s cerevisiae advanced gateway destination vector kit  (Addgene inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 87

    Structured Review

    Addgene inc s cerevisiae advanced gateway destination vector kit
    S Cerevisiae Advanced Gateway Destination Vector Kit, supplied by Addgene inc, used in various techniques. Bioz Stars score: 87/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/s cerevisiae advanced gateway destination vector kit/product/Addgene inc
    Average 87 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    s cerevisiae advanced gateway destination vector kit - by Bioz Stars, 2020-02
    87/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Engineering biosynthesis of the anticancer alkaloid noscapine in yeast
    Article Snippet: .. BP Clonase II Enzyme Mix, Gateway pDONR221 Vector and LR Clonase II Enzyme Mix (Life Technologies) and the S. cerevisiae Advanced Gateway Destination Vector Kit (Addgene) were used to perform Gateway Cloning. .. Gibson one-pot, isothermal DNA assembly was conducted at 10 μl scale by incubating T5 exonuclease (NEB), Phusion polymerase (NEB), Taq ligase (NEB) and 50 ng of each DNA fragment at 50 °C for 1 h to assemble multiple DNA fragments into one circular plasmid.

    Mutagenesis:

    Article Title: Engineering biosynthesis of the anticancer alkaloid noscapine in yeast
    Article Snippet: .. The mutant genes were subsequently recombined into pAG413GAL-ccdB from the S. cerevisiae Advanced Gateway Destination Vector Kit using LR Clonase II to generate pCS2844 and 3180–3182 ( ). ..

    Construct:

    Article Title: Engineering biosynthesis of the anticancer alkaloid noscapine in yeast
    Article Snippet: .. The genes were subsequently recombined into selected pAG expression vectors from the S. cerevisiae Advanced Gateway Destination Vector Kit using LR Clonase II to generate the corresponding pAG yeast expression constructs pCS3152–3154, 3158–3159, 3161, 3164–3165, 3168–3169, 3173–3174, 3177, 3179 and 3619 ( ). .. PsAT1 was amplified with primer PsAT1-F (5′- caccagaacttagtttcgacgg attctagaactagttatacaatgg ctaccatgtcatctgctgc -3′) and PsAT1-R (5′- attacatgactcgaggtcgacggtatcgat aagcttttagaataattgcaagatttctctcaagtggtgttc -3′) and inserted into pAG415GPD-ccdB digested with SacI and HindIII with yeast in vivo homologous recombination to yield pCS3124.

    Article Title: Engineering biosynthesis of the anticancer alkaloid noscapine in yeast
    Article Snippet: All DNA constructs were confirmed through DNA sequencing by Elim Biopharmaceuticals Inc. .. BP Clonase II Enzyme Mix, Gateway pDONR221 Vector and LR Clonase II Enzyme Mix (Life Technologies) and the S. cerevisiae Advanced Gateway Destination Vector Kit (Addgene) were used to perform Gateway Cloning.

    Purification:

    Article Title: Engineering biosynthesis of the anticancer alkaloid noscapine in yeast
    Article Snippet: PCR products were purified by Zymoclean Gel DNA Recovery Kit (Zymo Research). .. BP Clonase II Enzyme Mix, Gateway pDONR221 Vector and LR Clonase II Enzyme Mix (Life Technologies) and the S. cerevisiae Advanced Gateway Destination Vector Kit (Addgene) were used to perform Gateway Cloning.

    Plasmid Preparation:

    Article Title: Engineering biosynthesis of the anticancer alkaloid noscapine in yeast
    Article Snippet: .. The genes were subsequently recombined into selected pAG expression vectors from the S. cerevisiae Advanced Gateway Destination Vector Kit using LR Clonase II to generate the corresponding pAG yeast expression constructs pCS3152–3154, 3158–3159, 3161, 3164–3165, 3168–3169, 3173–3174, 3177, 3179 and 3619 ( ). .. PsAT1 was amplified with primer PsAT1-F (5′- caccagaacttagtttcgacgg attctagaactagttatacaatgg ctaccatgtcatctgctgc -3′) and PsAT1-R (5′- attacatgactcgaggtcgacggtatcgat aagcttttagaataattgcaagatttctctcaagtggtgttc -3′) and inserted into pAG415GPD-ccdB digested with SacI and HindIII with yeast in vivo homologous recombination to yield pCS3124.

    Article Title: Engineering biosynthesis of the anticancer alkaloid noscapine in yeast
    Article Snippet: .. The mutant genes were subsequently recombined into pAG413GAL-ccdB from the S. cerevisiae Advanced Gateway Destination Vector Kit using LR Clonase II to generate pCS2844 and 3180–3182 ( ). ..

    Article Title: Engineering biosynthesis of the anticancer alkaloid noscapine in yeast
    Article Snippet: .. BP Clonase II Enzyme Mix, Gateway pDONR221 Vector and LR Clonase II Enzyme Mix (Life Technologies) and the S. cerevisiae Advanced Gateway Destination Vector Kit (Addgene) were used to perform Gateway Cloning. .. Gibson one-pot, isothermal DNA assembly was conducted at 10 μl scale by incubating T5 exonuclease (NEB), Phusion polymerase (NEB), Taq ligase (NEB) and 50 ng of each DNA fragment at 50 °C for 1 h to assemble multiple DNA fragments into one circular plasmid.

    DNA Sequencing:

    Article Title: Engineering biosynthesis of the anticancer alkaloid noscapine in yeast
    Article Snippet: All DNA constructs were confirmed through DNA sequencing by Elim Biopharmaceuticals Inc. .. BP Clonase II Enzyme Mix, Gateway pDONR221 Vector and LR Clonase II Enzyme Mix (Life Technologies) and the S. cerevisiae Advanced Gateway Destination Vector Kit (Addgene) were used to perform Gateway Cloning.

    Expressing:

    Article Title: Engineering biosynthesis of the anticancer alkaloid noscapine in yeast
    Article Snippet: .. The genes were subsequently recombined into selected pAG expression vectors from the S. cerevisiae Advanced Gateway Destination Vector Kit using LR Clonase II to generate the corresponding pAG yeast expression constructs pCS3152–3154, 3158–3159, 3161, 3164–3165, 3168–3169, 3173–3174, 3177, 3179 and 3619 ( ). .. PsAT1 was amplified with primer PsAT1-F (5′- caccagaacttagtttcgacgg attctagaactagttatacaatgg ctaccatgtcatctgctgc -3′) and PsAT1-R (5′- attacatgactcgaggtcgacggtatcgat aagcttttagaataattgcaagatttctctcaagtggtgttc -3′) and inserted into pAG415GPD-ccdB digested with SacI and HindIII with yeast in vivo homologous recombination to yield pCS3124.

    Polymerase Chain Reaction:

    Article Title: Engineering biosynthesis of the anticancer alkaloid noscapine in yeast
    Article Snippet: PCR products were purified by Zymoclean Gel DNA Recovery Kit (Zymo Research). .. BP Clonase II Enzyme Mix, Gateway pDONR221 Vector and LR Clonase II Enzyme Mix (Life Technologies) and the S. cerevisiae Advanced Gateway Destination Vector Kit (Addgene) were used to perform Gateway Cloning.

    Homologous Recombination:

    Article Title: Engineering biosynthesis of the anticancer alkaloid noscapine in yeast
    Article Snippet: BP Clonase II Enzyme Mix, Gateway pDONR221 Vector and LR Clonase II Enzyme Mix (Life Technologies) and the S. cerevisiae Advanced Gateway Destination Vector Kit (Addgene) were used to perform Gateway Cloning. .. Yeast strains are constructed through homologous recombination and DNA assembly .

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 87
    Addgene inc s cerevisiae advanced gateway destination vector kit
    S Cerevisiae Advanced Gateway Destination Vector Kit, supplied by Addgene inc, used in various techniques. Bioz Stars score: 87/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/s cerevisiae advanced gateway destination vector kit/product/Addgene inc
    Average 87 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    s cerevisiae advanced gateway destination vector kit - by Bioz Stars, 2020-02
    87/100 stars
      Buy from Supplier

    Image Search Results