sequalprep long range pcr kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    SequalPrep Long PCR Kit
    Description:
    The SequalPrep Long PCR Kit with dNTPs provides the highest amplification success rate of any long range PCR kit tested across multiple organisms and platforms for non optimized amplicons up to 20 kB with little to no optimization Successful long range PCR with minimal optimization enables efficient PCR enrichment for a variety of applications including medical re sequencing on next generation sequencing NGS platforms PCR amplification is the traditional method to enrich target regions of the genome for genotyping and re sequencing applications To take advantage of the enhanced NGS processing capabilities higher throughput enrichment methods have become necessary Unfortunately the potential efficiency gains from long range PCR using available commercial solutions have been offset with lower amplification success rates limiting enrichment to 5 kB regions The SequalPrep Long PCR Kit with dNTPs overcomes these issues and provides the highest amplification success rate of any commercially available kit tested across multiple organisms and platforms for amplicons up to 20 kB with minimal optimization This kit can be used upstream of any NGS platform or for other genotyping applications When combined with the SequalPrep Normalization Plate the SequalPrep Sequence Equalization Sample Preparation System is the first complete PCR enrichment and amplicon equalization solution that provides a viable and efficient enrichment method to meet NGS re sequencing throughput capabilities This NGS Sample Prep system significantly reduces PCR amplification and normalization complexity to allow for enrichment of regions up to 1MB in a 96 well plate format Amplify and equalize with the ease of SequalPrep for consistently high coverage of your regions of interest
    Catalog Number:
    a10498
    Price:
    None
    Category:
    Proteins Enzymes Peptides
    Applications:
    DNA Sequencing|Kits & Reagents for Sanger Sequencing|Long Fragment PCR|PCR|PCR & Real-Time PCR|PCR Enzymes & Master Mixes|SOLiD® Next-Generation Sequencing|SOLiD® Next-Generation Sequencing Sample Enrichment|Sample & Library Preparation for SOLiD® Next-Generation Sequencing|Sanger Sequencing|Sanger Sequencing Technology & Accessories|Targeted Sequencing|Sequencing
    Buy from Supplier


    Structured Review

    Thermo Fisher sequalprep long range pcr kit
    The SequalPrep Long PCR Kit with dNTPs provides the highest amplification success rate of any long range PCR kit tested across multiple organisms and platforms for non optimized amplicons up to 20 kB with little to no optimization Successful long range PCR with minimal optimization enables efficient PCR enrichment for a variety of applications including medical re sequencing on next generation sequencing NGS platforms PCR amplification is the traditional method to enrich target regions of the genome for genotyping and re sequencing applications To take advantage of the enhanced NGS processing capabilities higher throughput enrichment methods have become necessary Unfortunately the potential efficiency gains from long range PCR using available commercial solutions have been offset with lower amplification success rates limiting enrichment to 5 kB regions The SequalPrep Long PCR Kit with dNTPs overcomes these issues and provides the highest amplification success rate of any commercially available kit tested across multiple organisms and platforms for amplicons up to 20 kB with minimal optimization This kit can be used upstream of any NGS platform or for other genotyping applications When combined with the SequalPrep Normalization Plate the SequalPrep Sequence Equalization Sample Preparation System is the first complete PCR enrichment and amplicon equalization solution that provides a viable and efficient enrichment method to meet NGS re sequencing throughput capabilities This NGS Sample Prep system significantly reduces PCR amplification and normalization complexity to allow for enrichment of regions up to 1MB in a 96 well plate format Amplify and equalize with the ease of SequalPrep for consistently high coverage of your regions of interest
    https://www.bioz.com/result/sequalprep long range pcr kit/product/Thermo Fisher
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    sequalprep long range pcr kit - by Bioz Stars, 2021-03
    93/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Probiotic supplements prevented oxonic acid-induced hyperuricemia and renal damage
    Article Snippet: In brief, amplicons were generated using primers that target approximately 400 base pairs of the V3V4 variable region of the 16S rRNA gene. .. PCR products were normalized using a SequalPrepTM kit (Invitrogen, Carlsbad, CA), pooled, lyophilized, purified and concentrated using a DNA Clean and Concentrator Kit (Zymo, Irvine, CA). .. The denatured PCR amplicon pool was diluted to 15 pM and spiked with 25% of the Illumina PhiX control DNA prior to loading the sequencer.

    Article Title: Helicase-like transcription factor (Hltf) gene-deletion promotes oxidative phosphorylation (OXPHOS) in colorectal tumors of AOM/DSS-treated mice
    Article Snippet: Isolation of genomic DNA from tail biopsies and tumor samples was achieved with the DNeasy Blood & Tissue Kit (69506) purchased from Qiagen (Valencia, CA). .. Applied Biosystems TaqMan® MGB (minor groove binder) probes with a 5´ reporter (FAM or VIC) and a 3´ nonfluorescent quencher (MGB-NFQ), Invitrogen™ TRIzol™ Reagent (15596026), Invitrogen SuperScript™ Vilo™ cDNA Synthesis Kit (11754050), and SequalPrep™ Long PCR Kit with dNTPs (A10498) were purchased from ThermoFisher Scientific (Waltham, MA). .. Midland Certified Reagent Company (Midland, TX) synthesized the PCR primers.

    Article Title: An Application of NGS for WDR36 Gene in Taiwanese Patients with Juvenile-Onset Open-Angle Glaucoma
    Article Snippet: Long range polymerase chain reaction (PCR) was applied for enrichment of WDR36 gene, intragenic primer sequences shown in Table . .. Cycling profile of long range PCR was conducted as follows: one cycle at 94℃ for 2 min, followed by 10 cycles at 94℃ for 10 s, at 55℃ for 30 s, and at 68℃ for 14 min, followed by 30 cycles at 94℃ for 10 s, at 55℃ for 30 s, and at 68℃ for 14 min (+20 s every cycle), followed by a final extension step at 72℃ for 5 min, according to SequalPrepTM Long PCR Kit protocol (Invitrogen, USA). .. According to the manufacturer's instructions, PCR products were cleaned up using AMPure Reagent beads (Agencourt, Beverly, MA).

    Article Title: Conditional Disruption of Hepatic Carbamoyl Phosphate Synthetase 1 in Mice Results in Hyperammonemia without Orotic Aciduria and Can be Corrected by Liver-Directed Gene Therapy
    Article Snippet: Twelve passing clones were then expanded and DNA extracted via Qiagen blood and tissue kit following manufacturer’s protocol. .. Approximately 50ng of DNA was tested by long range PCR across the 5′ arm as well as the 3′ distal loxP using Invitrogen SequalPrep long PCR Kit following manufacturer’s protocol with the following thermal cycling: 94°C for 2min; 10 cycles of 94°C for 15 sec, 65°C for 15 sec (↓1C/cycle), 68°C for 10 min; 25 cycles of 94°C for 15 sec, 55°C for 30 sec, 68°C for 10 min (+20 sec/cycle), hold at 4°C. .. 5′ long range PCR included a genomic forward primer TTTCAGCTTTTAAGGGACTAGCGTGC paired with a cassette reverse primer GGTGGTGTGGGAAAGGGTTCGAAG for an expected 6,007bp targeted band.

    Article Title: Hybridization capture of larch (Larix Mill) chloroplast genomes from sedimentary ancient DNA reveals past changes of Siberian forests
    Article Snippet: Long-range PCR products were generated from DNA extractions from needles of a L. gmelinii individual collected in the Botanical Gardens of the University of Potsdam (Accession number XX-0POTSD-3867). .. PCR amplification was conducted using the SequalPrep™ Long PCR Kit (Invitrogen), according to the manufacturer’s cycling protocol instructions, and with specific annealing temperatures for each primer pair (see , Table S2). .. The PCR products were pooled in equimolar ratios in a volume of 130 µL and sonicated using a Covaris M220 Focused-ultrasonicator (Covaris, Woburn, MA) to a target peak of 350 bp with settings of peak incident power 50 W, duty factor 20%, cycles per burst 200, treatment time 70 seconds.

    Article Title: Analysis of the chromosome X exome in patients with autism spectrum disorders identified novel candidate genes, including TMLHE
    Article Snippet: PCR products were quantified on a Caliper LabChip system (Caliper Life Sciences, Hopkinton, MA, USA). .. In addition, the presence of the deletion of exon 2 in TMLHE was confirmed by long-range PCR using the SequalPrep Long PCR kit (Invitrogen, Life Technologies Corporation, Carlsbad, CA, USA) according to the manufacturer's recommendations. ..

    Article Title: Large-scale screening and characterization of enteroviruses and kobuviruses infecting pigs in Vietnam
    Article Snippet: Then, 1 μl of the first-round reaction was used as template for the second-round PCR with amplification (using GoTaq DNA polymerase; Promega) conditions as follows: 95 °C for 5 min, and 30 cycles of denaturation (94 °C, 30 s), annealing (50 °C, 30 s) and elongation (72 °C, 60 s) in a thermal cycler. .. A SequalPrep long PCR kit (Life Technology) was used according to the manufacturer's instruction instead of GoTaq DNA polymerase to amplify fragments > 2 kb. .. Sequences were imported into sse ( ) for alignment and calculation of sequence divergence values from reference sequences of known EV types.

    Article Title: A higher throughput assay for quantification of melphalan-induced DNA damage in peripheral blood mononuclear cells
    Article Snippet: .. LA Taq DNA Polymerase (TaKaRa, Japan), Ex Taq Hot Start Version Kit (TaKaRa, Japan), and SequalPrep Long PCR Kit (Life Technologies, USA) failed to generate major products specific for the 6.8 kb target amplicon. .. This may be due to predicted G-quadruplex structures adjacent to the annealing site of the sense primer , ; G-quadruplexes can affect the proof-reading fidelity of long-range PCR DNA polymerases .

    Purification:

    Article Title: Probiotic supplements prevented oxonic acid-induced hyperuricemia and renal damage
    Article Snippet: In brief, amplicons were generated using primers that target approximately 400 base pairs of the V3V4 variable region of the 16S rRNA gene. .. PCR products were normalized using a SequalPrepTM kit (Invitrogen, Carlsbad, CA), pooled, lyophilized, purified and concentrated using a DNA Clean and Concentrator Kit (Zymo, Irvine, CA). .. The denatured PCR amplicon pool was diluted to 15 pM and spiked with 25% of the Illumina PhiX control DNA prior to loading the sequencer.

    Size-exclusion Chromatography:

    Article Title: Conditional Disruption of Hepatic Carbamoyl Phosphate Synthetase 1 in Mice Results in Hyperammonemia without Orotic Aciduria and Can be Corrected by Liver-Directed Gene Therapy
    Article Snippet: Twelve passing clones were then expanded and DNA extracted via Qiagen blood and tissue kit following manufacturer’s protocol. .. Approximately 50ng of DNA was tested by long range PCR across the 5′ arm as well as the 3′ distal loxP using Invitrogen SequalPrep long PCR Kit following manufacturer’s protocol with the following thermal cycling: 94°C for 2min; 10 cycles of 94°C for 15 sec, 65°C for 15 sec (↓1C/cycle), 68°C for 10 min; 25 cycles of 94°C for 15 sec, 55°C for 30 sec, 68°C for 10 min (+20 sec/cycle), hold at 4°C. .. 5′ long range PCR included a genomic forward primer TTTCAGCTTTTAAGGGACTAGCGTGC paired with a cassette reverse primer GGTGGTGTGGGAAAGGGTTCGAAG for an expected 6,007bp targeted band.

    Amplification:

    Article Title: Hybridization capture of larch (Larix Mill) chloroplast genomes from sedimentary ancient DNA reveals past changes of Siberian forests
    Article Snippet: Long-range PCR products were generated from DNA extractions from needles of a L. gmelinii individual collected in the Botanical Gardens of the University of Potsdam (Accession number XX-0POTSD-3867). .. PCR amplification was conducted using the SequalPrep™ Long PCR Kit (Invitrogen), according to the manufacturer’s cycling protocol instructions, and with specific annealing temperatures for each primer pair (see , Table S2). .. The PCR products were pooled in equimolar ratios in a volume of 130 µL and sonicated using a Covaris M220 Focused-ultrasonicator (Covaris, Woburn, MA) to a target peak of 350 bp with settings of peak incident power 50 W, duty factor 20%, cycles per burst 200, treatment time 70 seconds.

    Article Title: A higher throughput assay for quantification of melphalan-induced DNA damage in peripheral blood mononuclear cells
    Article Snippet: .. LA Taq DNA Polymerase (TaKaRa, Japan), Ex Taq Hot Start Version Kit (TaKaRa, Japan), and SequalPrep Long PCR Kit (Life Technologies, USA) failed to generate major products specific for the 6.8 kb target amplicon. .. This may be due to predicted G-quadruplex structures adjacent to the annealing site of the sense primer , ; G-quadruplexes can affect the proof-reading fidelity of long-range PCR DNA polymerases .

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Thermo Fisher sequalprep long pcr kit
    Sequalprep Long Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sequalprep long pcr kit/product/Thermo Fisher
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    sequalprep long pcr kit - by Bioz Stars, 2021-03
    93/100 stars
      Buy from Supplier

    Image Search Results