Review





Similar Products

90
Thermo Fisher shrna construct shctrl
Silencing of integrin a6 in MES-GSCs does not have an impact on stemness and self-renewal. ( A , C ) Representative Western blot of the lentiviral-based <t>shRNA</t> silencing of ITGA6 in PN-GIC2 ( A ) and MES-GSCs ( C ). The values indicated within blots are relative to the densitometric analysis. Numbers indicate the normalized integrin a6 intensity ratio relative to the mean of <t>normalized</t> <t>shCTRL</t> samples. ( B ) Assessment of self-renewal capacity (mean ± SEM; n = 3; unpaired t -test) and sphere size (mean ± SEM; n = 3; Mann–Whitney test) in PN-GSCs silenced for ITGA6 . Micrographs from representative fields of gliomaspheres (scale bar = 100 µm). ( D ) Self-renewal capacity (mean ± SEM; n = 4; unpaired t -test) and sphere size (mean ± SEM; n = 4; Mann–Whitney test) in MES-GSCs silenced for ITGA6 . The number of independent experiments— n , the number of gliomaspheres scored for each condition—N. The values specified within the bar plot indicate the mean relative self-renewal capacity. ( E ) Transcript levels of ITGA6 and NES detected by means of qPCR in shITGA6 PN-GSCs and MES-GSCs (mean ± SEM; n = 3; unpaired t -test). ( F ) Relative transcript amount of ALDH1A3 , a specific MES stem cell marker, in shITGA6 MES-GSCs (mean ± SEM; n = 3; unpaired t -test). *** p < 0.001; **** p < 0.0001.
Shrna Construct Shctrl, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+constructs/pmc08235627-77-1-26?v=Thermo+Fisher
Average 90 stars, based on 1 article reviews
shrna construct shctrl - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

93
Addgene inc lentiviral constructs plko rfp shctrl
a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
Lentiviral Constructs Plko Rfp Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+constructs/bio_rxiv__2025__07__16__665171-165-0-3?v=Addgene+inc
Average 93 stars, based on 1 article reviews
lentiviral constructs plko rfp shctrl - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

96
OriGene shctrl constructs
a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
Shctrl Constructs, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+constructs/pm38873940-270-3-8?v=OriGene
Average 96 stars, based on 1 article reviews
shctrl constructs - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

90
Millipore thenontargeting (shctrl) shrna construct (shc002)
a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
Thenontargeting (Shctrl) Shrna Construct (Shc002), supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+constructs/10__1158_slash_0008___5472__can___21___1114-60-0-6?v=Millipore
Average 90 stars, based on 1 article reviews
thenontargeting (shctrl) shrna construct (shc002) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Millipore shctrl shrna construct (shc002)
a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
Shctrl Shrna Construct (Shc002), supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+constructs/us10308698-333-1-9?v=Millipore
Average 90 stars, based on 1 article reviews
shctrl shrna construct (shc002) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Thermo Fisher tripz-shctrl construct
a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
Tripz Shctrl Construct, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shctrl+constructs/pm30415143-59-3-5?v=Thermo+Fisher
Average 90 stars, based on 1 article reviews
tripz-shctrl construct - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


Silencing of integrin a6 in MES-GSCs does not have an impact on stemness and self-renewal. ( A , C ) Representative Western blot of the lentiviral-based shRNA silencing of ITGA6 in PN-GIC2 ( A ) and MES-GSCs ( C ). The values indicated within blots are relative to the densitometric analysis. Numbers indicate the normalized integrin a6 intensity ratio relative to the mean of normalized shCTRL samples. ( B ) Assessment of self-renewal capacity (mean ± SEM; n = 3; unpaired t -test) and sphere size (mean ± SEM; n = 3; Mann–Whitney test) in PN-GSCs silenced for ITGA6 . Micrographs from representative fields of gliomaspheres (scale bar = 100 µm). ( D ) Self-renewal capacity (mean ± SEM; n = 4; unpaired t -test) and sphere size (mean ± SEM; n = 4; Mann–Whitney test) in MES-GSCs silenced for ITGA6 . The number of independent experiments— n , the number of gliomaspheres scored for each condition—N. The values specified within the bar plot indicate the mean relative self-renewal capacity. ( E ) Transcript levels of ITGA6 and NES detected by means of qPCR in shITGA6 PN-GSCs and MES-GSCs (mean ± SEM; n = 3; unpaired t -test). ( F ) Relative transcript amount of ALDH1A3 , a specific MES stem cell marker, in shITGA6 MES-GSCs (mean ± SEM; n = 3; unpaired t -test). *** p < 0.001; **** p < 0.0001.

Journal: Cancers

Article Title: Dual Role of Integrin Alpha-6 in Glioblastoma: Supporting Stemness in Proneural Stem-Like Cells While Inducing Radioresistance in Mesenchymal Stem-Like Cells

doi: 10.3390/cancers13123055

Figure Lengend Snippet: Silencing of integrin a6 in MES-GSCs does not have an impact on stemness and self-renewal. ( A , C ) Representative Western blot of the lentiviral-based shRNA silencing of ITGA6 in PN-GIC2 ( A ) and MES-GSCs ( C ). The values indicated within blots are relative to the densitometric analysis. Numbers indicate the normalized integrin a6 intensity ratio relative to the mean of normalized shCTRL samples. ( B ) Assessment of self-renewal capacity (mean ± SEM; n = 3; unpaired t -test) and sphere size (mean ± SEM; n = 3; Mann–Whitney test) in PN-GSCs silenced for ITGA6 . Micrographs from representative fields of gliomaspheres (scale bar = 100 µm). ( D ) Self-renewal capacity (mean ± SEM; n = 4; unpaired t -test) and sphere size (mean ± SEM; n = 4; Mann–Whitney test) in MES-GSCs silenced for ITGA6 . The number of independent experiments— n , the number of gliomaspheres scored for each condition—N. The values specified within the bar plot indicate the mean relative self-renewal capacity. ( E ) Transcript levels of ITGA6 and NES detected by means of qPCR in shITGA6 PN-GSCs and MES-GSCs (mean ± SEM; n = 3; unpaired t -test). ( F ) Relative transcript amount of ALDH1A3 , a specific MES stem cell marker, in shITGA6 MES-GSCs (mean ± SEM; n = 3; unpaired t -test). *** p < 0.001; **** p < 0.0001.

Article Snippet: Non-targeting shRNA construct (shCTRL; source clone ID: RHS4348) and shITGA6 plasmid mapping against ITGA6 exon 15 (target sequence: AGGATATTGCTTTAGAAAT; source clone ID: V3LHS_326014) were purchased from Thermo-Scientific.

Techniques: Western Blot, shRNA, MANN-WHITNEY, Marker

a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a lentiviral vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).

Journal: bioRxiv

Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP

doi: 10.1101/2025.07.16.665171

Figure Lengend Snippet: a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a lentiviral vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).

Article Snippet: Lentiviral constructs pLKO-RFP-shCtrl (Addgene, 69040) and pLKO-RFP-shDbn1 containing the shRNA sequence GCAGTCTATCTTTGGTGACCA (TRCN0000090077) against the Dbn1 gene were used in knockdown experiments. pFUW-FLAG-APEX2, pFUW-FLAG-APEX2-DBN1 and pFUW-FLAG-APEX2-IGF2BP1 were used to perform accessibility and proximity assays, and derived from pcDNA3 APEX2-NES (Addgene, 49386) and pFUW (Addgene, 14882).

Techniques: Immunofluorescence, Expressing, Sequencing, Plasmid Preparation, Selection