Review
Similar Products
86
|
10X Genomics
sequencing chromium single cell 3 library gel bead kit v2 Sequencing Chromium Single Cell 3 Library Gel Bead Kit V2, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sequence+3/cellranger/pmc08772395-882-0-12 Average 86 stars, based on 1 article reviews
sequencing chromium single cell 3 library gel bead kit v2 - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
10X Genomics
sequencing chromium single cell 3 library gel bead kit v3 Sequencing Chromium Single Cell 3 Library Gel Bead Kit V3, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sequence+3/cellranger/pmc08772395-883-0-12 Average 86 stars, based on 1 article reviews
sequencing chromium single cell 3 library gel bead kit v3 - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Plasmidsaurus
lower depth 3 single end rna sequencing Lower Depth 3 Single End Rna Sequencing, supplied by Plasmidsaurus, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sequence+3/3+depth+end+lower+rna+sequencing+single/pm42297096-222-15-20 Average 86 stars, based on 1 article reviews
lower depth 3 single end rna sequencing - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Plasmidsaurus
3 tag single end sequencing 3 Tag Single End Sequencing, supplied by Plasmidsaurus, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sequence+3/3+depth+end+lower+rna+sequencing+single/pm42297096-90-1-0 Average 86 stars, based on 1 article reviews
3 tag single end sequencing - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Solexa
3 dapter sequences 3 Dapter Sequences, supplied by Solexa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sequence+3/3+dapter+sequences/pm42240622-221-4-7 Average 86 stars, based on 1 article reviews
3 dapter sequences - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Sangon Biotech
shperk 2 targeted sequence 5 gttgtgctagcaaccctaata 3 Shperk 2 Targeted Sequence 5 Gttgtgctagcaaccctaata 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sequence+3/2+3+5+gttgtgctagcaaccctaata+sequence+shperk+targeted/pmc13198297-89-0-8 Average 86 stars, based on 1 article reviews
shperk 2 targeted sequence 5 gttgtgctagcaaccctaata 3 - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
10X Genomics
sequencing chromium single cell 3 reagent kit v3 1 dual index Sequencing Chromium Single Cell 3 Reagent Kit V3 1 Dual Index, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sequence+3/cellranger/pm42134332-1005-4-14 Average 86 stars, based on 1 article reviews
sequencing chromium single cell 3 reagent kit v3 1 dual index - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Bioedit Company
sequence alignment editor v7 0 5 3 Sequence Alignment Editor V7 0 5 3, supplied by Bioedit Company, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sequence+3/alignment+bioedit+editor+sequence/pm42103925-96-16-15 Average 86 stars, based on 1 article reviews
sequence alignment editor v7 0 5 3 - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Ebiogen Inc
quantseq 3 mrna sequencing Quantseq 3 Mrna Sequencing, supplied by Ebiogen Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sequence+3/3+mrna+quantseq+sequencing/pm42071063-72-0-7 Average 86 stars, based on 1 article reviews
quantseq 3 mrna sequencing - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
94
|
Thermo Fisher
n morpholino propanesulfonic acid mops thermo fisher waltham ma N Morpholino Propanesulfonic Acid Mops Thermo Fisher Waltham Ma, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sequence+3/MOPS%2C+99%2E5%25%2C+for+molecular+biology%2C+Dnase%2C+Rnase%2C+Prot%2E+free%2C+for+peptide+sequencing/pm42017691-184-15-18 Average 94 stars, based on 1 article reviews
n morpholino propanesulfonic acid mops thermo fisher waltham ma - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell Reports Medicine
Article Title: Overcoming ADC resistance in advanced colorectal cancer by dual targeting of TROP2 and PERK to suppress Wnt/β-catenin signaling
doi: 10.1016/j.xcrm.2026.102769
Figure Lengend Snippet:
Article Snippet:
Techniques: Recombinant, Lysis, Cell Viability Assay, cDNA Synthesis, RNA sequencing, Sequencing, Plasmid Preparation, Software