extracted DNA was amplified by PCR at the DNMT3A exons 19, 20, 21, 22, and 23, with primers described by Thol et al. [ ] ( ). .. After electrophoresis on 1.5 agarose gel, PCR products were subjected to purification using Exonuclease I and Shrimp Alkaline Phosphatase (EXO-SAP, GE Healthcare) and then sequenced. .. Samples were sequenced at the Unidade de Análises Moleculares e de Proteínas (Centro de Pesquisa Experimental, HCPA) using ABI 3500 Genetic Analyzer with 50 cm capillaries and POP7 polymer (Applied Biosystems).

Article Title: Identification and Genotyping of Mycobacterium tuberculosis Complex Species by Use of a SNaPshot Minisequencing-Based Assay
Article Snippet: Paragraph title: Multiplex SBE reactions and purification of extension products. ... Extension was performed for 25 cycles of denaturation at 96°C for 10 s, annealing at 50°C for 5 s, and extension at 60°C for 30 s. Unincorporated ddNTPs were removed by addition of 1 U of shrimp alkaline phosphatase (GE Healthcare, Little Chalfont, United Kingdom) to the SBE mixtures and incubation at 37°C for 1 h, followed by incubation at 75°C for 15 min.

Article Title: The conserved carboxyl domain of MorC, an inner membrane protein of Aggregatibacter actinomycetemcomitans, is essential for membrane function
Article Snippet: The cassette was ligated with pGP704 that had been digested with EcoRV and treated with shrimp alkaline phosphatase (Amersham Life Sciences, Buckinghamshire, UK). .. The resulting plasmid, pVT1460, was used as the template for inverse PCR to delete the β-lactamase gene as described previously ( ).

Article Title: Clinical relevance of KRAS mutation detection in metastatic colorectal cancer treated by Cetuximab plus chemotherapy
Article Snippet: After purification using gel extraction kit, PCR-amplified KRAS exon 2 was analysed for the presence of KRAS mutations at nucleotides c.34, c.35, c.37 and c.38, using the ABI PRISM SNaPshot Multiplex kit (Applied Biosystems, Foster City, CA, USA) and four primers including at their 5′ end, an additional tail allowing their simultaneous detection. .. Cycling conditions were 25 cycles of rapid thermal ramp to 96°C, 96°C for 10 s; rapid thermal ramp to 50°C, 50°C for 5 s; and rapid thermal ramp to 60°C and 60°C for 30 s. SNaPshot products were then treated 1 h at 37°C with 3 U of shrimp alkaline phosphatase (Amersham Biosciences/GE Healthcare Europe GmbH, Saclay, France).

Polymerase Chain Reaction:

Article Title: Major pathologic response and RAD51 predict survival in lung cancer patients receiving neoadjuvant chemotherapy
Article Snippet: The EGFR primers used were as follows: exon 19: forward: 5′‐TGGTAACATCCACCCAGATC‐3′, reverse: 5′‐ATGAGAAAAGGTGGGCCTGA ‐3′; exon 21: forward: 5′‐CTCAGAGCCTGGCATGAACAT‐3′, reverse: 5′‐CAATACAGCTAGTGGGAAGGC‐3′. .. For direct sequencing, all PCR amplification products were incubated using exonuclease I and shrimp alkaline phosphatase (Amersham Biosciences, Piscataway, NJ) and sequenced by the MD Anderson Core Sequencing and Microarray Facility. .. Immunohistochemical staining for biomarkers was performed as described previously .

Article Title: Antitumor activity of pan‐ HER inhibitors in HER2‐positive gastric cancer, et al. Antitumor activity of pan‐HER inhibitors in HER2‐positive gastric cancer
Article Snippet: 2.7 The direct sequencing of exon 8, the transmembrane domain (exon 17), and the kinase domain (exons 18‐24) of HER2 was carried out for each of the 12 cell lines and 123 primary gastric cancer samples. .. The sequences of the primers were the same as previously reported., The detailed PCR protocol has been previously reported, and all the PCR products were incubated using exonuclease I and shrimp alkaline phosphatase (Amersham Biosciences). .. DNA sequence alterations were evaluated using MutationTaster2.

Article Title: Root-associated fungal communities in three Pyroleae species and their mycobiont sharing with surrounding trees in subalpine coniferous forests on Mount Fuji, Japan
Article Snippet: PCR products were assessed on 1.2% agarose gels (0.5× TBE buffer) using Gel Red (Biotium, Fremont, CA, USA) under UV light (Benchtop 2UV Transilluminator, UVP, Cambridge, UK). .. Amplification products were purified using a PCR clean-up kit containing exonuclease I and shrimp alkaline phosphatase (GE Healthcare, Hertfordshire, UK). .. Sanger sequencing was performed using the Big Dye Terminator version 3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA) and ITS1 or ITS4.

Article Title: Nutlin-3, the small-molecule inhibitor of MDM2, promotes senescence and radiosensitises laryngeal carcinoma cells harbouring wild-type p53
Article Snippet: The PCR primers were designed to include the entire exon-coding sequence and exon–intron junctions (Primer3 v0.4.0, ) as summarised in Supplementary Data Table 1. .. Residual primers and dNTPs were removed by exonuclease I and shrimp alkaline phosphatase (ExoSAP-IT, GE Healthcare, Little Chalfont, UK).

Article Title: Epidemiology of Theileria bicornis among black and white rhinoceros metapopulation in Kenya
Article Snippet: The PCR was completed with a final extension step of 72°C for 9 min. PCR products showing successful amplification on agarose gel analysis were directly sequenced for both strands. .. PCR products were purified for direct sequencing by enzymatic treatment using exonuclease I and shrimp alkaline phosphatase (PCR Product Presequencing Kit, Amersham). .. All DNA sequencing was carried out by direct cycle sequencing on both strands of purified PCR DNA products from PCR amplification.

Article Title: Exposure to Polycyclic Aromatic Hydrocarbons Among Never Smokers in Golestan Province, Iran, an Area of High Incidence of Esophageal Cancer - a Cross-Sectional Study with Repeated Measurement of Urinary 1-OHPG in Two Seasons
Article Snippet: The samples were incubated at 37°C (45 min) with 4 μl Exo-SAP-IT (Amersham, Roosendaal, the Netherlands) to degrade deoxynucleotide triphosphates and PCR primers. .. Following SBE, the samples were incubated at 37°C (1 h) with 1 unit shrimp alkaline phosphatase (Amersham) to degrade the unincorporated dideoxynucleotide triphosphates.

Article Title: Bias in effect size of systemic lupus erythematosus susceptibility loci across Europe: a case-control study
Article Snippet: DNA samples were amplified in a multiplex PCR with the KAPA2G fast HotStart (Kapa Biosystems, Woburn, MA, USA) in a final volume of 10 μl (20 ng genomic DNA), using 3 mM MgCl2 and 0.2 μM each primer. .. Products were purified by Exo-SAP digestion with exonuclease I (Epicentre, Madison, WI, USA) and shrimp alkaline phosphatase (GE Healthcare, Barcelona, Spain).

Article Title: Human and Murine Clonal CD8+ T Cell Expansions Arise during Tuberculosis Because of TCR Selection
Article Snippet: Paragraph title: Single cell sorting and single cell PCR ... For TCR product sequencing, a total of 12 μl of the products from the second round of the nested PCR amplification was combined with 1.5 μl of 10X shrimp alkaline phosphatase reaction buffer (200 mM Tris-HCl (pH 8.0) and 100 mM MgCl2), 1 U of shrimp alkaline phosphatase (Amersham Biosciences), and 1 U of exonuclease I (New England Biolabs), and water to total 15 μl.

Article Title: DNA damage predicts prognosis and treatment response in colorectal liver metastases superior to immunogenic cell death and T cells
Article Snippet: Briefly, genomic DNA was extracted from tissue blocks and exon 2 and 3 of the KRAS gene and exon 15 of the BRAF gene were polymerase chain reaction (PCR) amplified with AmpliTaq Gold® DNA polymerase (Applied Biosystems, Fisher Scientific, Vienna, Austria) and corresponding oligonucleotide primers ( Table ). .. Excess of primers and deoxynucleotides (dNTPs) was removed by incubation of 5 µL PCR product with 2.5 U exonuclease I (GE Healthcare Life Sciences, Vienna, Austria) and 2.5 U shrimp alkaline phosphatase (SAP; GE Healthcare Life Sciences) at 37°C for 1 h. Enzymes were further heat inactivated at 70°C for 15 min, following sequence analysis with 1-2 µL of the purified PCR product and 4 pmol primers using the BigDye™ Terminator Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer's instructions. .. Excess of BigDye™ Terminator nucleotides was removed by centrifugation with Centri-Sep™ Spin Columns (Invitrogen, Fisher Scientific, Vienna, Austria).

Article Title: Contrasting patterns of RUNX2 repeat variations are associated with palate shape in phyllostomid bats and New World primates
Article Snippet: The polymerase chain reaction (PCR) was carried out to amplify the target RUNX2 exon, using primers and conditions described by Pointer et al ., standardising the PCR conditions for the different species surveyed. .. Shrimp alkaline phosphatase and exonuclease I enzymes (GE Healthcare, Chicago, IL, USA) were used to purify the PCR products. .. Amplicons were sequenced in an ABI3730xl (Applied Biosystems Inc., Foster City, CA, USA) sequencer, using the same primers employed in the PCR for both DNA strands.

Article Title: DNMT3A Mutations in Patients with Acute Myeloid Leukemia in South Brazil
Article Snippet: The extracted DNA was amplified by PCR at the DNMT3A exons 19, 20, 21, 22, and 23, with primers described by Thol et al. [ ] ( ). .. After electrophoresis on 1.5 agarose gel, PCR products were subjected to purification using Exonuclease I and Shrimp Alkaline Phosphatase (EXO-SAP, GE Healthcare) and then sequenced. .. Samples were sequenced at the Unidade de Análises Moleculares e de Proteínas (Centro de Pesquisa Experimental, HCPA) using ABI 3500 Genetic Analyzer with 50 cm capillaries and POP7 polymer (Applied Biosystems).

Article Title: Identification and Genotyping of Mycobacterium tuberculosis Complex Species by Use of a SNaPshot Minisequencing-Based Assay
Article Snippet: Each SBE reaction was carried out in a 10 μl final volume containing 4 μl of SNaPshot multiplex ready reaction mixture (AB), 20 mM ammonium sulfate, 3 μl cleaned PCR products, and 0.13 to 0.58 μM each minisequencing primer. .. Extension was performed for 25 cycles of denaturation at 96°C for 10 s, annealing at 50°C for 5 s, and extension at 60°C for 30 s. Unincorporated ddNTPs were removed by addition of 1 U of shrimp alkaline phosphatase (GE Healthcare, Little Chalfont, United Kingdom) to the SBE mixtures and incubation at 37°C for 1 h, followed by incubation at 75°C for 15 min.

Article Title: Cox-2 and IL-10 Polymorphisms and Association with Squamous Cell Carcinoma of The Head and Neck in a Korean Sample
Article Snippet: We performed single base extension (SBE) for genetic analysis of all SNPs, except for COX-2 +6365T > C. The polymerase chain reactions (PCR) included primers (1.25 pM each), 5 ng genomic DNA, 250 µM dNTPs and 0.15 U Taq DNA polymerase (Applied Biosystems, Foster City, CA, USA) and were run using the GeneAmp PCR System 9700 Thermocycler (Applied Biosystems). .. To clean-up the primer extension reaction products, 1 U shrimp alkaline phosphatase (Amersham Life Science, Cleveland, Ohio, USA) was added to the reaction mixture, and the mixture was incubated at 37℃ for one hour, followed by 15 min at 72℃ for enzyme inactivation.

Article Title: Characterization of the differentially methylated region of the Impact gene that exhibits Glires-specific imprinting
Article Snippet: Both PCR reactions were performed in the presence of 3.5% dimethyl sulfoxide (DMSO). .. PCR products were treated with exonuclease I and shrimp alkaline phosphatase (Amersham, London, UK) for subsequent direct sequencing. .. Sequence data from this article has been deposited as [GenBank: EF470590 - EF470605 ].

Article Title: Clinical relevance of KRAS mutation detection in metastatic colorectal cancer treated by Cetuximab plus chemotherapy
Article Snippet: The multiplex SNaPshot reaction was performed in a final volume of 10 μ l, containing one-fifth of the PCR reaction, 2.5 μ l of the SNaPshot Multiplex Ready Reaction Mix, 1 μ l of sequencing buffer from the Big Dye V3.1 Terminator Kit and SNaPshot primers at a concentration of 0.02–0.05 μ M . .. Cycling conditions were 25 cycles of rapid thermal ramp to 96°C, 96°C for 10 s; rapid thermal ramp to 50°C, 50°C for 5 s; and rapid thermal ramp to 60°C and 60°C for 30 s. SNaPshot products were then treated 1 h at 37°C with 3 U of shrimp alkaline phosphatase (Amersham Biosciences/GE Healthcare Europe GmbH, Saclay, France).

Software:

Article Title: Nutlin-3, the small-molecule inhibitor of MDM2, promotes senescence and radiosensitises laryngeal carcinoma cells harbouring wild-type p53
Article Snippet: Residual primers and dNTPs were removed by exonuclease I and shrimp alkaline phosphatase (ExoSAP-IT, GE Healthcare, Little Chalfont, UK). .. Sequencing reactions were purified by gel filtration (genClean 96-Well Dye Terminator Removal Kit; Genetix Limited, New Milton, UK) before analysis by capillary electrophoresis (Megabace 1000 DNA sequencing system; GE Healthcare).

Article Title: Exposure to Polycyclic Aromatic Hydrocarbons Among Never Smokers in Golestan Province, Iran, an Area of High Incidence of Esophageal Cancer - a Cross-Sectional Study with Repeated Measurement of Urinary 1-OHPG in Two Seasons
Article Snippet: Genotyping was performed by single base extension (SBE) method using SnaPShot (Applied Biosystems, Nieuwerkerk, a.d. IJssel, the Netherlands), and primer 3 and Netprimer software were used to design SBE primers. .. Following SBE, the samples were incubated at 37°C (1 h) with 1 unit shrimp alkaline phosphatase (Amersham) to degrade the unincorporated dideoxynucleotide triphosphates.

Article Title: Contrasting patterns of RUNX2 repeat variations are associated with palate shape in phyllostomid bats and New World primates
Article Snippet: Shrimp alkaline phosphatase and exonuclease I enzymes (GE Healthcare, Chicago, IL, USA) were used to purify the PCR products. .. Amplicons were sequenced in an ABI3730xl (Applied Biosystems Inc., Foster City, CA, USA) sequencer, using the same primers employed in the PCR for both DNA strands.

FACS:

Article Title: Human and Murine Clonal CD8+ T Cell Expansions Arise during Tuberculosis Because of TCR Selection
Article Snippet: Paragraph title: Single cell sorting and single cell PCR ... For TCR product sequencing, a total of 12 μl of the products from the second round of the nested PCR amplification was combined with 1.5 μl of 10X shrimp alkaline phosphatase reaction buffer (200 mM Tris-HCl (pH 8.0) and 100 mM MgCl2), 1 U of shrimp alkaline phosphatase (Amersham Biosciences), and 1 U of exonuclease I (New England Biolabs), and water to total 15 μl.

Nested PCR:

Article Title: Human and Murine Clonal CD8+ T Cell Expansions Arise during Tuberculosis Because of TCR Selection
Article Snippet: Contamination was monitored for all steps (sorting, reverse transcriptase, and PCR), by leaving 16 control wells empty per 96-well PCR plate sorted. .. For TCR product sequencing, a total of 12 μl of the products from the second round of the nested PCR amplification was combined with 1.5 μl of 10X shrimp alkaline phosphatase reaction buffer (200 mM Tris-HCl (pH 8.0) and 100 mM MgCl2), 1 U of shrimp alkaline phosphatase (Amersham Biosciences), and 1 U of exonuclease I (New England Biolabs), and water to total 15 μl. .. The reaction was then heated to 37°C 30 min, 80°C 10 min, and cooled to 4°C, and the product was subjected to automated sequencing (Dana-Farber/Harvard Cancer Center High-Throughput Sequencing Core).

Article Title: Interhomolog polymorphism shapes meiotic crossover within the Arabidopsis RAC1 and RPP13 disease resistance genes
Article Snippet: Genomic DNA was extracted from hybrid F1 pollen (Col×Ler, Col×Wl or Col×Mh), and used for nested PCR amplifications using parental or crossover configurations of allele-specific oligonucleotide (ASO) primers ( and Tables). .. Amplified single crossover molecules were treated with exonuclease I (NEB, M0293) and shrimp alkaline phosphatase (Amersham, E70092), and then Sanger sequenced to identify recombination sites to the resolution of individual polymorphisms.

Chloramphenicol Acetyltransferase Assay:

Article Title: Characterization of the differentially methylated region of the Impact gene that exhibits Glires-specific imprinting
Article Snippet: The first round of PCR was performed using primers 5'- ATG GCT GAR GDG GAM KYA GGG A -3' (forward) and 5'- CAA AGT GTC CAT TTG GGG TCA TC -3' (reverse). .. PCR products were treated with exonuclease I and shrimp alkaline phosphatase (Amersham, London, UK) for subsequent direct sequencing.

Titration:

Article Title: Interhomolog polymorphism shapes meiotic crossover within the Arabidopsis RAC1 and RPP13 disease resistance genes
Article Snippet: The relative concentrations of parental (non-recombinant) and crossover (recombinant) molecules were estimated by titration [ – ]. .. Amplified single crossover molecules were treated with exonuclease I (NEB, M0293) and shrimp alkaline phosphatase (Amersham, E70092), and then Sanger sequenced to identify recombination sites to the resolution of individual polymorphisms.

Plasmid Preparation:

Article Title: The conserved carboxyl domain of MorC, an inner membrane protein of Aggregatibacter actinomycetemcomitans, is essential for membrane function
Article Snippet: The plasmid constructed for conjugation in A. actinomycetemcomitans is based on the mobilizable plasmid pGP704 ( ). .. The cassette was ligated with pGP704 that had been digested with EcoRV and treated with shrimp alkaline phosphatase (Amersham Life Sciences, Buckinghamshire, UK).

TaqMan Assay:

Article Title: Cox-2 and IL-10 Polymorphisms and Association with Squamous Cell Carcinoma of The Head and Neck in a Korean Sample
Article Snippet: To clean-up the primer extension reaction products, 1 U shrimp alkaline phosphatase (Amersham Life Science, Cleveland, Ohio, USA) was added to the reaction mixture, and the mixture was incubated at 37℃ for one hour, followed by 15 min at 72℃ for enzyme inactivation. .. To clean-up the primer extension reaction products, 1 U shrimp alkaline phosphatase (Amersham Life Science, Cleveland, Ohio, USA) was added to the reaction mixture, and the mixture was incubated at 37℃ for one hour, followed by 15 min at 72℃ for enzyme inactivation.

Multiplex Assay:

Article Title: Root-associated fungal communities in three Pyroleae species and their mycobiont sharing with surrounding trees in subalpine coniferous forests on Mount Fuji, Japan
Article Snippet: The internal transcribed spacer (ITS) regions of fungal rDNA were amplified by polymerase chain reaction (PCR) using the forward primer ITS1F and the reverse primers ITS4, LR21, LR22, and LBW with a Multiplex PCR kit (QIAGEN, Hilden, Germany), following the manufacturer’s instructions. .. Amplification products were purified using a PCR clean-up kit containing exonuclease I and shrimp alkaline phosphatase (GE Healthcare, Hertfordshire, UK).

Article Title: Bias in effect size of systemic lupus erythematosus susceptibility loci across Europe: a case-control study
Article Snippet: DNA samples were amplified in a multiplex PCR with the KAPA2G fast HotStart (Kapa Biosystems, Woburn, MA, USA) in a final volume of 10 μl (20 ng genomic DNA), using 3 mM MgCl2 and 0.2 μM each primer. .. Products were purified by Exo-SAP digestion with exonuclease I (Epicentre, Madison, WI, USA) and shrimp alkaline phosphatase (GE Healthcare, Barcelona, Spain).

Article Title: Identification and Genotyping of Mycobacterium tuberculosis Complex Species by Use of a SNaPshot Minisequencing-Based Assay
Article Snippet: Paragraph title: Multiplex SBE reactions and purification of extension products. ... Extension was performed for 25 cycles of denaturation at 96°C for 10 s, annealing at 50°C for 5 s, and extension at 60°C for 30 s. Unincorporated ddNTPs were removed by addition of 1 U of shrimp alkaline phosphatase (GE Healthcare, Little Chalfont, United Kingdom) to the SBE mixtures and incubation at 37°C for 1 h, followed by incubation at 75°C for 15 min.

Article Title: Clinical relevance of KRAS mutation detection in metastatic colorectal cancer treated by Cetuximab plus chemotherapy
Article Snippet: Paragraph title: SNaPshot multiplex assay ... Cycling conditions were 25 cycles of rapid thermal ramp to 96°C, 96°C for 10 s; rapid thermal ramp to 50°C, 50°C for 5 s; and rapid thermal ramp to 60°C and 60°C for 30 s. SNaPshot products were then treated 1 h at 37°C with 3 U of shrimp alkaline phosphatase (Amersham Biosciences/GE Healthcare Europe GmbH, Saclay, France).

Recombinant:

Article Title: Interhomolog polymorphism shapes meiotic crossover within the Arabidopsis RAC1 and RPP13 disease resistance genes
Article Snippet: The relative concentrations of parental (non-recombinant) and crossover (recombinant) molecules were estimated by titration [ – ]. .. Amplified single crossover molecules were treated with exonuclease I (NEB, M0293) and shrimp alkaline phosphatase (Amersham, E70092), and then Sanger sequenced to identify recombination sites to the resolution of individual polymorphisms.

Agarose Gel Electrophoresis:

Article Title: Epidemiology of Theileria bicornis among black and white rhinoceros metapopulation in Kenya
Article Snippet: PCR products were purified for direct sequencing by enzymatic treatment using exonuclease I and shrimp alkaline phosphatase (PCR Product Presequencing Kit, Amersham). .. PCR products were purified for direct sequencing by enzymatic treatment using exonuclease I and shrimp alkaline phosphatase (PCR Product Presequencing Kit, Amersham).

Article Title: DNMT3A Mutations in Patients with Acute Myeloid Leukemia in South Brazil
Article Snippet: The extracted DNA was amplified by PCR at the DNMT3A exons 19, 20, 21, 22, and 23, with primers described by Thol et al. [ ] ( ). .. After electrophoresis on 1.5 agarose gel, PCR products were subjected to purification using Exonuclease I and Shrimp Alkaline Phosphatase (EXO-SAP, GE Healthcare) and then sequenced. .. Samples were sequenced at the Unidade de Análises Moleculares e de Proteínas (Centro de Pesquisa Experimental, HCPA) using ABI 3500 Genetic Analyzer with 50 cm capillaries and POP7 polymer (Applied Biosystems).

Concentration Assay:

Article Title: Human and Murine Clonal CD8+ T Cell Expansions Arise during Tuberculosis Because of TCR Selection
Article Snippet: For the second round of the nested reaction, 2 μL of the first reaction were combined with 18 μL of Taq buffer (50 mM KCl, 10 mM Tris-HCl (pH 8.3), and 2.5 mM MgCl2), 500 μM dNTP, 0.6 U of Taq polymerase, 50 μM of TRACint - or TRBCint -specific primer for the constant region and an oligonucleotide mixture of 23 TRAVint or 19 TRBVint primers (each 50 μM final concentration). .. For TCR product sequencing, a total of 12 μl of the products from the second round of the nested PCR amplification was combined with 1.5 μl of 10X shrimp alkaline phosphatase reaction buffer (200 mM Tris-HCl (pH 8.0) and 100 mM MgCl2), 1 U of shrimp alkaline phosphatase (Amersham Biosciences), and 1 U of exonuclease I (New England Biolabs), and water to total 15 μl.

Article Title: Clinical relevance of KRAS mutation detection in metastatic colorectal cancer treated by Cetuximab plus chemotherapy
Article Snippet: The multiplex SNaPshot reaction was performed in a final volume of 10 μ l, containing one-fifth of the PCR reaction, 2.5 μ l of the SNaPshot Multiplex Ready Reaction Mix, 1 μ l of sequencing buffer from the Big Dye V3.1 Terminator Kit and SNaPshot primers at a concentration of 0.02–0.05 μ M . .. Cycling conditions were 25 cycles of rapid thermal ramp to 96°C, 96°C for 10 s; rapid thermal ramp to 50°C, 50°C for 5 s; and rapid thermal ramp to 60°C and 60°C for 30 s. SNaPshot products were then treated 1 h at 37°C with 3 U of shrimp alkaline phosphatase (Amersham Biosciences/GE Healthcare Europe GmbH, Saclay, France).

DNA Purification:

Article Title: Cox-2 and IL-10 Polymorphisms and Association with Squamous Cell Carcinoma of The Head and Neck in a Korean Sample
Article Snippet: We performed DNA extraction from peripheral blood using the Wizard™ Genomic DNA purification kit (Promega, Madison, WI, USA). .. To clean-up the primer extension reaction products, 1 U shrimp alkaline phosphatase (Amersham Life Science, Cleveland, Ohio, USA) was added to the reaction mixture, and the mixture was incubated at 37℃ for one hour, followed by 15 min at 72℃ for enzyme inactivation.

Marker:

Article Title: The conserved carboxyl domain of MorC, an inner membrane protein of Aggregatibacter actinomycetemcomitans, is essential for membrane function
Article Snippet: The kanamycin resistance gene from pUC-4k (Pharmacia, Kalamazoo, MI) was used as a selective marker in place of β-lactamase. .. The cassette was ligated with pGP704 that had been digested with EcoRV and treated with shrimp alkaline phosphatase (Amersham Life Sciences, Buckinghamshire, UK).

Gel Extraction:

Article Title: Clinical relevance of KRAS mutation detection in metastatic colorectal cancer treated by Cetuximab plus chemotherapy
Article Snippet: After purification using gel extraction kit, PCR-amplified KRAS exon 2 was analysed for the presence of KRAS mutations at nucleotides c.34, c.35, c.37 and c.38, using the ABI PRISM SNaPshot Multiplex kit (Applied Biosystems, Foster City, CA, USA) and four primers including at their 5′ end, an additional tail allowing their simultaneous detection. .. Cycling conditions were 25 cycles of rapid thermal ramp to 96°C, 96°C for 10 s; rapid thermal ramp to 50°C, 50°C for 5 s; and rapid thermal ramp to 60°C and 60°C for 30 s. SNaPshot products were then treated 1 h at 37°C with 3 U of shrimp alkaline phosphatase (Amersham Biosciences/GE Healthcare Europe GmbH, Saclay, France).

Homologous Recombination:

Article Title: The conserved carboxyl domain of MorC, an inner membrane protein of Aggregatibacter actinomycetemcomitans, is essential for membrane function
Article Snippet: Therefore, it was necessary to develop a morC deletion strain of A. actinomycetemcomitans to eliminate homologous recombination of the truncated gene. .. The cassette was ligated with pGP704 that had been digested with EcoRV and treated with shrimp alkaline phosphatase (Amersham Life Sciences, Buckinghamshire, UK).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 75
    GE Healthcare shrimp alkaline phosphatase
    Shrimp Alkaline Phosphatase, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 75/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrimp alkaline phosphatase/product/GE Healthcare
    Average 75 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    shrimp alkaline phosphatase - by Bioz Stars, 2019-12
    75/100 stars
      Buy from Supplier

    90
    GE Healthcare exonuclease i shrimp alkaline phosphatase
    Exonuclease I Shrimp Alkaline Phosphatase, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 90/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/exonuclease i shrimp alkaline phosphatase/product/GE Healthcare
    Average 90 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    exonuclease i shrimp alkaline phosphatase - by Bioz Stars, 2019-12
    90/100 stars
      Buy from Supplier

    Image Search Results