shrimp alkaline phosphatase affymetrics  (New England Biolabs)

Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Shrimp Alkaline Phosphatase (rSAP) - 2

    Catalog Number:
    Buy from Supplier

    Structured Review

    New England Biolabs shrimp alkaline phosphatase affymetrics alkaline phosphatase affymetrics/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    shrimp alkaline phosphatase affymetrics - by Bioz Stars, 2019-12
    99/100 stars


    Related Articles

    Clone Assay:

    Article Title: The Use of a Novel NanoLuc -Based Reporter Phage for the Detection of Escherichia coli O157:H7
    Article Snippet: The amplicon consisting of the translation initiation region was cloned into pGEM-T Easy Vector system I (Promega, WI) to create pNluc. .. Then pFSP138 was further dephosphorylated by shrimp alkaline phosphatase (New England biolab, MA) and ligated with pNluc at the Not I site to produce pNluc-Kan.

    Article Title: Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)
    Article Snippet: Paragraph title: Cloning of wheat miRNAs ... The RNA was dephosphorylated by alkaline phosphatase (New England Biolabs Inc., Beijing, China) and recovered by ethanol precipitation.

    Article Title: Differential Expression of miRNAs in Response to Topping in Flue-Cured Tobacco (Nicotiana tabacum) Roots
    Article Snippet: MiRNA cloning was performed as described previously by Sunkar and Zhu . .. The RNA was dephosphorylated using alkaline phosphatase (New England Biolabs, Beijing China) and recovered by ethanol precipitation.


    Article Title: Syntheses and characterizations of the in vivo replicative bypass and mutagenic properties of the minor-groove O2-alkylthymidine lesions
    Article Snippet: The PCR amplification was carried out with the use of Phusion high-fidelity DNA polymerase for the sequence region of interest in the ssM13 DNA template. .. For the determination of bypass efficiency, a portion of the above PCR products was digested with 10 U BbsI restriction endonuclease and 1 U shrimp alkaline phosphatase in 10 μl New England Biolabs (NEB) buffer 4 at 37°C for 30 min, followed by heating at 80°C for 20 min to deactivate the shrimp alkaline phosphatase.

    Article Title: The Use of a Novel NanoLuc -Based Reporter Phage for the Detection of Escherichia coli O157:H7
    Article Snippet: The amplicon consisting of the translation initiation region was cloned into pGEM-T Easy Vector system I (Promega, WI) to create pNluc. .. Then pFSP138 was further dephosphorylated by shrimp alkaline phosphatase (New England biolab, MA) and ligated with pNluc at the Not I site to produce pNluc-Kan.

    Article Title: Targeted recombination between homologous chromosomes for precise breeding in tomato
    Article Snippet: Paragraph title: DNA amplification and sequencing ... Then cleaned with Exonuclease I and Shrimp Alkaline Phosphatase (rSAP) (New England BioLabs).

    Article Title: A new species of Oxynetra from Mexico ( Hesperiidae, Pyrginae, Pyrrhopygini)
    Article Snippet: The following pairs of primers were used: sCOIF (forward, 5’-ATTCAACCAATCATAAAGATATTGG-3’) – Meg-mCOIR (reverse, 5’-CCAGTWCCTGYACCATTTTCTAC-3’), and Ven-mCOIF (forward, 5’-GCATTCCCTCGTATAAATAATA-3’) – sCOIR (reverse, 5’-TAAACTTCTGGATGTCCAAAAAATCA-3’), to amplify the barcode in two overlapping segments. .. The PCR reaction was cleaned by enzymatic digestion for the whole barcode amplifications, ID tag amplification, and sequences amplified in more than two segments, with 4 μl Shrimp Alkaline Phosphatase (20 U/μl) and 1 ul Exonuclease I (1 U/μl) from New England Biolabs. .. For sequences obtained in two segments, due to the frequent presence of primer dimers and other short non-specific PCR products, Agencourt Ampure XP beads or Invitrogen E-Gel EX Agarose Gels (followed by Zymo gel DNA recovery kit) were used to select the DNA products of expected length.

    Article Title: Investigating molecular crowding within nuclear pores using polarization-PALM
    Article Snippet: Then, mEos3.1 was PCR amplified from the mEos3.1 N1 vector using forward primer 5'- TTT ACGCGT GGAGGAAGTGCGATTAAGCCAGACATG-3' and reverse primer 5'- CTA ACGCG TTTATCGTCTGGCATTGTCAGGCAATCC-3', which includes a stop codon at the end of the coding sequence for mEos3. .. Plasmid pNup153 was digested with Mlu1 and the digested product was dephosphorylated by shrimp alkaline phosphatase (rSAP, New England Biolabs, Ipswich, MA).

    Article Title: Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075
    Article Snippet: Primers arpR Exp.1 (5′‐CATTTAAATCGCTTATAACAC‐3′) and arpR Exp.2 (5′‐TTATCGCTCTTATTCAAACT‐3′) were phosphorylated prior to PCR amplification to add 5′ phosphates with T4 polynucleotide kinase (New England Biolabs). .. The arpR fragment was gel purified and ligated (Fast‐Link Ligation Kit, Epicentre Biotechnologies) into pWH1266 that had been digested with ScaI and treated with recombinant shrimp alkaline phosphatase (rSAP, New England Biolabs).

    Article Title: Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)
    Article Snippet: The RNA was dephosphorylated by alkaline phosphatase (New England Biolabs Inc., Beijing, China) and recovered by ethanol precipitation. .. The RNA was dephosphorylated by alkaline phosphatase (New England Biolabs Inc., Beijing, China) and recovered by ethanol precipitation.

    High Throughput Screening Assay:

    Article Title: Targeted recombination between homologous chromosomes for precise breeding in tomato
    Article Snippet: High-throughput Sequencing was performed at the G-INCPM unit at the Weizmann Institute of Science with the Illumina HiSeq 2500 platform for 2 × 125 paired-end reads. .. Then cleaned with Exonuclease I and Shrimp Alkaline Phosphatase (rSAP) (New England BioLabs).

    Lambda DNA Preparation:

    Article Title: Transcriptional and epigenomic landscapes of CNS and non-CNS vascular endothelial cells
    Article Snippet: 20 ng of purified genomic DNA with 0.5% unmethylated lambda DNA spike-in (D1521, Promega) was bisulfite converted using the EZ DNA Methylation-Direct Kit (D5021, Zymo) following the product manual and was eluted in 10 µl M-Elution buffer. .. A 3 µl enzyme mix containing 2 µl of Exonuclease 1 (20U/µl, X8010L, Enzymatics) and 1 µl of Shrimp Alkaline Phosphatase (rSAP, M0371L, NEB) was added to the samples.

    Blocking Assay:

    Article Title: Down-regulation of p38 mitogen-activated protein kinase activation and proinflammatory cytokine production by mitogen-activated protein kinase inhibitors in inflammatory bowel disease
    Article Snippet: A synthetic blocker phospho-peptide corresponding to residues surrounding Thr180 and Tyr182 (Cell Signaling, Hertfordshire, UK) was used to specifically block the phospho-p38α Western blot reactivity. .. Alkaline phosphatase (CIP; New England BioLabs, Hertfordshire, UK) was used to release phosphate groups from phosphorylated tyrosine, serine and threonine residues in proteins to show that the antibodies identified only phosphorylated proteins.


    Article Title: Identification of miRs-143 and -145 that Is Associated with Bone Metastasis of Prostate Cancer and Involved in the Regulation of EMT
    Article Snippet: Paragraph title: Microarray analysis ... LMW-RNA was dephosphorylated by Alkaline Phosphatase (NEB) at the first following the protocol given by Wang H, et al. .


    Article Title: Syntheses and characterizations of the in vivo replicative bypass and mutagenic properties of the minor-groove O2-alkylthymidine lesions
    Article Snippet: For the determination of bypass efficiency, a portion of the above PCR products was digested with 10 U BbsI restriction endonuclease and 1 U shrimp alkaline phosphatase in 10 μl New England Biolabs (NEB) buffer 4 at 37°C for 30 min, followed by heating at 80°C for 20 min to deactivate the shrimp alkaline phosphatase. .. To the above mixture was subsequently added a 15 μl solution containing 5 mM DTT, 1 μM ATP (premixed with 1.66 pmol [γ-32 P]ATP) and 10 U T4 polynucleotide kinase, and the mixture was incubated at 37°C for 30 min, followed by heating at 65°C for 20 min to deactivate the T4 polynucleotide kinase.

    Article Title: A new species of Oxynetra from Mexico ( Hesperiidae, Pyrginae, Pyrrhopygini)
    Article Snippet: Legs, crumbs and pieces of muscle tissue from the thorax of dissected specimens (plucked from the abdomen attachment site), or a distal part of an abdomen (dropped into lysis buffer, and after overnight incubation at 56°C transferred into 10% KOH for genitalia dissection) were used to extract genomic DNA with the Macherey-Nagel ( MN ) NucleoSpin tissue kit following the manufacturer's protocol. .. The PCR reaction was cleaned by enzymatic digestion for the whole barcode amplifications, ID tag amplification, and sequences amplified in more than two segments, with 4 μl Shrimp Alkaline Phosphatase (20 U/μl) and 1 ul Exonuclease I (1 U/μl) from New England Biolabs.

    Article Title: Transcriptional and epigenomic landscapes of CNS and non-CNS vascular endothelial cells
    Article Snippet: The samples were incubated using a thermocycler with the following program: 4°C for 5 min, ramp up to 25°C at 0.1°C/s, 25°C for 5 min, ramp up to 37°C at 0.1°C/s, 37°C for 60 min, 4°C. .. A 3 µl enzyme mix containing 2 µl of Exonuclease 1 (20U/µl, X8010L, Enzymatics) and 1 µl of Shrimp Alkaline Phosphatase (rSAP, M0371L, NEB) was added to the samples.

    Article Title:
    Article Snippet: The eluted peptides were concentrated using a vacuum centrifuge. .. The peptides were reconstituted in 150 μl of 100 mm NaCl, 50 mm Tris-HCl, 10 mm MgCl2 , 1 mm dithiothreitol at pH 7.9 and incubated with 5 μl of Alkaline Phosphatase (New England Biolabs, Ipswhich, MA, USA) for 3 h at 37 °C. .. The resulting solution was then acidified using 50% TFA and the peptides desalted again using the reverse phase cartridges MicroSpin Column.

    Article Title: In-depth mapping of the mouse brain N-glycoproteome reveals widespread N-glycosylation of diverse brain proteins
    Article Snippet: Then, Na2 SO3 was added to a final concentration of 20 mM and incubated for 10 min. .. TiO2 : Digested peptides were first treated with alkaline phosphatase (New England Biolabs, Ipswich, MA) at 30°C for 2 h. The peptide mixture was suspended in a loading buffer containing 1 M glycolic acid, 80% CH3 CN, and 5% CF3 COOH.

    Article Title: A real-time PCR-based quantitative assay for 3-methylcytosine demethylase activity of ALKBH3
    Article Snippet: After incubating for 2 h at 45 °C, 5.5 µL of 1 m ammonium bicarbonate and 0.002 units of venom phosphodiesterase II (Wako) were added to the mixture, followed by additional incubation for 2 h at 25 °C. .. Thereafter, the mixture was incubated for 1 h at 37 °C with 0.5 units alkaline phosphatase (NEW ENGLAND BioLabs). .. HCl (1.3 µL, 0.1 N), H2 O (50 µL) and chloroform (20 µL) were then added.

    Article Title: Mechanistic insights into type I toxin antitoxin systems in Helicobacter pylori: the importance of mRNA folding in controlling toxin expression
    Article Snippet: AapA1 transcripts were first dephosphorylated by the CIP alkaline phosphatase (NEB) and then labeled with 10 pmol of γ32 P-ATP and T4 PNK enzyme (NEB). .. Then, RNA was extracted by phenol:chloroform, desalted and concentrated by ethanol precipitation, pellets were resuspended in 50 μl H2 O and stored at −20°C.


    Article Title: Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075
    Article Snippet: Paragraph title: Construction of an arpR expression plasmid ... The arpR fragment was gel purified and ligated (Fast‐Link Ligation Kit, Epicentre Biotechnologies) into pWH1266 that had been digested with ScaI and treated with recombinant shrimp alkaline phosphatase (rSAP, New England Biolabs).


    Article Title: Transcriptional and epigenomic landscapes of CNS and non-CNS vascular endothelial cells
    Article Snippet: DNA methylome libraries were prepared using a modified snmC-seq protocol adapted for bulk DNA samples ( ). .. A 3 µl enzyme mix containing 2 µl of Exonuclease 1 (20U/µl, X8010L, Enzymatics) and 1 µl of Shrimp Alkaline Phosphatase (rSAP, M0371L, NEB) was added to the samples.

    Western Blot:

    Article Title: Down-regulation of p38 mitogen-activated protein kinase activation and proinflammatory cytokine production by mitogen-activated protein kinase inhibitors in inflammatory bowel disease
    Article Snippet: Paragraph title: Western blotting ... Alkaline phosphatase (CIP; New England BioLabs, Hertfordshire, UK) was used to release phosphate groups from phosphorylated tyrosine, serine and threonine residues in proteins to show that the antibodies identified only phosphorylated proteins.


    Article Title: Identification of miRs-143 and -145 that Is Associated with Bone Metastasis of Prostate Cancer and Involved in the Regulation of EMT
    Article Snippet: LMW-RNA was dephosphorylated by Alkaline Phosphatase (NEB) at the first following the protocol given by Wang H, et al. . .. Then the dephosphorylated LMW-RNA was labeled with 500 ng 5′-phosphate-cytidyl-uridyl-cy3-3′ (Dharmacon) with 2 units T4 RNA ligase (NEB) .


    Article Title: Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075
    Article Snippet: Primers arpR Exp.1 (5′‐CATTTAAATCGCTTATAACAC‐3′) and arpR Exp.2 (5′‐TTATCGCTCTTATTCAAACT‐3′) were phosphorylated prior to PCR amplification to add 5′ phosphates with T4 polynucleotide kinase (New England Biolabs). .. The arpR fragment was gel purified and ligated (Fast‐Link Ligation Kit, Epicentre Biotechnologies) into pWH1266 that had been digested with ScaI and treated with recombinant shrimp alkaline phosphatase (rSAP, New England Biolabs). .. The ligation was electroporated into competent E. coli EC100D Transformax cells (Epicentre Biotechnologies).

    Article Title: Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)
    Article Snippet: The RNA was dephosphorylated by alkaline phosphatase (New England Biolabs Inc., Beijing, China) and recovered by ethanol precipitation. .. The RNA was dephosphorylated by alkaline phosphatase (New England Biolabs Inc., Beijing, China) and recovered by ethanol precipitation.


    Article Title: A new species of Oxynetra from Mexico ( Hesperiidae, Pyrginae, Pyrrhopygini)
    Article Snippet: Legs, crumbs and pieces of muscle tissue from the thorax of dissected specimens (plucked from the abdomen attachment site), or a distal part of an abdomen (dropped into lysis buffer, and after overnight incubation at 56°C transferred into 10% KOH for genitalia dissection) were used to extract genomic DNA with the Macherey-Nagel ( MN ) NucleoSpin tissue kit following the manufacturer's protocol. .. The PCR reaction was cleaned by enzymatic digestion for the whole barcode amplifications, ID tag amplification, and sequences amplified in more than two segments, with 4 μl Shrimp Alkaline Phosphatase (20 U/μl) and 1 ul Exonuclease I (1 U/μl) from New England Biolabs.


    Article Title: The Use of a Novel NanoLuc -Based Reporter Phage for the Detection of Escherichia coli O157:H7
    Article Snippet: In order to introduce a translation initiation region ( ) upstream of the nluc ORF, a second forward primer nluc-F′ paired with nluc-R was used to amplify the nluc-F and nluc-R amplicon. .. Then pFSP138 was further dephosphorylated by shrimp alkaline phosphatase (New England biolab, MA) and ligated with pNluc at the Not I site to produce pNluc-Kan.


    Article Title:
    Article Snippet: The peptides were reconstituted in 150 μl of 100 mm NaCl, 50 mm Tris-HCl, 10 mm MgCl2 , 1 mm dithiothreitol at pH 7.9 and incubated with 5 μl of Alkaline Phosphatase (New England Biolabs, Ipswhich, MA, USA) for 3 h at 37 °C. .. The concentration of each peptide sample was adjusted to 1 μg/μl (with 2% ACN, 0.5% FA) according to UV absorption at 280 nm measured using a NanoDrop ND-1000 photometer.


    Article Title: Genetic Abnormalities in a Calf with Congenital Increased Muscular Tonus
    Article Snippet: Shrimp alkaline phosphatase, New England BioLabs, Ipswich, MA USA

    Article Title: Mitochondrial ROS regulate oxidative damage and mitophagy but not age-related muscle fiber atrophy
    Article Snippet: DNA samples were digested to nucleosides by incubating the denatured DNA with nuclease P1 (5U) for 2 h at 37 °C in sodium acetate (20 mM) pH 5.2, followed with treatment of alkaline phosphatase (5U, New England Biolabs) for 1 h at 37 °C in Tris (100 mM), pH 7.5.

    DNA Sequencing:

    Article Title: A new species of Oxynetra from Mexico ( Hesperiidae, Pyrginae, Pyrrhopygini)
    Article Snippet: The PCR reaction was cleaned by enzymatic digestion for the whole barcode amplifications, ID tag amplification, and sequences amplified in more than two segments, with 4 μl Shrimp Alkaline Phosphatase (20 U/μl) and 1 ul Exonuclease I (1 U/μl) from New England Biolabs. .. The PCR reaction was cleaned by enzymatic digestion for the whole barcode amplifications, ID tag amplification, and sequences amplified in more than two segments, with 4 μl Shrimp Alkaline Phosphatase (20 U/μl) and 1 ul Exonuclease I (1 U/μl) from New England Biolabs.

    Article Title: Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075
    Article Snippet: The arpR fragment was gel purified and ligated (Fast‐Link Ligation Kit, Epicentre Biotechnologies) into pWH1266 that had been digested with ScaI and treated with recombinant shrimp alkaline phosphatase (rSAP, New England Biolabs). .. The ligation was electroporated into competent E. coli EC100D Transformax cells (Epicentre Biotechnologies).


    Article Title: Syntheses and characterizations of the in vivo replicative bypass and mutagenic properties of the minor-groove O2-alkylthymidine lesions
    Article Snippet: The PCR amplification was carried out with the use of Phusion high-fidelity DNA polymerase for the sequence region of interest in the ssM13 DNA template. .. For the determination of bypass efficiency, a portion of the above PCR products was digested with 10 U BbsI restriction endonuclease and 1 U shrimp alkaline phosphatase in 10 μl New England Biolabs (NEB) buffer 4 at 37°C for 30 min, followed by heating at 80°C for 20 min to deactivate the shrimp alkaline phosphatase.

    Article Title: Targeted recombination between homologous chromosomes for precise breeding in tomato
    Article Snippet: Paragraph title: DNA amplification and sequencing ... Then cleaned with Exonuclease I and Shrimp Alkaline Phosphatase (rSAP) (New England BioLabs).

    Article Title: A new species of Oxynetra from Mexico ( Hesperiidae, Pyrginae, Pyrrhopygini)
    Article Snippet: The PCR reaction was cleaned by enzymatic digestion for the whole barcode amplifications, ID tag amplification, and sequences amplified in more than two segments, with 4 μl Shrimp Alkaline Phosphatase (20 U/μl) and 1 ul Exonuclease I (1 U/μl) from New England Biolabs. .. The PCR reaction was cleaned by enzymatic digestion for the whole barcode amplifications, ID tag amplification, and sequences amplified in more than two segments, with 4 μl Shrimp Alkaline Phosphatase (20 U/μl) and 1 ul Exonuclease I (1 U/μl) from New England Biolabs.

    Article Title: Investigating molecular crowding within nuclear pores using polarization-PALM
    Article Snippet: Then, mEos3.1 was PCR amplified from the mEos3.1 N1 vector using forward primer 5'- TTT ACGCGT GGAGGAAGTGCGATTAAGCCAGACATG-3' and reverse primer 5'- CTA ACGCG TTTATCGTCTGGCATTGTCAGGCAATCC-3', which includes a stop codon at the end of the coding sequence for mEos3. .. Plasmid pNup153 was digested with Mlu1 and the digested product was dephosphorylated by shrimp alkaline phosphatase (rSAP, New England Biolabs, Ipswich, MA).

    Article Title: Transcriptional and epigenomic landscapes of CNS and non-CNS vascular endothelial cells
    Article Snippet: Paragraph title: Methylome sequencing ... A 3 µl enzyme mix containing 2 µl of Exonuclease 1 (20U/µl, X8010L, Enzymatics) and 1 µl of Shrimp Alkaline Phosphatase (rSAP, M0371L, NEB) was added to the samples.

    Article Title: Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075
    Article Snippet: 2.8 The full‐length arpR gene including 146 bp of sequence upstream from the GTG start codon and 71 bp downstream from the stop codon were amplified from AB5075 genomic DNA by PCR (Phusion Hot‐Start Polymerase, Thermo Scientific). .. The arpR fragment was gel purified and ligated (Fast‐Link Ligation Kit, Epicentre Biotechnologies) into pWH1266 that had been digested with ScaI and treated with recombinant shrimp alkaline phosphatase (rSAP, New England Biolabs).

    Article Title: Similar Albeit Not the Same: In-Depth Analysis of Proteoforms of Human Serum, Bovine Serum, and Recombinant Human Fetuin
    Article Snippet: Sequencing-grade trypsin was obtained from Promega (Madison, WI). .. Alkaline phosphatase was purchased from New England Biolabs (Ipswich, MA).

    Article Title: Differential Expression of miRNAs in Response to Topping in Flue-Cured Tobacco (Nicotiana tabacum) Roots
    Article Snippet: The RNA was dephosphorylated using alkaline phosphatase (New England Biolabs, Beijing China) and recovered by ethanol precipitation. .. The isolated small RNAs were then sequentially ligated to 5′- and 3′-chimeric oligonucleotide adapters, reversely transcribed, and amplified by PCR.

    Article Title: In-depth mapping of the mouse brain N-glycoproteome reveals widespread N-glycosylation of diverse brain proteins
    Article Snippet: After the coupling reaction, the resins were thoroughly washed thrice with the following sequence of solutions: 1.5 M NaCl, 80% CH3 CN, water, and 50 mM NH4 HCO3 . .. TiO2 : Digested peptides were first treated with alkaline phosphatase (New England Biolabs, Ipswich, MA) at 30°C for 2 h. The peptide mixture was suspended in a loading buffer containing 1 M glycolic acid, 80% CH3 CN, and 5% CF3 COOH.


    Article Title: Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075
    Article Snippet: Primers arpR Exp.1 (5′‐CATTTAAATCGCTTATAACAC‐3′) and arpR Exp.2 (5′‐TTATCGCTCTTATTCAAACT‐3′) were phosphorylated prior to PCR amplification to add 5′ phosphates with T4 polynucleotide kinase (New England Biolabs). .. The arpR fragment was gel purified and ligated (Fast‐Link Ligation Kit, Epicentre Biotechnologies) into pWH1266 that had been digested with ScaI and treated with recombinant shrimp alkaline phosphatase (rSAP, New England Biolabs). .. The ligation was electroporated into competent E. coli EC100D Transformax cells (Epicentre Biotechnologies).

    Article Title: Similar Albeit Not the Same: In-Depth Analysis of Proteoforms of Human Serum, Bovine Serum, and Recombinant Human Fetuin
    Article Snippet: hFet (alpha-2-HS glycoprotein; Uniprot Code: ), bFet (bovine fetuin; Uniprot Code: ), and rhFet (recombinant alpha-2-HS glycoprotein expressed in HEK293 cells), dithiothreitol (DTT), iodoacetamide (IAA), trifluoroacetic acid (TFA), ammonium bicarbonate (ABC), and ammonium acetate (AMAC) were purchased from Sigma-Aldrich (Steinheim, Germany). .. Alkaline phosphatase was purchased from New England Biolabs (Ipswich, MA).

    Article Title: A real-time PCR-based quantitative assay for 3-methylcytosine demethylase activity of ALKBH3
    Article Snippet: 2.4 After incubation with or without silkworm recombinant ALKBH3, the ssDNA oligo containing 3-meC was purified by ethanol-precipitation. .. Thereafter, the mixture was incubated for 1 h at 37 °C with 0.5 units alkaline phosphatase (NEW ENGLAND BioLabs).

    Molecular Weight:

    Article Title: Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)
    Article Snippet: About 100 μg of low molecular weight RNA was separated on a denaturing 15% polyacrylamide gel. .. The RNA was dephosphorylated by alkaline phosphatase (New England Biolabs Inc., Beijing, China) and recovered by ethanol precipitation.

    Article Title: Differential Expression of miRNAs in Response to Topping in Flue-Cured Tobacco (Nicotiana tabacum) Roots
    Article Snippet: Briefly, 0.5 M NaCl and 10% PEG8000 were used to precipitate and enrich RNAs with low molecular weight. .. The RNA was dephosphorylated using alkaline phosphatase (New England Biolabs, Beijing China) and recovered by ethanol precipitation.

    Nucleic Acid Electrophoresis:

    Article Title: Differential Expression of miRNAs in Response to Topping in Flue-Cured Tobacco (Nicotiana tabacum) Roots
    Article Snippet: After gel electrophoresis, small RNAs with 18–26 nt were excised from the gel and eluted with 0.4 M NaCl overnight at 4°C. .. The RNA was dephosphorylated using alkaline phosphatase (New England Biolabs, Beijing China) and recovered by ethanol precipitation.

    In Vivo:

    Article Title: Syntheses and characterizations of the in vivo replicative bypass and mutagenic properties of the minor-groove O2-alkylthymidine lesions
    Article Snippet: We employed the competitive replication and adduct bypass (CRAB) assay developed by Delaney et al. ( , ) to assess the bypass efficiencies of the O 2 -alkyldT lesions in vivo (Figure ). .. For the determination of bypass efficiency, a portion of the above PCR products was digested with 10 U BbsI restriction endonuclease and 1 U shrimp alkaline phosphatase in 10 μl New England Biolabs (NEB) buffer 4 at 37°C for 30 min, followed by heating at 80°C for 20 min to deactivate the shrimp alkaline phosphatase.

    RNA Sequencing Assay:

    Article Title: Differential Expression of miRNAs in Response to Topping in Flue-Cured Tobacco (Nicotiana tabacum) Roots
    Article Snippet: Paragraph title: RNA isolation and RNA sequencing ... The RNA was dephosphorylated using alkaline phosphatase (New England Biolabs, Beijing China) and recovered by ethanol precipitation.


    Article Title: Transcriptional and epigenomic landscapes of CNS and non-CNS vascular endothelial cells
    Article Snippet: 20 ng of purified genomic DNA with 0.5% unmethylated lambda DNA spike-in (D1521, Promega) was bisulfite converted using the EZ DNA Methylation-Direct Kit (D5021, Zymo) following the product manual and was eluted in 10 µl M-Elution buffer. .. A 3 µl enzyme mix containing 2 µl of Exonuclease 1 (20U/µl, X8010L, Enzymatics) and 1 µl of Shrimp Alkaline Phosphatase (rSAP, M0371L, NEB) was added to the samples.


    Article Title: Syntheses and characterizations of the in vivo replicative bypass and mutagenic properties of the minor-groove O2-alkylthymidine lesions
    Article Snippet: Paragraph title: Quantification of bypass efficiencies and mutation frequencies ... For the determination of bypass efficiency, a portion of the above PCR products was digested with 10 U BbsI restriction endonuclease and 1 U shrimp alkaline phosphatase in 10 μl New England Biolabs (NEB) buffer 4 at 37°C for 30 min, followed by heating at 80°C for 20 min to deactivate the shrimp alkaline phosphatase.

    Article Title: Investigating molecular crowding within nuclear pores using polarization-PALM
    Article Snippet: Plasmid pNup153 was digested with Mlu1 and the digested product was dephosphorylated by shrimp alkaline phosphatase (rSAP, New England Biolabs, Ipswich, MA). .. Plasmid pmEos2-Nup98, which produces mEos2-Nup98, was made identically.


    Article Title: The Use of a Novel NanoLuc -Based Reporter Phage for the Detection of Escherichia coli O157:H7
    Article Snippet: A kanamycin-resistance determinant isolated from EZ-Tn5TM < R6Kγori/KAN-2 > Tnp TransposomeTM kit (Epicentre Biotechonologies, WI) was inserted into pCR2.1 TOPO vector (Invitrogen, CA) to generate pFSP138. .. Then pFSP138 was further dephosphorylated by shrimp alkaline phosphatase (New England biolab, MA) and ligated with pNluc at the Not I site to produce pNluc-Kan.

    Article Title: Differential Expression of miRNAs in Response to Topping in Flue-Cured Tobacco (Nicotiana tabacum) Roots
    Article Snippet: Paragraph title: RNA isolation and RNA sequencing ... The RNA was dephosphorylated using alkaline phosphatase (New England Biolabs, Beijing China) and recovered by ethanol precipitation.

    Article Title: Identification of miRs-143 and -145 that Is Associated with Bone Metastasis of Prostate Cancer and Involved in the Regulation of EMT
    Article Snippet: Briefly, the low-molecular-weight RNA (LMW-RNA) was isolated using PEG solution precipitation method according to a previous protocol . .. LMW-RNA was dephosphorylated by Alkaline Phosphatase (NEB) at the first following the protocol given by Wang H, et al. .

    Article Title:
    Article Snippet: Paragraph title: Yeast Culture, Protein Isolation, Digestion, Phospho-enrichment, and Dephosphorylation ... The peptides were reconstituted in 150 μl of 100 mm NaCl, 50 mm Tris-HCl, 10 mm MgCl2 , 1 mm dithiothreitol at pH 7.9 and incubated with 5 μl of Alkaline Phosphatase (New England Biolabs, Ipswhich, MA, USA) for 3 h at 37 °C.


    Article Title: Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)
    Article Snippet: RNA oligonucleotides labeled at positions 18 and 26 were used as size standards. .. The RNA was dephosphorylated by alkaline phosphatase (New England Biolabs Inc., Beijing, China) and recovered by ethanol precipitation.

    Article Title: Differential Expression of miRNAs in Response to Topping in Flue-Cured Tobacco (Nicotiana tabacum) Roots
    Article Snippet: During gel electrophoresis, about 100 µg of total RNA was applied to the gel and two labeled RNA oligonucleotides, approximately 18 and 26 nt in length, were used as size standards. .. The RNA was dephosphorylated using alkaline phosphatase (New England Biolabs, Beijing China) and recovered by ethanol precipitation.

    Article Title: Identification of miRs-143 and -145 that Is Associated with Bone Metastasis of Prostate Cancer and Involved in the Regulation of EMT
    Article Snippet: LMW-RNA was dephosphorylated by Alkaline Phosphatase (NEB) at the first following the protocol given by Wang H, et al. . .. Then the dephosphorylated LMW-RNA was labeled with 500 ng 5′-phosphate-cytidyl-uridyl-cy3-3′ (Dharmacon) with 2 units T4 RNA ligase (NEB) .

    Article Title: Mechanistic insights into type I toxin antitoxin systems in Helicobacter pylori: the importance of mRNA folding in controlling toxin expression
    Article Snippet: For in vitro translation of the AapA1_FL and AapA1_Tr1 mRNAs, 0.05 to 1 μg of RNA was added to the E. coli S30 kit (Promega, #L1030) as previously described ( ). .. AapA1 transcripts were first dephosphorylated by the CIP alkaline phosphatase (NEB) and then labeled with 10 pmol of γ32 P-ATP and T4 PNK enzyme (NEB). .. Labeled RNA was purified on an 8% PAA containing 7 M urea 1X TBE and eluted overnight at 4°C under shaking in 750 μl elution buffer (0.1 M NaOAc pH 5.2, 0.1% SDS).


    Article Title: Five novel mutations in steroidogenic factor 1 (SF1, NR5A1) in 46,XY patients with severe underandrogenization but without adrenal insufficiency
    Article Snippet: Genomic DNA was extracted from peripheral blood leukocytes and exons 2–7 of the gene encoding SF1 (NR5A1 ) were PCR–amplified (primer sequences available on request). .. PCR products were purified using exonuclease 1 and shrimp alkaline phosphatase (New England Biolabs, Cambridge, UK; USB, Cleveland, OH) and sequenced using a V3 kit and 3130x analyzer (Applied Biosystems, Foster City, CA). .. DNA mutation numbering is based on GenBank reference DNA sequence NM_004959.3, with the A of the ATG initiation codon designated +1 ( ).

    Article Title: Syntheses and characterizations of the in vivo replicative bypass and mutagenic properties of the minor-groove O2-alkylthymidine lesions
    Article Snippet: The PCR products were purified by using Cycle Pure Kit. .. For the determination of bypass efficiency, a portion of the above PCR products was digested with 10 U BbsI restriction endonuclease and 1 U shrimp alkaline phosphatase in 10 μl New England Biolabs (NEB) buffer 4 at 37°C for 30 min, followed by heating at 80°C for 20 min to deactivate the shrimp alkaline phosphatase.

    Article Title: Transcriptional and epigenomic landscapes of CNS and non-CNS vascular endothelial cells
    Article Snippet: 20 ng of purified genomic DNA with 0.5% unmethylated lambda DNA spike-in (D1521, Promega) was bisulfite converted using the EZ DNA Methylation-Direct Kit (D5021, Zymo) following the product manual and was eluted in 10 µl M-Elution buffer. .. A 3 µl enzyme mix containing 2 µl of Exonuclease 1 (20U/µl, X8010L, Enzymatics) and 1 µl of Shrimp Alkaline Phosphatase (rSAP, M0371L, NEB) was added to the samples.

    Article Title: Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075
    Article Snippet: Primers arpR Exp.1 (5′‐CATTTAAATCGCTTATAACAC‐3′) and arpR Exp.2 (5′‐TTATCGCTCTTATTCAAACT‐3′) were phosphorylated prior to PCR amplification to add 5′ phosphates with T4 polynucleotide kinase (New England Biolabs). .. The arpR fragment was gel purified and ligated (Fast‐Link Ligation Kit, Epicentre Biotechnologies) into pWH1266 that had been digested with ScaI and treated with recombinant shrimp alkaline phosphatase (rSAP, New England Biolabs). .. The ligation was electroporated into competent E. coli EC100D Transformax cells (Epicentre Biotechnologies).

    Article Title: A real-time PCR-based quantitative assay for 3-methylcytosine demethylase activity of ALKBH3
    Article Snippet: 2.4 After incubation with or without silkworm recombinant ALKBH3, the ssDNA oligo containing 3-meC was purified by ethanol-precipitation. .. Thereafter, the mixture was incubated for 1 h at 37 °C with 0.5 units alkaline phosphatase (NEW ENGLAND BioLabs).

    Polymerase Chain Reaction:

    Article Title: Five novel mutations in steroidogenic factor 1 (SF1, NR5A1) in 46,XY patients with severe underandrogenization but without adrenal insufficiency
    Article Snippet: Genomic DNA was extracted from peripheral blood leukocytes and exons 2–7 of the gene encoding SF1 (NR5A1 ) were PCR–amplified (primer sequences available on request). .. PCR products were purified using exonuclease 1 and shrimp alkaline phosphatase (New England Biolabs, Cambridge, UK; USB, Cleveland, OH) and sequenced using a V3 kit and 3130x analyzer (Applied Biosystems, Foster City, CA). .. DNA mutation numbering is based on GenBank reference DNA sequence NM_004959.3, with the A of the ATG initiation codon designated +1 ( ).

    Article Title: Syntheses and characterizations of the in vivo replicative bypass and mutagenic properties of the minor-groove O2-alkylthymidine lesions
    Article Snippet: The PCR products were purified by using Cycle Pure Kit. .. For the determination of bypass efficiency, a portion of the above PCR products was digested with 10 U BbsI restriction endonuclease and 1 U shrimp alkaline phosphatase in 10 μl New England Biolabs (NEB) buffer 4 at 37°C for 30 min, followed by heating at 80°C for 20 min to deactivate the shrimp alkaline phosphatase. .. To the above mixture was subsequently added a 15 μl solution containing 5 mM DTT, 1 μM ATP (premixed with 1.66 pmol [γ-32 P]ATP) and 10 U T4 polynucleotide kinase, and the mixture was incubated at 37°C for 30 min, followed by heating at 65°C for 20 min to deactivate the T4 polynucleotide kinase.

    Article Title: The Use of a Novel NanoLuc -Based Reporter Phage for the Detection of Escherichia coli O157:H7
    Article Snippet: The same PCR cycling program was used as above, except that the annealing temperature of phase one was decreased from 68 °C to 61 °C and in phase two, the annealing temperature was held at 60 °C for 22 cycles. .. Then pFSP138 was further dephosphorylated by shrimp alkaline phosphatase (New England biolab, MA) and ligated with pNluc at the Not I site to produce pNluc-Kan.

    Article Title: Targeted recombination between homologous chromosomes for precise breeding in tomato
    Article Snippet: DNA samples for Sanger sequencing were amplified using REDTaq (SIGMA-ALDRICH) with 35 PCR cycles (for primers see ). .. Then cleaned with Exonuclease I and Shrimp Alkaline Phosphatase (rSAP) (New England BioLabs).

    Article Title: A new species of Oxynetra from Mexico ( Hesperiidae, Pyrginae, Pyrrhopygini)
    Article Snippet: The following pairs of primers were used: sCOIF (forward, 5’-ATTCAACCAATCATAAAGATATTGG-3’) – Meg-mCOIR (reverse, 5’-CCAGTWCCTGYACCATTTTCTAC-3’), and Ven-mCOIF (forward, 5’-GCATTCCCTCGTATAAATAATA-3’) – sCOIR (reverse, 5’-TAAACTTCTGGATGTCCAAAAAATCA-3’), to amplify the barcode in two overlapping segments. .. The PCR reaction was cleaned by enzymatic digestion for the whole barcode amplifications, ID tag amplification, and sequences amplified in more than two segments, with 4 μl Shrimp Alkaline Phosphatase (20 U/μl) and 1 ul Exonuclease I (1 U/μl) from New England Biolabs. .. For sequences obtained in two segments, due to the frequent presence of primer dimers and other short non-specific PCR products, Agencourt Ampure XP beads or Invitrogen E-Gel EX Agarose Gels (followed by Zymo gel DNA recovery kit) were used to select the DNA products of expected length.

    Article Title: Investigating molecular crowding within nuclear pores using polarization-PALM
    Article Snippet: Then, mEos3.1 was PCR amplified from the mEos3.1 N1 vector using forward primer 5'- TTT ACGCGT GGAGGAAGTGCGATTAAGCCAGACATG-3' and reverse primer 5'- CTA ACGCG TTTATCGTCTGGCATTGTCAGGCAATCC-3', which includes a stop codon at the end of the coding sequence for mEos3. .. Plasmid pNup153 was digested with Mlu1 and the digested product was dephosphorylated by shrimp alkaline phosphatase (rSAP, New England Biolabs, Ipswich, MA).

    Article Title: Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075
    Article Snippet: Primers arpR Exp.1 (5′‐CATTTAAATCGCTTATAACAC‐3′) and arpR Exp.2 (5′‐TTATCGCTCTTATTCAAACT‐3′) were phosphorylated prior to PCR amplification to add 5′ phosphates with T4 polynucleotide kinase (New England Biolabs). .. The arpR fragment was gel purified and ligated (Fast‐Link Ligation Kit, Epicentre Biotechnologies) into pWH1266 that had been digested with ScaI and treated with recombinant shrimp alkaline phosphatase (rSAP, New England Biolabs).

    Article Title: Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)
    Article Snippet: The RNA was dephosphorylated by alkaline phosphatase (New England Biolabs Inc., Beijing, China) and recovered by ethanol precipitation. .. The RNA was dephosphorylated by alkaline phosphatase (New England Biolabs Inc., Beijing, China) and recovered by ethanol precipitation.

    De-Phosphorylation Assay:

    Article Title:
    Article Snippet: Paragraph title: Yeast Culture, Protein Isolation, Digestion, Phospho-enrichment, and Dephosphorylation ... The peptides were reconstituted in 150 μl of 100 mm NaCl, 50 mm Tris-HCl, 10 mm MgCl2 , 1 mm dithiothreitol at pH 7.9 and incubated with 5 μl of Alkaline Phosphatase (New England Biolabs, Ipswhich, MA, USA) for 3 h at 37 °C.

    Chromatin Immunoprecipitation:

    Article Title: Identification of miRs-143 and -145 that Is Associated with Bone Metastasis of Prostate Cancer and Involved in the Regulation of EMT
    Article Snippet: Each miRNA microarray chip contained 924 probes in triplicate, corresponding to 677 human (including 122 predicted miRNAs), 461 mouse, and 292 rat miRNAs found in the miRNA Registry ( ; miRBase Release 10.0, 2007). .. LMW-RNA was dephosphorylated by Alkaline Phosphatase (NEB) at the first following the protocol given by Wang H, et al. .

    Liquid Chromatography:

    Article Title: A real-time PCR-based quantitative assay for 3-methylcytosine demethylase activity of ALKBH3
    Article Snippet: Paragraph title: Digestion of ssDNA oligo containing 3-meC demethylated by ALKBH3 to nucleosides for LC-MS/MS analysis ... Thereafter, the mixture was incubated for 1 h at 37 °C with 0.5 units alkaline phosphatase (NEW ENGLAND BioLabs).

    Plasmid Preparation:

    Article Title: The Use of a Novel NanoLuc -Based Reporter Phage for the Detection of Escherichia coli O157:H7
    Article Snippet: A kanamycin-resistance determinant isolated from EZ-Tn5TM < R6Kγori/KAN-2 > Tnp TransposomeTM kit (Epicentre Biotechonologies, WI) was inserted into pCR2.1 TOPO vector (Invitrogen, CA) to generate pFSP138. .. Then pFSP138 was further dephosphorylated by shrimp alkaline phosphatase (New England biolab, MA) and ligated with pNluc at the Not I site to produce pNluc-Kan.

    Article Title: Investigating molecular crowding within nuclear pores using polarization-PALM
    Article Snippet: Then, mEos3.1 was PCR amplified from the mEos3.1 N1 vector using forward primer 5'- TTT ACGCGT GGAGGAAGTGCGATTAAGCCAGACATG-3' and reverse primer 5'- CTA ACGCG TTTATCGTCTGGCATTGTCAGGCAATCC-3', which includes a stop codon at the end of the coding sequence for mEos3. .. Plasmid pNup153 was digested with Mlu1 and the digested product was dephosphorylated by shrimp alkaline phosphatase (rSAP, New England Biolabs, Ipswich, MA). .. The mEos3.1 PCR product was digested with Mlu1, and ligated into the dephosphorylated pNup153 fragment, yielding plasmid pNup153-mEos3, which produces Nup153-mEos3. mEos3-Nup98 – Human Nup98 was PCR amplified from the plasmid peGFP-Nup98 (gift of Jan Ellenberg, EMBL, Heidelberg) using forward primer 5'-CCG AGATCT TTTAACAAATCATTTGGAACACCCTTTGG-3' and reverse primer 5'-TAT ACGCGT TCACTGTCCTTTTTTCTCTACCTGAG-3'.

    Article Title: Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075
    Article Snippet: Paragraph title: Construction of an arpR expression plasmid ... The arpR fragment was gel purified and ligated (Fast‐Link Ligation Kit, Epicentre Biotechnologies) into pWH1266 that had been digested with ScaI and treated with recombinant shrimp alkaline phosphatase (rSAP, New England Biolabs).

    In Vitro:

    Article Title: Mechanistic insights into type I toxin antitoxin systems in Helicobacter pylori: the importance of mRNA folding in controlling toxin expression
    Article Snippet: Paragraph title: In vitro structure probing ... AapA1 transcripts were first dephosphorylated by the CIP alkaline phosphatase (NEB) and then labeled with 10 pmol of γ32 P-ATP and T4 PNK enzyme (NEB).

    Ethanol Precipitation:

    Article Title: Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)
    Article Snippet: The nucleotides from positions 18-26 were excised, and RNA was eluted overnight with 0.4 M NaCl at 4C. .. The RNA was dephosphorylated by alkaline phosphatase (New England Biolabs Inc., Beijing, China) and recovered by ethanol precipitation. .. The small RNAs were then ligated sequentially to 5' (5'-tactaatacgactcactAAA-3'; uppercase, RNA; lowercase, DNA) and 3' (5'-pUUUaaccgcatccttctcx-3'; uppercase, RNA; lowercase, DNA; p, phosphate; x, inverted deoxythymidine) RNA/DNA chimeric oligonucleotide adapters.

    Article Title: Differential Expression of miRNAs in Response to Topping in Flue-Cured Tobacco (Nicotiana tabacum) Roots
    Article Snippet: After gel electrophoresis, small RNAs with 18–26 nt were excised from the gel and eluted with 0.4 M NaCl overnight at 4°C. .. The RNA was dephosphorylated using alkaline phosphatase (New England Biolabs, Beijing China) and recovered by ethanol precipitation. .. The isolated small RNAs were then sequentially ligated to 5′- and 3′-chimeric oligonucleotide adapters, reversely transcribed, and amplified by PCR.

    Article Title: A real-time PCR-based quantitative assay for 3-methylcytosine demethylase activity of ALKBH3
    Article Snippet: 2.4 After incubation with or without silkworm recombinant ALKBH3, the ssDNA oligo containing 3-meC was purified by ethanol-precipitation. .. Thereafter, the mixture was incubated for 1 h at 37 °C with 0.5 units alkaline phosphatase (NEW ENGLAND BioLabs).

    Article Title: Mechanistic insights into type I toxin antitoxin systems in Helicobacter pylori: the importance of mRNA folding in controlling toxin expression
    Article Snippet: AapA1 transcripts were first dephosphorylated by the CIP alkaline phosphatase (NEB) and then labeled with 10 pmol of γ32 P-ATP and T4 PNK enzyme (NEB). .. Labeled RNA was purified on an 8% PAA containing 7 M urea 1X TBE and eluted overnight at 4°C under shaking in 750 μl elution buffer (0.1 M NaOAc pH 5.2, 0.1% SDS).


    Article Title: Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075Multiple roles for a novel RND‐type efflux system in Acinetobacter baumannii AB5075
    Article Snippet: The arpR fragment was gel purified and ligated (Fast‐Link Ligation Kit, Epicentre Biotechnologies) into pWH1266 that had been digested with ScaI and treated with recombinant shrimp alkaline phosphatase (rSAP, New England Biolabs). .. Plasmids that conferred tetracycline resistance but not ampicillin resistance were purified and confirmed by DNA sequencing prior to introduction into A. baumannii .

    Concentration Assay:

    Article Title: A new species of Oxynetra from Mexico ( Hesperiidae, Pyrginae, Pyrrhopygini)
    Article Snippet: Genomic DNA was eluted in a total volume of 40–100 μl MN BE buffer (concentration of DNA as measured by Promega QuantiFluor® dsDNA System was from near 0 to 20 ng/μl, mostly around 1 ng/μl, depending on specimen age and storage conditions) and was stored at -20°C. .. The PCR reaction was cleaned by enzymatic digestion for the whole barcode amplifications, ID tag amplification, and sequences amplified in more than two segments, with 4 μl Shrimp Alkaline Phosphatase (20 U/μl) and 1 ul Exonuclease I (1 U/μl) from New England Biolabs.

    Article Title:
    Article Snippet: The peptides were reconstituted in 150 μl of 100 mm NaCl, 50 mm Tris-HCl, 10 mm MgCl2 , 1 mm dithiothreitol at pH 7.9 and incubated with 5 μl of Alkaline Phosphatase (New England Biolabs, Ipswhich, MA, USA) for 3 h at 37 °C. .. The peptides were reconstituted in 150 μl of 100 mm NaCl, 50 mm Tris-HCl, 10 mm MgCl2 , 1 mm dithiothreitol at pH 7.9 and incubated with 5 μl of Alkaline Phosphatase (New England Biolabs, Ipswhich, MA, USA) for 3 h at 37 °C.

    Article Title: In-depth mapping of the mouse brain N-glycoproteome reveals widespread N-glycosylation of diverse brain proteins
    Article Snippet: N-glycopeptides were released from the resins by the addition of PNGase F (500 units/μL, New England Biolabs, Ipswich, MA) at a concentration of 1 μL of PNGase F per mg of crude protein in 100 mM NH4 HCO3 (pH 8.0) overnight at 37°C. .. TiO2 : Digested peptides were first treated with alkaline phosphatase (New England Biolabs, Ipswich, MA) at 30°C for 2 h. The peptide mixture was suspended in a loading buffer containing 1 M glycolic acid, 80% CH3 CN, and 5% CF3 COOH.


    Article Title: Protein Phosphatase 2A Controls Ethylene Biosynthesis by Differentially Regulating the Turnover of ACC Synthase Isoforms
    Article Snippet: For CIP treatment, 5 units of alkaline phosphatase (CIP, New England Biolabs) were added. .. For PP2A treatment, anti-GFP antibodies were used to immunoprecipitate PP2A complexes from seedlings expressing the RCN1-YFP fusion as described above; 10 µl of PP2A immunocomplexes were added to the myc-ACS6 extract.

    Standard Deviation:

    Article Title: Down-regulation of p38 mitogen-activated protein kinase activation and proinflammatory cytokine production by mitogen-activated protein kinase inhibitors in inflammatory bowel disease
    Article Snippet: We performed single measurements for each patient and based the mean and standard deviation (s.d.) on this single measurement in a number of patients. .. Alkaline phosphatase (CIP; New England BioLabs, Hertfordshire, UK) was used to release phosphate groups from phosphorylated tyrosine, serine and threonine residues in proteins to show that the antibodies identified only phosphorylated proteins.


    Article Title: A new species of Oxynetra from Mexico ( Hesperiidae, Pyrginae, Pyrrhopygini)
    Article Snippet: The lysis buffer volume was scaled down to 70 μl for legs and volumes of subsequent reagents were proportionally reduced. .. The PCR reaction was cleaned by enzymatic digestion for the whole barcode amplifications, ID tag amplification, and sequences amplified in more than two segments, with 4 μl Shrimp Alkaline Phosphatase (20 U/μl) and 1 ul Exonuclease I (1 U/μl) from New England Biolabs.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs shrimp alkaline phosphatase affymetrics
    Shrimp Alkaline Phosphatase Affymetrics, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more alkaline phosphatase affymetrics/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    shrimp alkaline phosphatase affymetrics - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results