sequalprep long pcr kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Name:
    SequalPrep Long PCR Kit
    Description:
    The SequalPrep Long PCR Kit with dNTPs provides the highest amplification success rate of any long range PCR kit tested across multiple organisms and platforms for non optimized amplicons up to 20 kB with little to no optimization Successful long range PCR with minimal optimization enables efficient PCR enrichment for a variety of applications including medical re sequencing on next generation sequencing NGS platforms PCR amplification is the traditional method to enrich target regions of the genome for genotyping and re sequencing applications To take advantage of the enhanced NGS processing capabilities higher throughput enrichment methods have become necessary Unfortunately the potential efficiency gains from long range PCR using available commercial solutions have been offset with lower amplification success rates limiting enrichment to 5 kB regions The SequalPrep Long PCR Kit with dNTPs overcomes these issues and provides the highest amplification success rate of any commercially available kit tested across multiple organisms and platforms for amplicons up to 20 kB with minimal optimization This kit can be used upstream of any NGS platform or for other genotyping applications When combined with the SequalPrep Normalization Plate the SequalPrep Sequence Equalization Sample Preparation System is the first complete PCR enrichment and amplicon equalization solution that provides a viable and efficient enrichment method to meet NGS re sequencing throughput capabilities This NGS Sample Prep system significantly reduces PCR amplification and normalization complexity to allow for enrichment of regions up to 1MB in a 96 well plate format Amplify and equalize with the ease of SequalPrep for consistently high coverage of your regions of interest
    Catalog Number:
    A10498
    Price:
    None
    Category:
    Proteins Enzymes Peptides
    Applications:
    DNA Sequencing|Kits & Reagents for Sanger Sequencing|Long Fragment PCR|PCR|PCR & Real-Time PCR|PCR Enzymes & Master Mixes|SOLiD® Next-Generation Sequencing|SOLiD® Next-Generation Sequencing Sample Enrichment|Sample & Library Preparation for SOLiD® Next-Generation Sequencing|Sanger Sequencing|Sanger Sequencing Technology & Accessories|Targeted Sequencing|Sequencing
    Buy from Supplier


    Structured Review

    Thermo Fisher sequalprep long pcr kit
    The SequalPrep Long PCR Kit with dNTPs provides the highest amplification success rate of any long range PCR kit tested across multiple organisms and platforms for non optimized amplicons up to 20 kB with little to no optimization Successful long range PCR with minimal optimization enables efficient PCR enrichment for a variety of applications including medical re sequencing on next generation sequencing NGS platforms PCR amplification is the traditional method to enrich target regions of the genome for genotyping and re sequencing applications To take advantage of the enhanced NGS processing capabilities higher throughput enrichment methods have become necessary Unfortunately the potential efficiency gains from long range PCR using available commercial solutions have been offset with lower amplification success rates limiting enrichment to 5 kB regions The SequalPrep Long PCR Kit with dNTPs overcomes these issues and provides the highest amplification success rate of any commercially available kit tested across multiple organisms and platforms for amplicons up to 20 kB with minimal optimization This kit can be used upstream of any NGS platform or for other genotyping applications When combined with the SequalPrep Normalization Plate the SequalPrep Sequence Equalization Sample Preparation System is the first complete PCR enrichment and amplicon equalization solution that provides a viable and efficient enrichment method to meet NGS re sequencing throughput capabilities This NGS Sample Prep system significantly reduces PCR amplification and normalization complexity to allow for enrichment of regions up to 1MB in a 96 well plate format Amplify and equalize with the ease of SequalPrep for consistently high coverage of your regions of interest
    https://www.bioz.com/result/sequalprep long pcr kit/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    sequalprep long pcr kit - by Bioz Stars, 2021-04
    86/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Microbial aerosol liberation from soiled textiles isolated during routine residuals handling in a modern health care setting
    Article Snippet: Amplification and sequencing Airborne bacterial profiles were determined by broad-range amplification on an Illumina MiSeq platform to sequence 16S ribosomal ribonucleic acid (rRNA) amplicons; these were generated using broad-range PCR primers that circumscribe approximately a 300 bp of the variable V1V2 variable region of [ ]. .. PCR products were normalized using a SequalPrep™ kit (Invitrogen, Carlsbad, CA), pooled, lyophilized, purified, and concentrated using a DNA Clean and Concentrator Kit (Zymo, Irvine, CA). .. Pooled amplicons were quantified using Qubit Fluorometer 2.0 (Invitrogen, Carlsbad, CA), and each pool was diluted to 4 nM and denatured with 0.2 N NaOH at room temperature.

    Article Title: Conditional Disruption of Hepatic Carbamoyl Phosphate Synthetase 1 in Mice Results in Hyperammonemia without Orotic Aciduria and Can be Corrected by Liver-Directed Gene Therapy
    Article Snippet: Twelve passing clones were then expanded and DNA extracted via Qiagen blood and tissue kit following manufacturer’s protocol. .. Approximately 50ng of DNA was tested by long range PCR across the 5′ arm as well as the 3′ distal loxP using Invitrogen SequalPrep long PCR Kit following manufacturer’s protocol with the following thermal cycling: 94°C for 2min; 10 cycles of 94°C for 15 sec, 65°C for 15 sec (↓1C/cycle), 68°C for 10 min; 25 cycles of 94°C for 15 sec, 55°C for 30 sec, 68°C for 10 min (+20 sec/cycle), hold at 4°C. .. 5′ long range PCR included a genomic forward primer TTTCAGCTTTTAAGGGACTAGCGTGC paired with a cassette reverse primer GGTGGTGTGGGAAAGGGTTCGAAG for an expected 6,007bp targeted band.

    Article Title: Enhancer hijacking activates GFI1 family oncogenes in medulloblastoma
    Article Snippet: Only heterozygous SNPs covered by at least 4 sequencing reads in each data set were included in the final summary. .. PCR experiments were performed as follows: 10 ng of genomic DNA were used with the SequalPrep Long PCR Kit (Invitrogen) in 20 µl volumes using the following PCR conditions in a MJ Mini thermocycler (BioRad): 94C for 3 min, followed by 10 cycles of 94C for 10 s, 62C for 30 s and 68C for 6 min and 25 cycles of 94C for 10 s, 60C for 30 s and 68C for 7 min, followed by a final cycle of 72C for 10 min. PCR products were analyzed on a 1% agarose gel stained with Sybr Safe Dye (Invitrogen). .. Gel extracted bands using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel) were capillary sequenced at GATC Biotech AG to analyse SV breakpoints.

    Article Title: Probiotic supplements prevented oxonic acid-induced hyperuricemia and renal damage
    Article Snippet: In brief, amplicons were generated using primers that target approximately 400 base pairs of the V3V4 variable region of the 16S rRNA gene. .. PCR products were normalized using a SequalPrepTM kit (Invitrogen, Carlsbad, CA), pooled, lyophilized, purified and concentrated using a DNA Clean and Concentrator Kit (Zymo, Irvine, CA). .. The denatured PCR amplicon pool was diluted to 15 pM and spiked with 25% of the Illumina PhiX control DNA prior to loading the sequencer.

    Article Title: Predicting the structure of soil communities from plant community taxonomy, phylogeny, and traits
    Article Snippet: All products for each sample were combined in equal volumes and cleaned using the UltraClean PCR Clean-Up Kit (Mo Bio Laboratories, Inc.). .. Illumina Nextera barcodes were added to the amplicons using an 8-cycle PCR, amplicons were cleaned and pooled using the SequalPrep kit (Invitrogen, Carlsbad, CA, USA), and sequenced on an Illumina MiSeq instrument with a 2x151 bp kit at the University of Colorado BioFrontiers sequencing facility. ..

    Article Title: An efficient method for generation of bi-allelic null mutant mouse embryonic stem cells and its application for investigating epigenetic modifiers
    Article Snippet: To confirm the genotype of expanded ES cell clones, genomic DNA was prepared from confluent cultures of 24 well plates using DNAzol (Invitrogen). .. Genotyping by long range PCR was done using either the Expand Long Template PCR System (Roche) with System 2 Buffer plus an extra 1.25 mM MgCl2 and the additives 1% DMSO and 67 mM Trehalose, or the SequalPrep Long PCR kit with dNTPs (Invitrogen), according to manufacturer’s instructions and the following cycling protocol was performed in 96 well format and heated lid: 94°C 3 min; 10 cycles of: 94°C 10–15 s, 70°C 30 s with −1°C per cycle, 68°C 6–7 min; 25 cycles of: 94°C 10–15 s, 60°C 30 s, 68°C 6 min plus add 20 s per cycle; 1 cycle: 7 min at 68°C (Roche Expand polymerase) or 72°C (SequalPrep polymerase); 4°C hold. .. Short range PCRs were done using Platinum Taq polymerase (Invitrogen) with the manufacturers recommended conditions.

    Article Title: Evaluation of bloodstream infections, Clostridium difficile infections, and gut microbiota in pediatric oncology patients
    Article Snippet: Broad-range PCR amplicons were generated using barcoded primers that target the V3V4 variable region of the 16S rRNA gene: primers 338F ( 5’ ACTCCTACGGGAGGCAGCAG ) and 806R ( 5’ GGACTACHVGGGTWTCTAAT ). .. [ – ] PCR products were normalized using a SequalPrep™ kit (Invitrogen, Carlsbad, CA), pooled, and quantified by Qubit Fluorometer 2.0 (Invitrogen, Carlsbad, CA). ..

    Article Title: Functional Impact of An ADHD-Associated DIRAS2 Promoter Polymorphism
    Article Snippet: .. The exons of the DIRAS2 gene including exon–intron boundaries and untranslated regions including the promoter region, were amplified by polymerase chain reactions (PCRs) using either the iProof High Fidelity DNA Polymerase (Bio-Rad Laboratories, München, Germany) or the SequalPrep Long PCR Kit from Invitrogen (Invitrogen; see for primer sequences). ..

    Purification:

    Article Title: Microbial aerosol liberation from soiled textiles isolated during routine residuals handling in a modern health care setting
    Article Snippet: Amplification and sequencing Airborne bacterial profiles were determined by broad-range amplification on an Illumina MiSeq platform to sequence 16S ribosomal ribonucleic acid (rRNA) amplicons; these were generated using broad-range PCR primers that circumscribe approximately a 300 bp of the variable V1V2 variable region of [ ]. .. PCR products were normalized using a SequalPrep™ kit (Invitrogen, Carlsbad, CA), pooled, lyophilized, purified, and concentrated using a DNA Clean and Concentrator Kit (Zymo, Irvine, CA). .. Pooled amplicons were quantified using Qubit Fluorometer 2.0 (Invitrogen, Carlsbad, CA), and each pool was diluted to 4 nM and denatured with 0.2 N NaOH at room temperature.

    Article Title: Probiotic supplements prevented oxonic acid-induced hyperuricemia and renal damage
    Article Snippet: In brief, amplicons were generated using primers that target approximately 400 base pairs of the V3V4 variable region of the 16S rRNA gene. .. PCR products were normalized using a SequalPrepTM kit (Invitrogen, Carlsbad, CA), pooled, lyophilized, purified and concentrated using a DNA Clean and Concentrator Kit (Zymo, Irvine, CA). .. The denatured PCR amplicon pool was diluted to 15 pM and spiked with 25% of the Illumina PhiX control DNA prior to loading the sequencer.

    Size-exclusion Chromatography:

    Article Title: Conditional Disruption of Hepatic Carbamoyl Phosphate Synthetase 1 in Mice Results in Hyperammonemia without Orotic Aciduria and Can be Corrected by Liver-Directed Gene Therapy
    Article Snippet: Twelve passing clones were then expanded and DNA extracted via Qiagen blood and tissue kit following manufacturer’s protocol. .. Approximately 50ng of DNA was tested by long range PCR across the 5′ arm as well as the 3′ distal loxP using Invitrogen SequalPrep long PCR Kit following manufacturer’s protocol with the following thermal cycling: 94°C for 2min; 10 cycles of 94°C for 15 sec, 65°C for 15 sec (↓1C/cycle), 68°C for 10 min; 25 cycles of 94°C for 15 sec, 55°C for 30 sec, 68°C for 10 min (+20 sec/cycle), hold at 4°C. .. 5′ long range PCR included a genomic forward primer TTTCAGCTTTTAAGGGACTAGCGTGC paired with a cassette reverse primer GGTGGTGTGGGAAAGGGTTCGAAG for an expected 6,007bp targeted band.

    Agarose Gel Electrophoresis:

    Article Title: Enhancer hijacking activates GFI1 family oncogenes in medulloblastoma
    Article Snippet: Only heterozygous SNPs covered by at least 4 sequencing reads in each data set were included in the final summary. .. PCR experiments were performed as follows: 10 ng of genomic DNA were used with the SequalPrep Long PCR Kit (Invitrogen) in 20 µl volumes using the following PCR conditions in a MJ Mini thermocycler (BioRad): 94C for 3 min, followed by 10 cycles of 94C for 10 s, 62C for 30 s and 68C for 6 min and 25 cycles of 94C for 10 s, 60C for 30 s and 68C for 7 min, followed by a final cycle of 72C for 10 min. PCR products were analyzed on a 1% agarose gel stained with Sybr Safe Dye (Invitrogen). .. Gel extracted bands using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel) were capillary sequenced at GATC Biotech AG to analyse SV breakpoints.

    Staining:

    Article Title: Enhancer hijacking activates GFI1 family oncogenes in medulloblastoma
    Article Snippet: Only heterozygous SNPs covered by at least 4 sequencing reads in each data set were included in the final summary. .. PCR experiments were performed as follows: 10 ng of genomic DNA were used with the SequalPrep Long PCR Kit (Invitrogen) in 20 µl volumes using the following PCR conditions in a MJ Mini thermocycler (BioRad): 94C for 3 min, followed by 10 cycles of 94C for 10 s, 62C for 30 s and 68C for 6 min and 25 cycles of 94C for 10 s, 60C for 30 s and 68C for 7 min, followed by a final cycle of 72C for 10 min. PCR products were analyzed on a 1% agarose gel stained with Sybr Safe Dye (Invitrogen). .. Gel extracted bands using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel) were capillary sequenced at GATC Biotech AG to analyse SV breakpoints.

    Sequencing:

    Article Title: Predicting the structure of soil communities from plant community taxonomy, phylogeny, and traits
    Article Snippet: All products for each sample were combined in equal volumes and cleaned using the UltraClean PCR Clean-Up Kit (Mo Bio Laboratories, Inc.). .. Illumina Nextera barcodes were added to the amplicons using an 8-cycle PCR, amplicons were cleaned and pooled using the SequalPrep kit (Invitrogen, Carlsbad, CA, USA), and sequenced on an Illumina MiSeq instrument with a 2x151 bp kit at the University of Colorado BioFrontiers sequencing facility. ..

    Amplification:

    Article Title: Functional Impact of An ADHD-Associated DIRAS2 Promoter Polymorphism
    Article Snippet: .. The exons of the DIRAS2 gene including exon–intron boundaries and untranslated regions including the promoter region, were amplified by polymerase chain reactions (PCRs) using either the iProof High Fidelity DNA Polymerase (Bio-Rad Laboratories, München, Germany) or the SequalPrep Long PCR Kit from Invitrogen (Invitrogen; see for primer sequences). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Thermo Fisher sequalprep long pcr kit
    Sequalprep Long Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sequalprep long pcr kit/product/Thermo Fisher
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    sequalprep long pcr kit - by Bioz Stars, 2021-04
    93/100 stars
      Buy from Supplier

    Image Search Results