sequalprep long pcr kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    SequalPrep Long PCR Kit
    Description:
    The SequalPrep Long PCR Kit with dNTPs provides the highest amplification success rate of any long range PCR kit tested across multiple organisms and platforms for non optimized amplicons up to 20 kB with little to no optimization Successful long range PCR with minimal optimization enables efficient PCR enrichment for a variety of applications including medical re sequencing on next generation sequencing NGS platforms PCR amplification is the traditional method to enrich target regions of the genome for genotyping and re sequencing applications To take advantage of the enhanced NGS processing capabilities higher throughput enrichment methods have become necessary Unfortunately the potential efficiency gains from long range PCR using available commercial solutions have been offset with lower amplification success rates limiting enrichment to 5 kB regions The SequalPrep Long PCR Kit with dNTPs overcomes these issues and provides the highest amplification success rate of any commercially available kit tested across multiple organisms and platforms for amplicons up to 20 kB with minimal optimization This kit can be used upstream of any NGS platform or for other genotyping applications When combined with the SequalPrep Normalization Plate the SequalPrep Sequence Equalization Sample Preparation System is the first complete PCR enrichment and amplicon equalization solution that provides a viable and efficient enrichment method to meet NGS re sequencing throughput capabilities This NGS Sample Prep system significantly reduces PCR amplification and normalization complexity to allow for enrichment of regions up to 1MB in a 96 well plate format Amplify and equalize with the ease of SequalPrep for consistently high coverage of your regions of interest
    Catalog Number:
    a10498
    Price:
    None
    Applications:
    DNA Sequencing|Kits & Reagents for Sanger Sequencing|Long Fragment PCR|PCR|PCR & Real-Time PCR|PCR Enzymes & Master Mixes|SOLiD® Next-Generation Sequencing|SOLiD® Next-Generation Sequencing Sample Enrichment|Sample & Library Preparation for SOLiD® Next-Generation Sequencing|Sanger Sequencing|Sanger Sequencing Technology & Accessories|Targeted Sequencing|Sequencing
    Category:
    Proteins Enzymes Peptides
    Buy from Supplier


    Structured Review

    Thermo Fisher sequalprep long pcr kit
    The SequalPrep Long PCR Kit with dNTPs provides the highest amplification success rate of any long range PCR kit tested across multiple organisms and platforms for non optimized amplicons up to 20 kB with little to no optimization Successful long range PCR with minimal optimization enables efficient PCR enrichment for a variety of applications including medical re sequencing on next generation sequencing NGS platforms PCR amplification is the traditional method to enrich target regions of the genome for genotyping and re sequencing applications To take advantage of the enhanced NGS processing capabilities higher throughput enrichment methods have become necessary Unfortunately the potential efficiency gains from long range PCR using available commercial solutions have been offset with lower amplification success rates limiting enrichment to 5 kB regions The SequalPrep Long PCR Kit with dNTPs overcomes these issues and provides the highest amplification success rate of any commercially available kit tested across multiple organisms and platforms for amplicons up to 20 kB with minimal optimization This kit can be used upstream of any NGS platform or for other genotyping applications When combined with the SequalPrep Normalization Plate the SequalPrep Sequence Equalization Sample Preparation System is the first complete PCR enrichment and amplicon equalization solution that provides a viable and efficient enrichment method to meet NGS re sequencing throughput capabilities This NGS Sample Prep system significantly reduces PCR amplification and normalization complexity to allow for enrichment of regions up to 1MB in a 96 well plate format Amplify and equalize with the ease of SequalPrep for consistently high coverage of your regions of interest
    https://www.bioz.com/result/sequalprep long pcr kit/product/Thermo Fisher
    Average 94 stars, based on 42 article reviews
    Price from $9.99 to $1999.99
    sequalprep long pcr kit - by Bioz Stars, 2020-08
    94/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: Multi-ethnic Cytochrome-P450 Copy Number Profiling: Novel Pharmacogenetic Alleles and Mechanism of Copy Number Variation Formation
    Article Snippet: .. CYP2B6 and CYP2E1 Sequence Analyses The breakpoint regions (~3 kb) of the CYP2B6 /2B7P1 fusion alleles (CYP2B6*29 and *30 ) were assessed by breakpoint-spanning PCR using overlapping primers ( ) and the SequalPrep™ Long PCR Kit (Invitrogen). .. In addition, long-range PCR was performed to generate CYP2B6 and CYP2B7P1 gene fusion-specific amplicons of 18 kb and 11 kb spanning exons 1–5 and exons 4–9, respectively, which were used as templates for exon and exon-intron junction sequencing using primers listed in .

    Polymerase Chain Reaction:

    Article Title: Multi-ethnic Cytochrome-P450 Copy Number Profiling: Novel Pharmacogenetic Alleles and Mechanism of Copy Number Variation Formation
    Article Snippet: .. CYP2B6 and CYP2E1 Sequence Analyses The breakpoint regions (~3 kb) of the CYP2B6 /2B7P1 fusion alleles (CYP2B6*29 and *30 ) were assessed by breakpoint-spanning PCR using overlapping primers ( ) and the SequalPrep™ Long PCR Kit (Invitrogen). .. In addition, long-range PCR was performed to generate CYP2B6 and CYP2B7P1 gene fusion-specific amplicons of 18 kb and 11 kb spanning exons 1–5 and exons 4–9, respectively, which were used as templates for exon and exon-intron junction sequencing using primers listed in .

    Article Title: OCA2 splice site variant in German Spitz dogs with oculocutaneous albinism
    Article Snippet: .. Long-range PCR A long-range PCR to was performed using the primer pair GGCAAACTTGGGAGTGGTAA (Chr3:31,659,781–31,659,762) and CCCCCTCAAATAAACCATGA (Chr3:32,346,375–32,346,356) and the SequalPrep™ Long PCR kit (Invitrogen). .. The PCR fragments were analyzed using FragmentAnalyzer™ (Advanced Analytical).

    Article Title: The BAF and PRC2 Complex Subunits Dpf2 and Eed Antagonistically Converge on Tbx3 to Control ESC Differentiation
    Article Snippet: .. Targeting of the second WT allele was confirmed by the presence of both the rWT allele and the second knockout allele through long-range PCR reactions (SequalPrep Long PCR kit, Invitrogen). ..

    Article Title: An Application of NGS for WDR36 Gene in Taiwanese Patients with Juvenile-Onset Open-Angle Glaucoma
    Article Snippet: .. Cycling profile of long range PCR was conducted as follows: one cycle at 94℃ for 2 min, followed by 10 cycles at 94℃ for 10 s, at 55℃ for 30 s, and at 68℃ for 14 min, followed by 30 cycles at 94℃ for 10 s, at 55℃ for 30 s, and at 68℃ for 14 min (+20 s every cycle), followed by a final extension step at 72℃ for 5 min, according to SequalPrepTM Long PCR Kit protocol (Invitrogen, USA). .. According to the manufacturer's instructions, PCR products were cleaned up using AMPure Reagent beads (Agencourt, Beverly, MA).

    Article Title: Conditional Disruption of Hepatic Carbamoyl Phosphate Synthetase 1 in Mice Results in Hyperammonemia without Orotic Aciduria and Can be Corrected by Liver-Directed Gene Therapy
    Article Snippet: .. Approximately 50ng of DNA was tested by long range PCR across the 5′ arm as well as the 3′ distal loxP using Invitrogen SequalPrep long PCR Kit following manufacturer’s protocol with the following thermal cycling: 94°C for 2min; 10 cycles of 94°C for 15 sec, 65°C for 15 sec (↓1C/cycle), 68°C for 10 min; 25 cycles of 94°C for 15 sec, 55°C for 30 sec, 68°C for 10 min (+20 sec/cycle), hold at 4°C. .. 5′ long range PCR included a genomic forward primer TTTCAGCTTTTAAGGGACTAGCGTGC paired with a cassette reverse primer GGTGGTGTGGGAAAGGGTTCGAAG for an expected 6,007bp targeted band.

    Article Title: Analysis of the chromosome X exome in patients with autism spectrum disorders identified novel candidate genes, including TMLHE
    Article Snippet: .. In addition, the presence of the deletion of exon 2 in TMLHE was confirmed by long-range PCR using the SequalPrep Long PCR kit (Invitrogen, Life Technologies Corporation, Carlsbad, CA, USA) according to the manufacturer's recommendations. ..

    Article Title: Large-scale screening and characterization of enteroviruses and kobuviruses infecting pigs in Vietnam
    Article Snippet: .. A SequalPrep long PCR kit (Life Technology) was used according to the manufacturer's instruction instead of GoTaq DNA polymerase to amplify fragments > 2 kb. .. Sequences were imported into sse ( ) for alignment and calculation of sequence divergence values from reference sequences of known EV types.

    Article Title: A higher throughput assay for quantification of melphalan-induced DNA damage in peripheral blood mononuclear cells
    Article Snippet: .. LA Taq DNA Polymerase (TaKaRa, Japan), Ex Taq Hot Start Version Kit (TaKaRa, Japan), and SequalPrep Long PCR Kit (Life Technologies, USA) failed to generate major products specific for the 6.8 kb target amplicon. .. This may be due to predicted G-quadruplex structures adjacent to the annealing site of the sense primer , ; G-quadruplexes can affect the proof-reading fidelity of long-range PCR DNA polymerases .

    Amplification:

    Article Title: A higher throughput assay for quantification of melphalan-induced DNA damage in peripheral blood mononuclear cells
    Article Snippet: .. LA Taq DNA Polymerase (TaKaRa, Japan), Ex Taq Hot Start Version Kit (TaKaRa, Japan), and SequalPrep Long PCR Kit (Life Technologies, USA) failed to generate major products specific for the 6.8 kb target amplicon. .. This may be due to predicted G-quadruplex structures adjacent to the annealing site of the sense primer , ; G-quadruplexes can affect the proof-reading fidelity of long-range PCR DNA polymerases .

    Size-exclusion Chromatography:

    Article Title: Conditional Disruption of Hepatic Carbamoyl Phosphate Synthetase 1 in Mice Results in Hyperammonemia without Orotic Aciduria and Can be Corrected by Liver-Directed Gene Therapy
    Article Snippet: .. Approximately 50ng of DNA was tested by long range PCR across the 5′ arm as well as the 3′ distal loxP using Invitrogen SequalPrep long PCR Kit following manufacturer’s protocol with the following thermal cycling: 94°C for 2min; 10 cycles of 94°C for 15 sec, 65°C for 15 sec (↓1C/cycle), 68°C for 10 min; 25 cycles of 94°C for 15 sec, 55°C for 30 sec, 68°C for 10 min (+20 sec/cycle), hold at 4°C. .. 5′ long range PCR included a genomic forward primer TTTCAGCTTTTAAGGGACTAGCGTGC paired with a cassette reverse primer GGTGGTGTGGGAAAGGGTTCGAAG for an expected 6,007bp targeted band.

    Knock-Out:

    Article Title: The BAF and PRC2 Complex Subunits Dpf2 and Eed Antagonistically Converge on Tbx3 to Control ESC Differentiation
    Article Snippet: .. Targeting of the second WT allele was confirmed by the presence of both the rWT allele and the second knockout allele through long-range PCR reactions (SequalPrep Long PCR kit, Invitrogen). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Thermo Fisher sequalprep long pcr kit
    Sequalprep Long Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sequalprep long pcr kit/product/Thermo Fisher
    Average 94 stars, based on 42 article reviews
    Price from $9.99 to $1999.99
    sequalprep long pcr kit - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    Image Search Results