sequalprep long range pcr kit (Thermo Fisher)
Thermo Fisher is a verified supplier 
94
|
Name:
SequalPrep Long PCR Kit
Description:
The SequalPrep Long PCR Kit with dNTPs provides the highest amplification success rate of any long range PCR kit tested across multiple organisms and platforms for non optimized amplicons up to 20 kB with little to no optimization Successful long range PCR with minimal optimization enables efficient PCR enrichment for a variety of applications including medical re sequencing on next generation sequencing NGS platforms PCR amplification is the traditional method to enrich target regions of the genome for genotyping and re sequencing applications To take advantage of the enhanced NGS processing capabilities higher throughput enrichment methods have become necessary Unfortunately the potential efficiency gains from long range PCR using available commercial solutions have been offset with lower amplification success rates limiting enrichment to 5 kB regions The SequalPrep Long PCR Kit with dNTPs overcomes these issues and provides the highest amplification success rate of any commercially available kit tested across multiple organisms and platforms for amplicons up to 20 kB with minimal optimization This kit can be used upstream of any NGS platform or for other genotyping applications When combined with the SequalPrep Normalization Plate the SequalPrep Sequence Equalization Sample Preparation System is the first complete PCR enrichment and amplicon equalization solution that provides a viable and efficient enrichment method to meet NGS re sequencing throughput capabilities This NGS Sample Prep system significantly reduces PCR amplification and normalization complexity to allow for enrichment of regions up to 1MB in a 96 well plate format Amplify and equalize with the ease of SequalPrep for consistently high coverage of your regions of interest
Catalog Number:
a10498
Price:
None
Applications:
DNA Sequencing|Kits & Reagents for Sanger Sequencing|Long Fragment PCR|PCR|PCR & Real-Time PCR|PCR Enzymes & Master Mixes|SOLiD® Next-Generation Sequencing|SOLiD® Next-Generation Sequencing Sample Enrichment|Sample & Library Preparation for SOLiD® Next-Generation Sequencing|Sanger Sequencing|Sanger Sequencing Technology & Accessories|Targeted Sequencing|Sequencing
Category:
Proteins Enzymes Peptides
|
Buy from Supplier |
Structured Review
Thermo Fisher
sequalprep long range pcr kit
The SequalPrep Long PCR Kit with dNTPs provides the highest amplification success rate of any long range PCR kit tested across multiple organisms and platforms for non optimized amplicons up to 20 kB with little to no optimization Successful long range PCR with minimal optimization enables efficient PCR enrichment for a variety of applications including medical re sequencing on next generation sequencing NGS platforms PCR amplification is the traditional method to enrich target regions of the genome for genotyping and re sequencing applications To take advantage of the enhanced NGS processing capabilities higher throughput enrichment methods have become necessary Unfortunately the potential efficiency gains from long range PCR using available commercial solutions have been offset with lower amplification success rates limiting enrichment to 5 kB regions The SequalPrep Long PCR Kit with dNTPs overcomes these issues and provides the highest amplification success rate of any commercially available kit tested across multiple organisms and platforms for amplicons up to 20 kB with minimal optimization This kit can be used upstream of any NGS platform or for other genotyping applications When combined with the SequalPrep Normalization Plate the SequalPrep Sequence Equalization Sample Preparation System is the first complete PCR enrichment and amplicon equalization solution that provides a viable and efficient enrichment method to meet NGS re sequencing throughput capabilities This NGS Sample Prep system significantly reduces PCR amplification and normalization complexity to allow for enrichment of regions up to 1MB in a 96 well plate format Amplify and equalize with the ease of SequalPrep for consistently high coverage of your regions of interest
https://www.bioz.com/result/sequalprep long range pcr kit/product/Thermo Fisher
Average 94 stars, based on 3 article reviews
Price from $9.99 to $1999.99
The SequalPrep Long PCR Kit with dNTPs provides the highest amplification success rate of any long range PCR kit tested across multiple organisms and platforms for non optimized amplicons up to 20 kB with little to no optimization Successful long range PCR with minimal optimization enables efficient PCR enrichment for a variety of applications including medical re sequencing on next generation sequencing NGS platforms PCR amplification is the traditional method to enrich target regions of the genome for genotyping and re sequencing applications To take advantage of the enhanced NGS processing capabilities higher throughput enrichment methods have become necessary Unfortunately the potential efficiency gains from long range PCR using available commercial solutions have been offset with lower amplification success rates limiting enrichment to 5 kB regions The SequalPrep Long PCR Kit with dNTPs overcomes these issues and provides the highest amplification success rate of any commercially available kit tested across multiple organisms and platforms for amplicons up to 20 kB with minimal optimization This kit can be used upstream of any NGS platform or for other genotyping applications When combined with the SequalPrep Normalization Plate the SequalPrep Sequence Equalization Sample Preparation System is the first complete PCR enrichment and amplicon equalization solution that provides a viable and efficient enrichment method to meet NGS re sequencing throughput capabilities This NGS Sample Prep system significantly reduces PCR amplification and normalization complexity to allow for enrichment of regions up to 1MB in a 96 well plate format Amplify and equalize with the ease of SequalPrep for consistently high coverage of your regions of interest
https://www.bioz.com/result/sequalprep long range pcr kit/product/Thermo Fisher
Average 94 stars, based on 3 article reviews
Price from $9.99 to $1999.99
sequalprep long range pcr kit - by Bioz Stars,
2020-07
94/100 stars
Related Products / Commonly Used Together
Images
Related Articles
Sequencing:Article Title: Multi-ethnic Cytochrome-P450 Copy Number Profiling: Novel Pharmacogenetic Alleles and Mechanism of Copy Number Variation Formation Article Snippet: .. CYP2B6 and CYP2E1 Sequence Analyses The breakpoint regions (~3 kb) of the CYP2B6 /2B7P1 fusion alleles (CYP2B6*29 and *30 ) were assessed by breakpoint-spanning PCR using overlapping primers ( ) and the Polymerase Chain Reaction:Article Title: Multi-ethnic Cytochrome-P450 Copy Number Profiling: Novel Pharmacogenetic Alleles and Mechanism of Copy Number Variation Formation Article Snippet: .. CYP2B6 and CYP2E1 Sequence Analyses The breakpoint regions (~3 kb) of the CYP2B6 /2B7P1 fusion alleles (CYP2B6*29 and *30 ) were assessed by breakpoint-spanning PCR using overlapping primers ( ) and the Article Title: OCA2 splice site variant in German Spitz dogs with oculocutaneous albinism Article Snippet: .. Long-range PCR A long-range PCR to was performed using the primer pair GGCAAACTTGGGAGTGGTAA (Chr3:31,659,781–31,659,762) and CCCCCTCAAATAAACCATGA (Chr3:32,346,375–32,346,356) and the Article Title: The BAF and PRC2 Complex Subunits Dpf2 and Eed Antagonistically Converge on Tbx3 to Control ESC Differentiation Article Snippet: .. Targeting of the second WT allele was confirmed by the presence of both the rWT allele and the second knockout allele through long-range PCR reactions ( Article Title: An Application of NGS for WDR36 Gene in Taiwanese Patients with Juvenile-Onset Open-Angle Glaucoma Article Snippet: .. Cycling profile of long range PCR was conducted as follows: one cycle at 94℃ for 2 min, followed by 10 cycles at 94℃ for 10 s, at 55℃ for 30 s, and at 68℃ for 14 min, followed by 30 cycles at 94℃ for 10 s, at 55℃ for 30 s, and at 68℃ for 14 min (+20 s every cycle), followed by a final extension step at 72℃ for 5 min, according to Article Title: Conditional Disruption of Hepatic Carbamoyl Phosphate Synthetase 1 in Mice Results in Hyperammonemia without Orotic Aciduria and Can be Corrected by Liver-Directed Gene Therapy Article Snippet: .. Approximately 50ng of DNA was tested by long range PCR across the 5′ arm as well as the 3′ distal loxP using Article Title: Analysis of the chromosome X exome in patients with autism spectrum disorders identified novel candidate genes, including TMLHE Article Snippet: .. In addition, the presence of the deletion of exon 2 in TMLHE was confirmed by long-range PCR using the Article Title: Large-scale screening and characterization of enteroviruses and kobuviruses infecting pigs in Vietnam Article Snippet: .. A Article Title: A higher throughput assay for quantification of melphalan-induced DNA damage in peripheral blood mononuclear cells Article Snippet: .. LA Taq DNA Polymerase (TaKaRa, Japan), Ex Taq Hot Start Version Kit (TaKaRa, Japan), and Amplification:Article Title: A higher throughput assay for quantification of melphalan-induced DNA damage in peripheral blood mononuclear cells Article Snippet: .. LA Taq DNA Polymerase (TaKaRa, Japan), Ex Taq Hot Start Version Kit (TaKaRa, Japan), and Size-exclusion Chromatography:Article Title: Conditional Disruption of Hepatic Carbamoyl Phosphate Synthetase 1 in Mice Results in Hyperammonemia without Orotic Aciduria and Can be Corrected by Liver-Directed Gene Therapy Article Snippet: .. Approximately 50ng of DNA was tested by long range PCR across the 5′ arm as well as the 3′ distal loxP using Knock-Out:Article Title: The BAF and PRC2 Complex Subunits Dpf2 and Eed Antagonistically Converge on Tbx3 to Control ESC Differentiation Article Snippet: .. Targeting of the second WT allele was confirmed by the presence of both the rWT allele and the second knockout allele through long-range PCR reactions ( |