Structured Review

Promega rutp
Rutp, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rutp/product/Promega
Average 93 stars, based on 12 article reviews
Price from $9.99 to $1999.99
rutp - by Bioz Stars, 2020-01
93/100 stars

Images

Related Articles

Clone Assay:

Article Title: RNA Directed Modulation of Phenotypic Plasticity in Human Cells
Article Snippet: Midi prepped (QIAGEN plasmid Midi Kit) clones were transfected along with the pcDNA3.1-GFP control [ ] into target cells using lipofectamine 2000 (Life Technologies, Carlsbad, CA, USA). .. Generating Biotin Labeled RNA Transcripts- Biotin labeled RNA transcripts of Retro-EFI2S2 and GFP were generated by adding the following components into an 8 well PCR strip: (2.5μg of DNA template, 2μl T7 Enzyme mix (Sigma), 1ul rATP, rGTP, rCTP, rUTP (Promega), 1μl Biotin-14-CTP (Life Technologies), 2.5μl 1M DTT (Sigma) and 1μl RNase Inhibitor (Life Technologies)(as described in [ ]).

Article Title: Distinct structural features of TFAM drive mitochondrial DNA packaging versus transcriptional activation
Article Snippet: The engineered promoters were synthesized by PCR with the appropriate oligonucleotides and cloned into the pSP65 vector at the BamHI and SalI sites. .. Transcription reactions were performed in a total volume of 20 μL [10 mM HEPES (pH 7.5), 10 mM MgCl2 , 1 mM DTT, 100 μg/mL BSA, 400 μM ATP, 150 μM rCTP, 150 μM rGTP, 15 μM rUTP (Promega), 0.2 μM [α-32 P] rUTP (3,000 Ci/mmol, Perkin Elmer), 7.5 nM template DNA, and 40 units of RNaseOut (Invitrogen)].

Article Title: A Nucleus-Encoded Chloroplast Phosphoprotein Governs Expression of the Photosystem I Subunit PsaC in Chlamydomonas reinhardtii
Article Snippet: A vector for the preparation of the RNA probe was obtained by cloning the following sequence in the TOPO pCR2.1 (Invitrogen) vector: TAATACGACTCACTATAG GGAGA AAGTCGATTCTCAATCTTCTTTTTGATATGGAGATGACATATTTAGCACA A TCGAT . .. The vector was digested with Apa I (in the vector) and Cla I (shown above in italics), leading to a fragment of 139 bp, which was purified by agarose gel electrophoresis and transcribed in vitro with T7 RNA polymerase (Promega) for 2 h at 30°C in a 20-μL reaction mixture containing: 4 μL transcription buffer (Promega), 1 μL 1 mM rUTP, 1 μL each 10 mM stocks of the three other nucleotide triphosphates, 3 μL 32 P-rUTP at 10 mCi mL−1 and 3000 Ci mmol−1 , 1 μL RNase-in (Promega), 1 μL 20 mM DTT, 1 μL T7 polymerase, and 200 ng probe.

Centrifugation:

Article Title: Virus Particle Core Defects Caused by Mutations in the Human Immunodeficiency Virus Capsid N-Terminal Domain
Article Snippet: TCA precipitates were pelleted by centrifugation for 10 min at 4°C, 13,600 × g , and were washed five times with 10% TCA prior to radioactivity quantitation in a scintillation counter. .. Probes for RNase protection assays were made by incubation of 1 μg of EcoRI-linearized template plasmid (BlueHX 680-831) with transcription buffer (40 mM Tris [pH 7.4], 10 mM DTT, 6 mM MgCl2 , 0.8 mM spermidine), 100 μCi of [α-32 P]rGTP, 0.5 mM each of rATP, rCTP, and rUTP, 1 μl of RNasin (Promega), 1 mM DTT, and 20 U of T3 polymerase (Promega) at 37°C for 1 h. Probes then were ethanol precipitated, dried, resuspended, separated on 5% sequencing gels, eluted, and reprecipitated prior to use ( ).

Amplification:

Article Title: RNA mutagenesis yields highly diverse mRNA libraries for in vitro protein evolution
Article Snippet: Run off transcription on the linear DNA template was performed by adding 40 mM Tris-HCl (pH 7.9), 6 mM MgCl2 , 2 mM spermidine, 10 mM dithiothreitol, 1 mM each of rCTP, rUTP, rGTP, and rATP, 2 U RNase inhibitor (Promega), 20 U T7 polymerase (Promega) to 200 ng DNA template and incubating at 37°C overnight. .. RNA was DNase-treated to remove the DNA template (RQ1 DNase, Promega) and purified (RNeasy, Qiagen) prior to amplification with Qβ replicase.

Article Title: Long-Term Follow-Up of Chimpanzees Inoculated with the First Infectious Clone for Hepatitis C Virus
Article Snippet: Duplicate RNA samples were amplified with the TaqMan EZ RT-PCR kit and a TaqMan fluorogenic probe labeled with FAM (6-carboxy-fluorescein) and TAMRA (6-carboxytetramethylrhodamine) (PE-Applied Biosystems) at the 5′ and 3′ ends, respectively. .. The 100-μl reaction mixture, containing 20 μl of 5× T7 buffer; 7.5 mM (each) rATP, rCTP, rGTP, and rUTP; 2 μg of DNA; and 10 μl of enzyme mixture was incubated at 37°C for 2 h and then treated with 10 U of RNase-free DNase (Promega) for 30 min at 37°C.

Synthesized:

Article Title: RNA Directed Modulation of Phenotypic Plasticity in Human Cells
Article Snippet: Generation of Retro-EIF2S2 and Retro-Cox6A RNA expressing clones- The parental pcDNA3.1 plasmid was used and the respective lncRNA sequences of either Retro-Cox6A or Retro-EIF2S2, or truncated forms of Retro-EIF2S2 ( ) were synthesized and generated commercially (Genewiz, Inc La Jolla, CA, USA). .. Generating Biotin Labeled RNA Transcripts- Biotin labeled RNA transcripts of Retro-EFI2S2 and GFP were generated by adding the following components into an 8 well PCR strip: (2.5μg of DNA template, 2μl T7 Enzyme mix (Sigma), 1ul rATP, rGTP, rCTP, rUTP (Promega), 1μl Biotin-14-CTP (Life Technologies), 2.5μl 1M DTT (Sigma) and 1μl RNase Inhibitor (Life Technologies)(as described in [ ]).

Article Title: Distinct structural features of TFAM drive mitochondrial DNA packaging versus transcriptional activation
Article Snippet: The engineered promoters were synthesized by PCR with the appropriate oligonucleotides and cloned into the pSP65 vector at the BamHI and SalI sites. .. Transcription reactions were performed in a total volume of 20 μL [10 mM HEPES (pH 7.5), 10 mM MgCl2 , 1 mM DTT, 100 μg/mL BSA, 400 μM ATP, 150 μM rCTP, 150 μM rGTP, 15 μM rUTP (Promega), 0.2 μM [α-32 P] rUTP (3,000 Ci/mmol, Perkin Elmer), 7.5 nM template DNA, and 40 units of RNaseOut (Invitrogen)].

Article Title: mRNA Decay during Herpes Simplex Virus (HSV) Infections: Mutations That Affect Translation of an mRNA Influence the Sites at Which It Is Cleaved by the HSV Virion Host Shutoff (Vhs) Protein
Article Snippet: .. Capped internally labeled pBK2 mRNA was synthesized using an SP6 Riboprobe in vitro transcription system (Promega) in reactions that included 0.5 mM (each) rATP, rUTP, and rCTP, 50 μM rGTP, 50 μCi [α-32 P]GTP, and 0.5 mM Ribo m7 G cap analog (Promega). .. After in vitro transcription, template DNA was removed by digestion with RQ1 DNase (Promega). mRNAs were extracted twice with phenol-chloroform, precipitated from ethanol, and resuspended in a small volume of water.

Article Title: Chemokine Gene Expression in Astrocytes of Borna Disease Virus-Infected Rats and Mice in the Absence of Inflammation
Article Snippet: .. The radiolabeled antisense RPA probe set was synthesized in a volume of 20 μl containing 100 μCi of [α-32 P]UTP (3,000 Ci/mmol); dithiothreitol (200 nmol); transcription buffer (Promega); 1 μl of template DNA; rUTP (61 pmol); rGTP, rATP, and rCTP (2.75 nmol each); RNase inhibitor (28 U; Pharmacia); and T7 polymerase (20 U; Promega). .. After 1 h of incubation at 37°C, the template DNAs were digested by treatment with DNase I (4 U; Ambion) for 30 min at 37°C.

Construct:

Article Title: Distinct structural features of TFAM drive mitochondrial DNA packaging versus transcriptional activation
Article Snippet: EP1 was constructed by reversing the TFAM binding site at HSP1, and EP2 was made by subcloning the TFAM binding site from LSP into HSP1. .. Transcription reactions were performed in a total volume of 20 μL [10 mM HEPES (pH 7.5), 10 mM MgCl2 , 1 mM DTT, 100 μg/mL BSA, 400 μM ATP, 150 μM rCTP, 150 μM rGTP, 15 μM rUTP (Promega), 0.2 μM [α-32 P] rUTP (3,000 Ci/mmol, Perkin Elmer), 7.5 nM template DNA, and 40 units of RNaseOut (Invitrogen)].

Real-time Polymerase Chain Reaction:

Article Title: Characterization of Multiple Exon 1 Variants in Mammalian HuD mRNA and Neuron-Specific Transcriptional Control via Neurogenin 2
Article Snippet: Nuclei were split into two aliquots and incubated in a transcription reaction mix containing 20% glycerol, 30 m m Tris-HCl pH 8.0, 2.5 m m MgCl2 , 150 m m KCl, 1 m m DTT, 40U of Rnasin and 0.5 m m rATP, rCTP, rGTP, and rUTP (+) or diethylpyrocarbonate (DEPC)-treated water (−) (Promega). .. Reactions were incubated for 30 min at 30°C, then RNA was TRIzol extracted and real-time qPCR was performed with HuD and 18S primers.

Incubation:

Article Title: Distinct structural features of TFAM drive mitochondrial DNA packaging versus transcriptional activation
Article Snippet: Transcription reactions were performed in a total volume of 20 μL [10 mM HEPES (pH 7.5), 10 mM MgCl2 , 1 mM DTT, 100 μg/mL BSA, 400 μM ATP, 150 μM rCTP, 150 μM rGTP, 15 μM rUTP (Promega), 0.2 μM [α-32 P] rUTP (3,000 Ci/mmol, Perkin Elmer), 7.5 nM template DNA, and 40 units of RNaseOut (Invitrogen)]. .. After addition of rNTPs, the reaction was incubated for 3 h at 33°C and stopped by addition of 25 μL of stop buffer (80% formamide, 10 mM EDTA, pH 8.0, 0.025% xylene cyanol, 0.025% bromophenol blue).

Article Title: Characterization of Multiple Exon 1 Variants in Mammalian HuD mRNA and Neuron-Specific Transcriptional Control via Neurogenin 2
Article Snippet: .. Nuclei were split into two aliquots and incubated in a transcription reaction mix containing 20% glycerol, 30 m m Tris-HCl pH 8.0, 2.5 m m MgCl2 , 150 m m KCl, 1 m m DTT, 40U of Rnasin and 0.5 m m rATP, rCTP, rGTP, and rUTP (+) or diethylpyrocarbonate (DEPC)-treated water (−) (Promega). .. Reactions were incubated for 30 min at 30°C, then RNA was TRIzol extracted and real-time qPCR was performed with HuD and 18S primers.

Article Title: I-PfoP3I: A Novel Nicking HNH Homing Endonuclease Encoded in the Group I Intron of the DNA Polymerase Gene in Phormidium foveolarum Phage Pf-WMP3
Article Snippet: .. The XhoI linearized pETP3DNAP[+int] (1 µg) was incubated with 40 mM Tris-HCl (pH 7.9), 10 mM NaCl, 6 mM MgCl2 , 2 mM spermidine, 10 mM DTT, 40 u Recombinant RNasin Ribonuclease Inhibitor, 0.5 mM each of rATP, rGTP, rCTP and rUTP, 20 u T7 RNA Polymerase in a total volume of 20 µl at 37°C for 1 h. Template DNA was digested with RNase-free DNaseI (Promega). .. Reverse transcription was performed using sequence-specific primer P3r2 and M-MLV Reverse Transcriptase (Promega) according to the manufacturer’s recommendations.

Article Title: Virus Particle Core Defects Caused by Mutations in the Human Immunodeficiency Virus Capsid N-Terminal Domain
Article Snippet: .. Probes for RNase protection assays were made by incubation of 1 μg of EcoRI-linearized template plasmid (BlueHX 680-831) with transcription buffer (40 mM Tris [pH 7.4], 10 mM DTT, 6 mM MgCl2 , 0.8 mM spermidine), 100 μCi of [α-32 P]rGTP, 0.5 mM each of rATP, rCTP, and rUTP, 1 μl of RNasin (Promega), 1 mM DTT, and 20 U of T3 polymerase (Promega) at 37°C for 1 h. Probes then were ethanol precipitated, dried, resuspended, separated on 5% sequencing gels, eluted, and reprecipitated prior to use ( ). ..

Article Title: Long-Term Follow-Up of Chimpanzees Inoculated with the First Infectious Clone for Hepatitis C Virus
Article Snippet: .. The 100-μl reaction mixture, containing 20 μl of 5× T7 buffer; 7.5 mM (each) rATP, rCTP, rGTP, and rUTP; 2 μg of DNA; and 10 μl of enzyme mixture was incubated at 37°C for 2 h and then treated with 10 U of RNase-free DNase (Promega) for 30 min at 37°C. ..

Article Title: Chemokine Gene Expression in Astrocytes of Borna Disease Virus-Infected Rats and Mice in the Absence of Inflammation
Article Snippet: The radiolabeled antisense RPA probe set was synthesized in a volume of 20 μl containing 100 μCi of [α-32 P]UTP (3,000 Ci/mmol); dithiothreitol (200 nmol); transcription buffer (Promega); 1 μl of template DNA; rUTP (61 pmol); rGTP, rATP, and rCTP (2.75 nmol each); RNase inhibitor (28 U; Pharmacia); and T7 polymerase (20 U; Promega). .. After 1 h of incubation at 37°C, the template DNAs were digested by treatment with DNase I (4 U; Ambion) for 30 min at 37°C.

Stripping Membranes:

Article Title: RNA Directed Modulation of Phenotypic Plasticity in Human Cells
Article Snippet: .. Generating Biotin Labeled RNA Transcripts- Biotin labeled RNA transcripts of Retro-EFI2S2 and GFP were generated by adding the following components into an 8 well PCR strip: (2.5μg of DNA template, 2μl T7 Enzyme mix (Sigma), 1ul rATP, rGTP, rCTP, rUTP (Promega), 1μl Biotin-14-CTP (Life Technologies), 2.5μl 1M DTT (Sigma) and 1μl RNase Inhibitor (Life Technologies)(as described in [ ]). .. The reaction volume was made up to 50μl with RNase free water (QIAGEN).

Expressing:

Article Title: RNA Directed Modulation of Phenotypic Plasticity in Human Cells
Article Snippet: Generation of Retro-EIF2S2 and Retro-Cox6A RNA expressing clones- The parental pcDNA3.1 plasmid was used and the respective lncRNA sequences of either Retro-Cox6A or Retro-EIF2S2, or truncated forms of Retro-EIF2S2 ( ) were synthesized and generated commercially (Genewiz, Inc La Jolla, CA, USA). .. Generating Biotin Labeled RNA Transcripts- Biotin labeled RNA transcripts of Retro-EFI2S2 and GFP were generated by adding the following components into an 8 well PCR strip: (2.5μg of DNA template, 2μl T7 Enzyme mix (Sigma), 1ul rATP, rGTP, rCTP, rUTP (Promega), 1μl Biotin-14-CTP (Life Technologies), 2.5μl 1M DTT (Sigma) and 1μl RNase Inhibitor (Life Technologies)(as described in [ ]).

Article Title: Characterization of Multiple Exon 1 Variants in Mammalian HuD mRNA and Neuron-Specific Transcriptional Control via Neurogenin 2
Article Snippet: Nuclei were split into two aliquots and incubated in a transcription reaction mix containing 20% glycerol, 30 m m Tris-HCl pH 8.0, 2.5 m m MgCl2 , 150 m m KCl, 1 m m DTT, 40U of Rnasin and 0.5 m m rATP, rCTP, rGTP, and rUTP (+) or diethylpyrocarbonate (DEPC)-treated water (−) (Promega). .. Expression levels were quantified using the ΔΔCt method and values were normalized to 18S rRNA.

Article Title: Chemokine Gene Expression in Astrocytes of Borna Disease Virus-Infected Rats and Mice in the Absence of Inflammation
Article Snippet: L32 was included in the riboprobe set to detect transcripts of the ribosomal protein L32 (encoded by a housekeeping gene), permitting normalization of chemokine mRNA expression. .. The radiolabeled antisense RPA probe set was synthesized in a volume of 20 μl containing 100 μCi of [α-32 P]UTP (3,000 Ci/mmol); dithiothreitol (200 nmol); transcription buffer (Promega); 1 μl of template DNA; rUTP (61 pmol); rGTP, rATP, and rCTP (2.75 nmol each); RNase inhibitor (28 U; Pharmacia); and T7 polymerase (20 U; Promega).

Splicing Assay:

Article Title: I-PfoP3I: A Novel Nicking HNH Homing Endonuclease Encoded in the Group I Intron of the DNA Polymerase Gene in Phormidium foveolarum Phage Pf-WMP3
Article Snippet: Paragraph title: In vitro Transcription and Splicing Assay ... The XhoI linearized pETP3DNAP[+int] (1 µg) was incubated with 40 mM Tris-HCl (pH 7.9), 10 mM NaCl, 6 mM MgCl2 , 2 mM spermidine, 10 mM DTT, 40 u Recombinant RNasin Ribonuclease Inhibitor, 0.5 mM each of rATP, rGTP, rCTP and rUTP, 20 u T7 RNA Polymerase in a total volume of 20 µl at 37°C for 1 h. Template DNA was digested with RNase-free DNaseI (Promega).

Recombinase Polymerase Amplification:

Article Title: Chemokine Gene Expression in Astrocytes of Borna Disease Virus-Infected Rats and Mice in the Absence of Inflammation
Article Snippet: .. The radiolabeled antisense RPA probe set was synthesized in a volume of 20 μl containing 100 μCi of [α-32 P]UTP (3,000 Ci/mmol); dithiothreitol (200 nmol); transcription buffer (Promega); 1 μl of template DNA; rUTP (61 pmol); rGTP, rATP, and rCTP (2.75 nmol each); RNase inhibitor (28 U; Pharmacia); and T7 polymerase (20 U; Promega). .. After 1 h of incubation at 37°C, the template DNAs were digested by treatment with DNase I (4 U; Ambion) for 30 min at 37°C.

RNA Binding Assay:

Article Title: A Nucleus-Encoded Chloroplast Phosphoprotein Governs Expression of the Photosystem I Subunit PsaC in Chlamydomonas reinhardtii
Article Snippet: Paragraph title: Mac1 Purification and RNA Binding Assays ... The vector was digested with Apa I (in the vector) and Cla I (shown above in italics), leading to a fragment of 139 bp, which was purified by agarose gel electrophoresis and transcribed in vitro with T7 RNA polymerase (Promega) for 2 h at 30°C in a 20-μL reaction mixture containing: 4 μL transcription buffer (Promega), 1 μL 1 mM rUTP, 1 μL each 10 mM stocks of the three other nucleotide triphosphates, 3 μL 32 P-rUTP at 10 mCi mL−1 and 3000 Ci mmol−1 , 1 μL RNase-in (Promega), 1 μL 20 mM DTT, 1 μL T7 polymerase, and 200 ng probe.

Hybridization:

Article Title: Chemokine Gene Expression in Astrocytes of Borna Disease Virus-Infected Rats and Mice in the Absence of Inflammation
Article Snippet: The radiolabeled antisense RPA probe set was synthesized in a volume of 20 μl containing 100 μCi of [α-32 P]UTP (3,000 Ci/mmol); dithiothreitol (200 nmol); transcription buffer (Promega); 1 μl of template DNA; rUTP (61 pmol); rGTP, rATP, and rCTP (2.75 nmol each); RNase inhibitor (28 U; Pharmacia); and T7 polymerase (20 U; Promega). .. After extraction with phenol-chloroform, probes were precipitated with ethanol in the presence of mussel glycogen (20 μg; Roche Molecular Biochemicals), dried, and dissolved (3 × 105 cpm/μl) in hybridization buffer 1 [40 mM piperazine- N , N ′-bis(2-ethanesulfonic acid) (PIPES) [pH 6.4], 0.4 M NaCl, 1 mM EDTA, 80% formamide].

Countercurrent Chromatography:

Article Title: RNA mutagenesis yields highly diverse mRNA libraries for in vitro protein evolution
Article Snippet: T7 polymerase often inserts a terminal A nucleotide to the 3' CCC sequence, however, this did not appear to significantly influence RNA template recognition. .. Run off transcription on the linear DNA template was performed by adding 40 mM Tris-HCl (pH 7.9), 6 mM MgCl2 , 2 mM spermidine, 10 mM dithiothreitol, 1 mM each of rCTP, rUTP, rGTP, and rATP, 2 U RNase inhibitor (Promega), 20 U T7 polymerase (Promega) to 200 ng DNA template and incubating at 37°C overnight.

Transfection:

Article Title: RNA Directed Modulation of Phenotypic Plasticity in Human Cells
Article Snippet: Midi prepped (QIAGEN plasmid Midi Kit) clones were transfected along with the pcDNA3.1-GFP control [ ] into target cells using lipofectamine 2000 (Life Technologies, Carlsbad, CA, USA). .. Generating Biotin Labeled RNA Transcripts- Biotin labeled RNA transcripts of Retro-EFI2S2 and GFP were generated by adding the following components into an 8 well PCR strip: (2.5μg of DNA template, 2μl T7 Enzyme mix (Sigma), 1ul rATP, rGTP, rCTP, rUTP (Promega), 1μl Biotin-14-CTP (Life Technologies), 2.5μl 1M DTT (Sigma) and 1μl RNase Inhibitor (Life Technologies)(as described in [ ]).

Sequencing:

Article Title: RNA mutagenesis yields highly diverse mRNA libraries for in vitro protein evolution
Article Snippet: T7 polymerase often inserts a terminal A nucleotide to the 3' CCC sequence, however, this did not appear to significantly influence RNA template recognition. .. Run off transcription on the linear DNA template was performed by adding 40 mM Tris-HCl (pH 7.9), 6 mM MgCl2 , 2 mM spermidine, 10 mM dithiothreitol, 1 mM each of rCTP, rUTP, rGTP, and rATP, 2 U RNase inhibitor (Promega), 20 U T7 polymerase (Promega) to 200 ng DNA template and incubating at 37°C overnight.

Article Title: I-PfoP3I: A Novel Nicking HNH Homing Endonuclease Encoded in the Group I Intron of the DNA Polymerase Gene in Phormidium foveolarum Phage Pf-WMP3
Article Snippet: The XhoI linearized pETP3DNAP[+int] (1 µg) was incubated with 40 mM Tris-HCl (pH 7.9), 10 mM NaCl, 6 mM MgCl2 , 2 mM spermidine, 10 mM DTT, 40 u Recombinant RNasin Ribonuclease Inhibitor, 0.5 mM each of rATP, rGTP, rCTP and rUTP, 20 u T7 RNA Polymerase in a total volume of 20 µl at 37°C for 1 h. Template DNA was digested with RNase-free DNaseI (Promega). .. Reverse transcription was performed using sequence-specific primer P3r2 and M-MLV Reverse Transcriptase (Promega) according to the manufacturer’s recommendations.

Article Title: A Nucleus-Encoded Chloroplast Phosphoprotein Governs Expression of the Photosystem I Subunit PsaC in Chlamydomonas reinhardtii
Article Snippet: A vector for the preparation of the RNA probe was obtained by cloning the following sequence in the TOPO pCR2.1 (Invitrogen) vector: TAATACGACTCACTATAG GGAGA AAGTCGATTCTCAATCTTCTTTTTGATATGGAGATGACATATTTAGCACA A TCGAT . .. The vector was digested with Apa I (in the vector) and Cla I (shown above in italics), leading to a fragment of 139 bp, which was purified by agarose gel electrophoresis and transcribed in vitro with T7 RNA polymerase (Promega) for 2 h at 30°C in a 20-μL reaction mixture containing: 4 μL transcription buffer (Promega), 1 μL 1 mM rUTP, 1 μL each 10 mM stocks of the three other nucleotide triphosphates, 3 μL 32 P-rUTP at 10 mCi mL−1 and 3000 Ci mmol−1 , 1 μL RNase-in (Promega), 1 μL 20 mM DTT, 1 μL T7 polymerase, and 200 ng probe.

Article Title: Virus Particle Core Defects Caused by Mutations in the Human Immunodeficiency Virus Capsid N-Terminal Domain
Article Snippet: .. Probes for RNase protection assays were made by incubation of 1 μg of EcoRI-linearized template plasmid (BlueHX 680-831) with transcription buffer (40 mM Tris [pH 7.4], 10 mM DTT, 6 mM MgCl2 , 0.8 mM spermidine), 100 μCi of [α-32 P]rGTP, 0.5 mM each of rATP, rCTP, and rUTP, 1 μl of RNasin (Promega), 1 mM DTT, and 20 U of T3 polymerase (Promega) at 37°C for 1 h. Probes then were ethanol precipitated, dried, resuspended, separated on 5% sequencing gels, eluted, and reprecipitated prior to use ( ). ..

Immunoprecipitation:

Article Title: Wnt-5a mRNA translation is suppressed by the Elav-like protein HuR in human breast epithelial cells
Article Snippet: For UV-crosslink immunoprecipitation experiments the probes were also labelled with Digoxigenin (Roche). .. The cold probe was prepared using rUTP (Promega) instead of radiolabelled-UTP.

Serial Dilution:

Article Title: Long-Term Follow-Up of Chimpanzees Inoculated with the First Infectious Clone for Hepatitis C Virus
Article Snippet: The 100-μl reaction mixture, containing 20 μl of 5× T7 buffer; 7.5 mM (each) rATP, rCTP, rGTP, and rUTP; 2 μg of DNA; and 10 μl of enzyme mixture was incubated at 37°C for 2 h and then treated with 10 U of RNase-free DNase (Promega) for 30 min at 37°C. .. Standards of 105 , 104 , 103 , 102 , 101 , and 100 RNA copies/μl were prepared by serial dilution of the stock RNA in RNasin-DTT water containing 10 μg of tRNA/ml and stored at −80°C.

Generated:

Article Title: RNA Directed Modulation of Phenotypic Plasticity in Human Cells
Article Snippet: .. Generating Biotin Labeled RNA Transcripts- Biotin labeled RNA transcripts of Retro-EFI2S2 and GFP were generated by adding the following components into an 8 well PCR strip: (2.5μg of DNA template, 2μl T7 Enzyme mix (Sigma), 1ul rATP, rGTP, rCTP, rUTP (Promega), 1μl Biotin-14-CTP (Life Technologies), 2.5μl 1M DTT (Sigma) and 1μl RNase Inhibitor (Life Technologies)(as described in [ ]). .. The reaction volume was made up to 50μl with RNase free water (QIAGEN).

Polymerase Chain Reaction:

Article Title: RNA Directed Modulation of Phenotypic Plasticity in Human Cells
Article Snippet: .. Generating Biotin Labeled RNA Transcripts- Biotin labeled RNA transcripts of Retro-EFI2S2 and GFP were generated by adding the following components into an 8 well PCR strip: (2.5μg of DNA template, 2μl T7 Enzyme mix (Sigma), 1ul rATP, rGTP, rCTP, rUTP (Promega), 1μl Biotin-14-CTP (Life Technologies), 2.5μl 1M DTT (Sigma) and 1μl RNase Inhibitor (Life Technologies)(as described in [ ]). .. The reaction volume was made up to 50μl with RNase free water (QIAGEN).

Article Title: Distinct structural features of TFAM drive mitochondrial DNA packaging versus transcriptional activation
Article Snippet: The engineered promoters were synthesized by PCR with the appropriate oligonucleotides and cloned into the pSP65 vector at the BamHI and SalI sites. .. Transcription reactions were performed in a total volume of 20 μL [10 mM HEPES (pH 7.5), 10 mM MgCl2 , 1 mM DTT, 100 μg/mL BSA, 400 μM ATP, 150 μM rCTP, 150 μM rGTP, 15 μM rUTP (Promega), 0.2 μM [α-32 P] rUTP (3,000 Ci/mmol, Perkin Elmer), 7.5 nM template DNA, and 40 units of RNaseOut (Invitrogen)].

Article Title: I-PfoP3I: A Novel Nicking HNH Homing Endonuclease Encoded in the Group I Intron of the DNA Polymerase Gene in Phormidium foveolarum Phage Pf-WMP3
Article Snippet: The XhoI linearized pETP3DNAP[+int] (1 µg) was incubated with 40 mM Tris-HCl (pH 7.9), 10 mM NaCl, 6 mM MgCl2 , 2 mM spermidine, 10 mM DTT, 40 u Recombinant RNasin Ribonuclease Inhibitor, 0.5 mM each of rATP, rGTP, rCTP and rUTP, 20 u T7 RNA Polymerase in a total volume of 20 µl at 37°C for 1 h. Template DNA was digested with RNase-free DNaseI (Promega). .. PCR was carried out using primers P3f3 and P3r2.

Injection:

Article Title: A Nucleus-Encoded Chloroplast Phosphoprotein Governs Expression of the Photosystem I Subunit PsaC in Chlamydomonas reinhardtii
Article Snippet: The extract was then directly injected onto the size exclusion column (HiLoad Sephadex 200 16/60, AKTA system; GE Healthcare) and eluted in column buffer (50 mM Tris, pH 7.7, 250 mM NaCl, 4 mM DTT, and 10% [v/v] glycerol) at 0.6 mL⋅min−1 . .. The vector was digested with Apa I (in the vector) and Cla I (shown above in italics), leading to a fragment of 139 bp, which was purified by agarose gel electrophoresis and transcribed in vitro with T7 RNA polymerase (Promega) for 2 h at 30°C in a 20-μL reaction mixture containing: 4 μL transcription buffer (Promega), 1 μL 1 mM rUTP, 1 μL each 10 mM stocks of the three other nucleotide triphosphates, 3 μL 32 P-rUTP at 10 mCi mL−1 and 3000 Ci mmol−1 , 1 μL RNase-in (Promega), 1 μL 20 mM DTT, 1 μL T7 polymerase, and 200 ng probe.

Binding Assay:

Article Title: Distinct structural features of TFAM drive mitochondrial DNA packaging versus transcriptional activation
Article Snippet: EP1 was constructed by reversing the TFAM binding site at HSP1, and EP2 was made by subcloning the TFAM binding site from LSP into HSP1. .. Transcription reactions were performed in a total volume of 20 μL [10 mM HEPES (pH 7.5), 10 mM MgCl2 , 1 mM DTT, 100 μg/mL BSA, 400 μM ATP, 150 μM rCTP, 150 μM rGTP, 15 μM rUTP (Promega), 0.2 μM [α-32 P] rUTP (3,000 Ci/mmol, Perkin Elmer), 7.5 nM template DNA, and 40 units of RNaseOut (Invitrogen)].

Article Title: A Nucleus-Encoded Chloroplast Phosphoprotein Governs Expression of the Photosystem I Subunit PsaC in Chlamydomonas reinhardtii
Article Snippet: The vector was digested with Apa I (in the vector) and Cla I (shown above in italics), leading to a fragment of 139 bp, which was purified by agarose gel electrophoresis and transcribed in vitro with T7 RNA polymerase (Promega) for 2 h at 30°C in a 20-μL reaction mixture containing: 4 μL transcription buffer (Promega), 1 μL 1 mM rUTP, 1 μL each 10 mM stocks of the three other nucleotide triphosphates, 3 μL 32 P-rUTP at 10 mCi mL−1 and 3000 Ci mmol−1 , 1 μL RNase-in (Promega), 1 μL 20 mM DTT, 1 μL T7 polymerase, and 200 ng probe. .. The vector was digested with Apa I (in the vector) and Cla I (shown above in italics), leading to a fragment of 139 bp, which was purified by agarose gel electrophoresis and transcribed in vitro with T7 RNA polymerase (Promega) for 2 h at 30°C in a 20-μL reaction mixture containing: 4 μL transcription buffer (Promega), 1 μL 1 mM rUTP, 1 μL each 10 mM stocks of the three other nucleotide triphosphates, 3 μL 32 P-rUTP at 10 mCi mL−1 and 3000 Ci mmol−1 , 1 μL RNase-in (Promega), 1 μL 20 mM DTT, 1 μL T7 polymerase, and 200 ng probe.

Radioactivity:

Article Title: Virus Particle Core Defects Caused by Mutations in the Human Immunodeficiency Virus Capsid N-Terminal Domain
Article Snippet: TCA precipitates were pelleted by centrifugation for 10 min at 4°C, 13,600 × g , and were washed five times with 10% TCA prior to radioactivity quantitation in a scintillation counter. .. Probes for RNase protection assays were made by incubation of 1 μg of EcoRI-linearized template plasmid (BlueHX 680-831) with transcription buffer (40 mM Tris [pH 7.4], 10 mM DTT, 6 mM MgCl2 , 0.8 mM spermidine), 100 μCi of [α-32 P]rGTP, 0.5 mM each of rATP, rCTP, and rUTP, 1 μl of RNasin (Promega), 1 mM DTT, and 20 U of T3 polymerase (Promega) at 37°C for 1 h. Probes then were ethanol precipitated, dried, resuspended, separated on 5% sequencing gels, eluted, and reprecipitated prior to use ( ).

Subcloning:

Article Title: Distinct structural features of TFAM drive mitochondrial DNA packaging versus transcriptional activation
Article Snippet: EP1 was constructed by reversing the TFAM binding site at HSP1, and EP2 was made by subcloning the TFAM binding site from LSP into HSP1. .. Transcription reactions were performed in a total volume of 20 μL [10 mM HEPES (pH 7.5), 10 mM MgCl2 , 1 mM DTT, 100 μg/mL BSA, 400 μM ATP, 150 μM rCTP, 150 μM rGTP, 15 μM rUTP (Promega), 0.2 μM [α-32 P] rUTP (3,000 Ci/mmol, Perkin Elmer), 7.5 nM template DNA, and 40 units of RNaseOut (Invitrogen)].

Labeling:

Article Title: RNA Directed Modulation of Phenotypic Plasticity in Human Cells
Article Snippet: .. Generating Biotin Labeled RNA Transcripts- Biotin labeled RNA transcripts of Retro-EFI2S2 and GFP were generated by adding the following components into an 8 well PCR strip: (2.5μg of DNA template, 2μl T7 Enzyme mix (Sigma), 1ul rATP, rGTP, rCTP, rUTP (Promega), 1μl Biotin-14-CTP (Life Technologies), 2.5μl 1M DTT (Sigma) and 1μl RNase Inhibitor (Life Technologies)(as described in [ ]). .. The reaction volume was made up to 50μl with RNase free water (QIAGEN).

Article Title: A Nucleus-Encoded Chloroplast Phosphoprotein Governs Expression of the Photosystem I Subunit PsaC in Chlamydomonas reinhardtii
Article Snippet: The vector was digested with Apa I (in the vector) and Cla I (shown above in italics), leading to a fragment of 139 bp, which was purified by agarose gel electrophoresis and transcribed in vitro with T7 RNA polymerase (Promega) for 2 h at 30°C in a 20-μL reaction mixture containing: 4 μL transcription buffer (Promega), 1 μL 1 mM rUTP, 1 μL each 10 mM stocks of the three other nucleotide triphosphates, 3 μL 32 P-rUTP at 10 mCi mL−1 and 3000 Ci mmol−1 , 1 μL RNase-in (Promega), 1 μL 20 mM DTT, 1 μL T7 polymerase, and 200 ng probe. .. After treatment with RQ1 DNase (Promega) for 30 min, the labeled RNA was separated from the free nucleotides on a size-exclusion column (Sephadex G25 fine).

Article Title: mRNA Decay during Herpes Simplex Virus (HSV) Infections: Mutations That Affect Translation of an mRNA Influence the Sites at Which It Is Cleaved by the HSV Virion Host Shutoff (Vhs) Protein
Article Snippet: .. Capped internally labeled pBK2 mRNA was synthesized using an SP6 Riboprobe in vitro transcription system (Promega) in reactions that included 0.5 mM (each) rATP, rUTP, and rCTP, 50 μM rGTP, 50 μCi [α-32 P]GTP, and 0.5 mM Ribo m7 G cap analog (Promega). .. After in vitro transcription, template DNA was removed by digestion with RQ1 DNase (Promega). mRNAs were extracted twice with phenol-chloroform, precipitated from ethanol, and resuspended in a small volume of water.

Article Title: Long-Term Follow-Up of Chimpanzees Inoculated with the First Infectious Clone for Hepatitis C Virus
Article Snippet: Duplicate RNA samples were amplified with the TaqMan EZ RT-PCR kit and a TaqMan fluorogenic probe labeled with FAM (6-carboxy-fluorescein) and TAMRA (6-carboxytetramethylrhodamine) (PE-Applied Biosystems) at the 5′ and 3′ ends, respectively. .. The 100-μl reaction mixture, containing 20 μl of 5× T7 buffer; 7.5 mM (each) rATP, rCTP, rGTP, and rUTP; 2 μg of DNA; and 10 μl of enzyme mixture was incubated at 37°C for 2 h and then treated with 10 U of RNase-free DNase (Promega) for 30 min at 37°C.

Article Title: Array-Based Nuclear Run-on (ANRO) Analysis
Article Snippet: Paragraph title: 2.3. Materials and Reagents for Nascent RNA Labeling and RNA Purification ... 2× NRO Reaction Buffer: 300 mM KCl, 10 mM MgCl2 , 2 mM each of rATP, rCTP, rGTP (Promega cat. # E6000), 1 mM Bio-16-UTP (Enzo Life Sciences, cat. # ENZ-42814), 800 Units/ml RNaseOUT (Invitrogen cat. # 10777-019). rUTP (Promega cat. # 6000).

Purification:

Article Title: RNA mutagenesis yields highly diverse mRNA libraries for in vitro protein evolution
Article Snippet: Run off transcription on the linear DNA template was performed by adding 40 mM Tris-HCl (pH 7.9), 6 mM MgCl2 , 2 mM spermidine, 10 mM dithiothreitol, 1 mM each of rCTP, rUTP, rGTP, and rATP, 2 U RNase inhibitor (Promega), 20 U T7 polymerase (Promega) to 200 ng DNA template and incubating at 37°C overnight. .. RNA was DNase-treated to remove the DNA template (RQ1 DNase, Promega) and purified (RNeasy, Qiagen) prior to amplification with Qβ replicase.

Article Title: RNA mutagenesis yields highly diverse mRNA libraries for in vitro protein evolution
Article Snippet: The mRNA was mixed with 40 mM Tris-HCl (pH 7.9), 21 mM MgCl2 , 2 mM spermidine, 10 mM dithiothreitol, 1 mM each of rCTP, rUTP, rGTP, and rATP, 2 U RNase inhibitor (Promega) and 200 nM Qβ replicase (prepared in house following the method of Moody et al . .. The remaining mRNA was purified (RNeasy; Qiagen) to remove excess MgCl2 prior to ribosome display.

Article Title: A Nucleus-Encoded Chloroplast Phosphoprotein Governs Expression of the Photosystem I Subunit PsaC in Chlamydomonas reinhardtii
Article Snippet: .. The vector was digested with Apa I (in the vector) and Cla I (shown above in italics), leading to a fragment of 139 bp, which was purified by agarose gel electrophoresis and transcribed in vitro with T7 RNA polymerase (Promega) for 2 h at 30°C in a 20-μL reaction mixture containing: 4 μL transcription buffer (Promega), 1 μL 1 mM rUTP, 1 μL each 10 mM stocks of the three other nucleotide triphosphates, 3 μL 32 P-rUTP at 10 mCi mL−1 and 3000 Ci mmol−1 , 1 μL RNase-in (Promega), 1 μL 20 mM DTT, 1 μL T7 polymerase, and 200 ng probe. .. This produced a 62-nucleotide RNA containing the first 51 nucleotides of the psaC 5′ .

Article Title: Chemokine Gene Expression in Astrocytes of Borna Disease Virus-Infected Rats and Mice in the Absence of Inflammation
Article Snippet: Purified linearized DNAs were pooled at a concentration of 50 ng each per μl. .. The radiolabeled antisense RPA probe set was synthesized in a volume of 20 μl containing 100 μCi of [α-32 P]UTP (3,000 Ci/mmol); dithiothreitol (200 nmol); transcription buffer (Promega); 1 μl of template DNA; rUTP (61 pmol); rGTP, rATP, and rCTP (2.75 nmol each); RNase inhibitor (28 U; Pharmacia); and T7 polymerase (20 U; Promega).

Article Title: Array-Based Nuclear Run-on (ANRO) Analysis
Article Snippet: Paragraph title: 2.3. Materials and Reagents for Nascent RNA Labeling and RNA Purification ... 2× NRO Reaction Buffer: 300 mM KCl, 10 mM MgCl2 , 2 mM each of rATP, rCTP, rGTP (Promega cat. # E6000), 1 mM Bio-16-UTP (Enzo Life Sciences, cat. # ENZ-42814), 800 Units/ml RNaseOUT (Invitrogen cat. # 10777-019). rUTP (Promega cat. # 6000).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Long-Term Follow-Up of Chimpanzees Inoculated with the First Infectious Clone for Hepatitis C Virus
Article Snippet: Duplicate RNA samples were amplified with the TaqMan EZ RT-PCR kit and a TaqMan fluorogenic probe labeled with FAM (6-carboxy-fluorescein) and TAMRA (6-carboxytetramethylrhodamine) (PE-Applied Biosystems) at the 5′ and 3′ ends, respectively. .. The 100-μl reaction mixture, containing 20 μl of 5× T7 buffer; 7.5 mM (each) rATP, rCTP, rGTP, and rUTP; 2 μg of DNA; and 10 μl of enzyme mixture was incubated at 37°C for 2 h and then treated with 10 U of RNase-free DNase (Promega) for 30 min at 37°C.

Protein Extraction:

Article Title: Characterization of Multiple Exon 1 Variants in Mammalian HuD mRNA and Neuron-Specific Transcriptional Control via Neurogenin 2
Article Snippet: Briefly, nuclear extracts were harvested from neuron or mesoderm differentiated P19 cells using the ProteoJet Nuclear and Cytoplasmic Protein Extraction kit (Fermentas), according to manufacturer's protocol. .. Nuclei were split into two aliquots and incubated in a transcription reaction mix containing 20% glycerol, 30 m m Tris-HCl pH 8.0, 2.5 m m MgCl2 , 150 m m KCl, 1 m m DTT, 40U of Rnasin and 0.5 m m rATP, rCTP, rGTP, and rUTP (+) or diethylpyrocarbonate (DEPC)-treated water (−) (Promega).

Electrophoretic Mobility Shift Assay:

Article Title: Wnt-5a mRNA translation is suppressed by the Elav-like protein HuR in human breast epithelial cells
Article Snippet: Paragraph title: RNA electrophoretic mobility shift assay (REMSA) and ultraviolet (UV)-crosslinking ... The cold probe was prepared using rUTP (Promega) instead of radiolabelled-UTP.

Article Title: A Nucleus-Encoded Chloroplast Phosphoprotein Governs Expression of the Photosystem I Subunit PsaC in Chlamydomonas reinhardtii
Article Snippet: The vector was digested with Apa I (in the vector) and Cla I (shown above in italics), leading to a fragment of 139 bp, which was purified by agarose gel electrophoresis and transcribed in vitro with T7 RNA polymerase (Promega) for 2 h at 30°C in a 20-μL reaction mixture containing: 4 μL transcription buffer (Promega), 1 μL 1 mM rUTP, 1 μL each 10 mM stocks of the three other nucleotide triphosphates, 3 μL 32 P-rUTP at 10 mCi mL−1 and 3000 Ci mmol−1 , 1 μL RNase-in (Promega), 1 μL 20 mM DTT, 1 μL T7 polymerase, and 200 ng probe. .. The vector was digested with Apa I (in the vector) and Cla I (shown above in italics), leading to a fragment of 139 bp, which was purified by agarose gel electrophoresis and transcribed in vitro with T7 RNA polymerase (Promega) for 2 h at 30°C in a 20-μL reaction mixture containing: 4 μL transcription buffer (Promega), 1 μL 1 mM rUTP, 1 μL each 10 mM stocks of the three other nucleotide triphosphates, 3 μL 32 P-rUTP at 10 mCi mL−1 and 3000 Ci mmol−1 , 1 μL RNase-in (Promega), 1 μL 20 mM DTT, 1 μL T7 polymerase, and 200 ng probe.

Plasmid Preparation:

Article Title: RNA Directed Modulation of Phenotypic Plasticity in Human Cells
Article Snippet: Midi prepped (QIAGEN plasmid Midi Kit) clones were transfected along with the pcDNA3.1-GFP control [ ] into target cells using lipofectamine 2000 (Life Technologies, Carlsbad, CA, USA). .. Generating Biotin Labeled RNA Transcripts- Biotin labeled RNA transcripts of Retro-EFI2S2 and GFP were generated by adding the following components into an 8 well PCR strip: (2.5μg of DNA template, 2μl T7 Enzyme mix (Sigma), 1ul rATP, rGTP, rCTP, rUTP (Promega), 1μl Biotin-14-CTP (Life Technologies), 2.5μl 1M DTT (Sigma) and 1μl RNase Inhibitor (Life Technologies)(as described in [ ]).

Article Title: Distinct structural features of TFAM drive mitochondrial DNA packaging versus transcriptional activation
Article Snippet: The engineered promoters were synthesized by PCR with the appropriate oligonucleotides and cloned into the pSP65 vector at the BamHI and SalI sites. .. Transcription reactions were performed in a total volume of 20 μL [10 mM HEPES (pH 7.5), 10 mM MgCl2 , 1 mM DTT, 100 μg/mL BSA, 400 μM ATP, 150 μM rCTP, 150 μM rGTP, 15 μM rUTP (Promega), 0.2 μM [α-32 P] rUTP (3,000 Ci/mmol, Perkin Elmer), 7.5 nM template DNA, and 40 units of RNaseOut (Invitrogen)].

Article Title: Wnt-5a mRNA translation is suppressed by the Elav-like protein HuR in human breast epithelial cells
Article Snippet: The mutated probe was produced in the same way but using primers corresponding to the sense primer spanning the T7 site in the pcDNA3 vector (5′-cccactgcttactggcttatcg) and an antisense primer (5′-taatatgataatgatgatgtggcaataatgggggtgggaaccacgaaaaatatgtattttgtggatctttgaaaaggtaatacaagacttctttgggccc ) and Digoxigenin labelled rUTPs (Roche). .. The cold probe was prepared using rUTP (Promega) instead of radiolabelled-UTP.

Article Title: A Nucleus-Encoded Chloroplast Phosphoprotein Governs Expression of the Photosystem I Subunit PsaC in Chlamydomonas reinhardtii
Article Snippet: .. The vector was digested with Apa I (in the vector) and Cla I (shown above in italics), leading to a fragment of 139 bp, which was purified by agarose gel electrophoresis and transcribed in vitro with T7 RNA polymerase (Promega) for 2 h at 30°C in a 20-μL reaction mixture containing: 4 μL transcription buffer (Promega), 1 μL 1 mM rUTP, 1 μL each 10 mM stocks of the three other nucleotide triphosphates, 3 μL 32 P-rUTP at 10 mCi mL−1 and 3000 Ci mmol−1 , 1 μL RNase-in (Promega), 1 μL 20 mM DTT, 1 μL T7 polymerase, and 200 ng probe. .. This produced a 62-nucleotide RNA containing the first 51 nucleotides of the psaC 5′ .

Article Title: Virus Particle Core Defects Caused by Mutations in the Human Immunodeficiency Virus Capsid N-Terminal Domain
Article Snippet: .. Probes for RNase protection assays were made by incubation of 1 μg of EcoRI-linearized template plasmid (BlueHX 680-831) with transcription buffer (40 mM Tris [pH 7.4], 10 mM DTT, 6 mM MgCl2 , 0.8 mM spermidine), 100 μCi of [α-32 P]rGTP, 0.5 mM each of rATP, rCTP, and rUTP, 1 μl of RNasin (Promega), 1 mM DTT, and 20 U of T3 polymerase (Promega) at 37°C for 1 h. Probes then were ethanol precipitated, dried, resuspended, separated on 5% sequencing gels, eluted, and reprecipitated prior to use ( ). ..

Article Title: mRNA Decay during Herpes Simplex Virus (HSV) Infections: Mutations That Affect Translation of an mRNA Influence the Sites at Which It Is Cleaved by the HSV Virion Host Shutoff (Vhs) Protein
Article Snippet: Capped internally labeled pBK2 mRNA was synthesized using an SP6 Riboprobe in vitro transcription system (Promega) in reactions that included 0.5 mM (each) rATP, rUTP, and rCTP, 50 μM rGTP, 50 μCi [α-32 P]GTP, and 0.5 mM Ribo m7 G cap analog (Promega). .. To produce pBK2 mRNA with a 32 P-labeled cap and a cold poly(A) tail, uncapped unlabeled pBK2 mRNA with a 35-nucleotide poly(A) tail encoded by the plasmid was synthesized using an SP6 RiboMAX in vitro transcription kit (Promega).

Article Title: Long-Term Follow-Up of Chimpanzees Inoculated with the First Infectious Clone for Hepatitis C Virus
Article Snippet: RNA standards, run in duplicate in every reaction, were prepared from RNA transcripts produced with the RiboMAX T7 large-scale RNA production system (Promega) and the p90 full-length plasmid linearized with Bsm I. .. The 100-μl reaction mixture, containing 20 μl of 5× T7 buffer; 7.5 mM (each) rATP, rCTP, rGTP, and rUTP; 2 μg of DNA; and 10 μl of enzyme mixture was incubated at 37°C for 2 h and then treated with 10 U of RNase-free DNase (Promega) for 30 min at 37°C.

Electrophoresis:

Article Title: Wnt-5a mRNA translation is suppressed by the Elav-like protein HuR in human breast epithelial cells
Article Snippet: The cold probe was prepared using rUTP (Promega) instead of radiolabelled-UTP. .. Subsequently, RNAse T1 (1 U; Promega) and Heparin (5 μg/ml) was added for 5 min each, the samples were diluted in RNA native loading buffer [30 mM Tris–Hcl (pH 7.5), 40% Sucrose and 0.2% BFB] and subjected to native PAGE gel (4%) electrophoresis.

Recombinant:

Article Title: I-PfoP3I: A Novel Nicking HNH Homing Endonuclease Encoded in the Group I Intron of the DNA Polymerase Gene in Phormidium foveolarum Phage Pf-WMP3
Article Snippet: .. The XhoI linearized pETP3DNAP[+int] (1 µg) was incubated with 40 mM Tris-HCl (pH 7.9), 10 mM NaCl, 6 mM MgCl2 , 2 mM spermidine, 10 mM DTT, 40 u Recombinant RNasin Ribonuclease Inhibitor, 0.5 mM each of rATP, rGTP, rCTP and rUTP, 20 u T7 RNA Polymerase in a total volume of 20 µl at 37°C for 1 h. Template DNA was digested with RNase-free DNaseI (Promega). .. Reverse transcription was performed using sequence-specific primer P3r2 and M-MLV Reverse Transcriptase (Promega) according to the manufacturer’s recommendations.

Article Title: Long-Term Follow-Up of Chimpanzees Inoculated with the First Infectious Clone for Hepatitis C Virus
Article Snippet: Reactions were performed with 50-μl mixtures containing the following: 5 μl of template RNA; 10 μl of 5× TaqMan EZ buffer; 2.5 mM Mn(OAc)2 ; 300 μM (each) dATP, dCTP, dGTP, and dTTP; 300 nM (each) primers TaqMan/243 and TaqMan/390; 100 nM fluorogenic probe (TaqMan/336); and 5 U of recombinant Tth (r Tth ) DNA polymerase. .. The 100-μl reaction mixture, containing 20 μl of 5× T7 buffer; 7.5 mM (each) rATP, rCTP, rGTP, and rUTP; 2 μg of DNA; and 10 μl of enzyme mixture was incubated at 37°C for 2 h and then treated with 10 U of RNase-free DNase (Promega) for 30 min at 37°C.

Agarose Gel Electrophoresis:

Article Title: A Nucleus-Encoded Chloroplast Phosphoprotein Governs Expression of the Photosystem I Subunit PsaC in Chlamydomonas reinhardtii
Article Snippet: .. The vector was digested with Apa I (in the vector) and Cla I (shown above in italics), leading to a fragment of 139 bp, which was purified by agarose gel electrophoresis and transcribed in vitro with T7 RNA polymerase (Promega) for 2 h at 30°C in a 20-μL reaction mixture containing: 4 μL transcription buffer (Promega), 1 μL 1 mM rUTP, 1 μL each 10 mM stocks of the three other nucleotide triphosphates, 3 μL 32 P-rUTP at 10 mCi mL−1 and 3000 Ci mmol−1 , 1 μL RNase-in (Promega), 1 μL 20 mM DTT, 1 μL T7 polymerase, and 200 ng probe. .. This produced a 62-nucleotide RNA containing the first 51 nucleotides of the psaC 5′ .

In Vitro:

Article Title: Distinct structural features of TFAM drive mitochondrial DNA packaging versus transcriptional activation
Article Snippet: Paragraph title: In vitro transcription reactions ... Transcription reactions were performed in a total volume of 20 μL [10 mM HEPES (pH 7.5), 10 mM MgCl2 , 1 mM DTT, 100 μg/mL BSA, 400 μM ATP, 150 μM rCTP, 150 μM rGTP, 15 μM rUTP (Promega), 0.2 μM [α-32 P] rUTP (3,000 Ci/mmol, Perkin Elmer), 7.5 nM template DNA, and 40 units of RNaseOut (Invitrogen)].

Article Title: I-PfoP3I: A Novel Nicking HNH Homing Endonuclease Encoded in the Group I Intron of the DNA Polymerase Gene in Phormidium foveolarum Phage Pf-WMP3
Article Snippet: Paragraph title: In vitro Transcription and Splicing Assay ... The XhoI linearized pETP3DNAP[+int] (1 µg) was incubated with 40 mM Tris-HCl (pH 7.9), 10 mM NaCl, 6 mM MgCl2 , 2 mM spermidine, 10 mM DTT, 40 u Recombinant RNasin Ribonuclease Inhibitor, 0.5 mM each of rATP, rGTP, rCTP and rUTP, 20 u T7 RNA Polymerase in a total volume of 20 µl at 37°C for 1 h. Template DNA was digested with RNase-free DNaseI (Promega).

Article Title: A Nucleus-Encoded Chloroplast Phosphoprotein Governs Expression of the Photosystem I Subunit PsaC in Chlamydomonas reinhardtii
Article Snippet: .. The vector was digested with Apa I (in the vector) and Cla I (shown above in italics), leading to a fragment of 139 bp, which was purified by agarose gel electrophoresis and transcribed in vitro with T7 RNA polymerase (Promega) for 2 h at 30°C in a 20-μL reaction mixture containing: 4 μL transcription buffer (Promega), 1 μL 1 mM rUTP, 1 μL each 10 mM stocks of the three other nucleotide triphosphates, 3 μL 32 P-rUTP at 10 mCi mL−1 and 3000 Ci mmol−1 , 1 μL RNase-in (Promega), 1 μL 20 mM DTT, 1 μL T7 polymerase, and 200 ng probe. .. This produced a 62-nucleotide RNA containing the first 51 nucleotides of the psaC 5′ .

Article Title: mRNA Decay during Herpes Simplex Virus (HSV) Infections: Mutations That Affect Translation of an mRNA Influence the Sites at Which It Is Cleaved by the HSV Virion Host Shutoff (Vhs) Protein
Article Snippet: .. Capped internally labeled pBK2 mRNA was synthesized using an SP6 Riboprobe in vitro transcription system (Promega) in reactions that included 0.5 mM (each) rATP, rUTP, and rCTP, 50 μM rGTP, 50 μCi [α-32 P]GTP, and 0.5 mM Ribo m7 G cap analog (Promega). .. After in vitro transcription, template DNA was removed by digestion with RQ1 DNase (Promega). mRNAs were extracted twice with phenol-chloroform, precipitated from ethanol, and resuspended in a small volume of water.

Quantitation Assay:

Article Title: Virus Particle Core Defects Caused by Mutations in the Human Immunodeficiency Virus Capsid N-Terminal Domain
Article Snippet: TCA precipitates were pelleted by centrifugation for 10 min at 4°C, 13,600 × g , and were washed five times with 10% TCA prior to radioactivity quantitation in a scintillation counter. .. Probes for RNase protection assays were made by incubation of 1 μg of EcoRI-linearized template plasmid (BlueHX 680-831) with transcription buffer (40 mM Tris [pH 7.4], 10 mM DTT, 6 mM MgCl2 , 0.8 mM spermidine), 100 μCi of [α-32 P]rGTP, 0.5 mM each of rATP, rCTP, and rUTP, 1 μl of RNasin (Promega), 1 mM DTT, and 20 U of T3 polymerase (Promega) at 37°C for 1 h. Probes then were ethanol precipitated, dried, resuspended, separated on 5% sequencing gels, eluted, and reprecipitated prior to use ( ).

Produced:

Article Title: Wnt-5a mRNA translation is suppressed by the Elav-like protein HuR in human breast epithelial cells
Article Snippet: The mutated probe was produced in the same way but using primers corresponding to the sense primer spanning the T7 site in the pcDNA3 vector (5′-cccactgcttactggcttatcg) and an antisense primer (5′-taatatgataatgatgatgtggcaataatgggggtgggaaccacgaaaaatatgtattttgtggatctttgaaaaggtaatacaagacttctttgggccc ) and Digoxigenin labelled rUTPs (Roche). .. The cold probe was prepared using rUTP (Promega) instead of radiolabelled-UTP.

Article Title: A Nucleus-Encoded Chloroplast Phosphoprotein Governs Expression of the Photosystem I Subunit PsaC in Chlamydomonas reinhardtii
Article Snippet: The vector was digested with Apa I (in the vector) and Cla I (shown above in italics), leading to a fragment of 139 bp, which was purified by agarose gel electrophoresis and transcribed in vitro with T7 RNA polymerase (Promega) for 2 h at 30°C in a 20-μL reaction mixture containing: 4 μL transcription buffer (Promega), 1 μL 1 mM rUTP, 1 μL each 10 mM stocks of the three other nucleotide triphosphates, 3 μL 32 P-rUTP at 10 mCi mL−1 and 3000 Ci mmol−1 , 1 μL RNase-in (Promega), 1 μL 20 mM DTT, 1 μL T7 polymerase, and 200 ng probe. .. This produced a 62-nucleotide RNA containing the first 51 nucleotides of the psaC 5′ .

Article Title: mRNA Decay during Herpes Simplex Virus (HSV) Infections: Mutations That Affect Translation of an mRNA Influence the Sites at Which It Is Cleaved by the HSV Virion Host Shutoff (Vhs) Protein
Article Snippet: Target mRNAs for in vitro mRNA degradation assays were produced by in vitro transcription of EcoRI-linearized pBK2 or SpeI-linearized pCITE-RLuc using SP6 or T7 RNA polymerase, respectively. .. Capped internally labeled pBK2 mRNA was synthesized using an SP6 Riboprobe in vitro transcription system (Promega) in reactions that included 0.5 mM (each) rATP, rUTP, and rCTP, 50 μM rGTP, 50 μCi [α-32 P]GTP, and 0.5 mM Ribo m7 G cap analog (Promega).

Article Title: Long-Term Follow-Up of Chimpanzees Inoculated with the First Infectious Clone for Hepatitis C Virus
Article Snippet: RNA standards, run in duplicate in every reaction, were prepared from RNA transcripts produced with the RiboMAX T7 large-scale RNA production system (Promega) and the p90 full-length plasmid linearized with Bsm I. .. The 100-μl reaction mixture, containing 20 μl of 5× T7 buffer; 7.5 mM (each) rATP, rCTP, rGTP, and rUTP; 2 μg of DNA; and 10 μl of enzyme mixture was incubated at 37°C for 2 h and then treated with 10 U of RNase-free DNase (Promega) for 30 min at 37°C.

Concentration Assay:

Article Title: Long-Term Follow-Up of Chimpanzees Inoculated with the First Infectious Clone for Hepatitis C Virus
Article Snippet: The 100-μl reaction mixture, containing 20 μl of 5× T7 buffer; 7.5 mM (each) rATP, rCTP, rGTP, and rUTP; 2 μg of DNA; and 10 μl of enzyme mixture was incubated at 37°C for 2 h and then treated with 10 U of RNase-free DNase (Promega) for 30 min at 37°C. .. The concentration was calculated by optical density readings at 260 nm (OD260 ), and the RNA was stored in aliquots of 100 ng in liquid nitrogen until use.

Article Title: Chemokine Gene Expression in Astrocytes of Borna Disease Virus-Infected Rats and Mice in the Absence of Inflammation
Article Snippet: Purified linearized DNAs were pooled at a concentration of 50 ng each per μl. .. The radiolabeled antisense RPA probe set was synthesized in a volume of 20 μl containing 100 μCi of [α-32 P]UTP (3,000 Ci/mmol); dithiothreitol (200 nmol); transcription buffer (Promega); 1 μl of template DNA; rUTP (61 pmol); rGTP, rATP, and rCTP (2.75 nmol each); RNase inhibitor (28 U; Pharmacia); and T7 polymerase (20 U; Promega).

Lysis:

Article Title: A Nucleus-Encoded Chloroplast Phosphoprotein Governs Expression of the Photosystem I Subunit PsaC in Chlamydomonas reinhardtii
Article Snippet: The resulting extract was centrifuged 30 min at 12,000 g and the supernatant was loaded on a 1-mL Ni-NTA column, washed with lysis buffer supplemented with 30 mM imidazole, and eluted with 5 mL of 25 mM HEPES, pH 7.7, 750 mM NaCl, 5 mM MgCl2 , 4 mM DTT, and 300 mM imidazole. .. The vector was digested with Apa I (in the vector) and Cla I (shown above in italics), leading to a fragment of 139 bp, which was purified by agarose gel electrophoresis and transcribed in vitro with T7 RNA polymerase (Promega) for 2 h at 30°C in a 20-μL reaction mixture containing: 4 μL transcription buffer (Promega), 1 μL 1 mM rUTP, 1 μL each 10 mM stocks of the three other nucleotide triphosphates, 3 μL 32 P-rUTP at 10 mCi mL−1 and 3000 Ci mmol−1 , 1 μL RNase-in (Promega), 1 μL 20 mM DTT, 1 μL T7 polymerase, and 200 ng probe.

Clear Native PAGE:

Article Title: Wnt-5a mRNA translation is suppressed by the Elav-like protein HuR in human breast epithelial cells
Article Snippet: The cold probe was prepared using rUTP (Promega) instead of radiolabelled-UTP. .. Subsequently, RNAse T1 (1 U; Promega) and Heparin (5 μg/ml) was added for 5 min each, the samples were diluted in RNA native loading buffer [30 mM Tris–Hcl (pH 7.5), 40% Sucrose and 0.2% BFB] and subjected to native PAGE gel (4%) electrophoresis.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 77
    Promega alpha 32p rutp
    Prep1 inhibits translation of the luciferase- Hoxb4 mRNA and is able to bind the 3′-UTR region of Hoxb4 mRNA. (A) Luc-Hoxb4 3′UTR mRNA was translated in vitro in a rabbit reticulocytes system with the additions indicated at the bottom (Prep1 or 4EHP previously in vitro synthesized under T7 promoter). Luciferase activity is expressed in percent of the control; the 100% value is the level of luciferase translated in the absence of any added protein (column 6). Addition of in vitro translated Prep1 inhibits Luc-Hoxb4 3′UTR mRNA translation (columns 1 and 4) while no further effect is observed when the in vitro translated 4EHP protein is added to the reaction with Prep1 (column 1) or alone (column 3). Less inhibition is obtained with the in vitro translated Prep1 4EHP-binding (Y-LL) mutant (Prep1-Mut) (columns 2 and 5). N-values are 5. (B) This control shows that the differences observed in (A) are not due to interference with the in vitro transcription of the luciferase- Hoxb4 3′UTR mRNA. RT-PCR analysis of Luc-Hoxb4 3′UTR mRNA present in samples 1–6 (A). Each reaction was amplified for 25 and 30 cycles. Notice the absence of amplification in the RT(-), indicating that the plasmid used for Luc-Hoxb4 3′UTR transcription had been completely digested by the DNAse treatment. (C) Prep1 does not inhibit translation of Luc-Cdx2 3′UTR mRNA, independently of the presence of 4EHP. Thus the inhibitory effect appears to be dictated by the presence of the Hoxb4 3′UTR. N-values are 3. (D) Prep1 inhibits in vitro translation of Luc-Hoxb4 3′UTR mRNA in a dose-dependent manner. Compare non diluted Prep1 (column 1) with dilutions 1/2 and 1/5 (columns 2 and 3). N-values are 4. (E) Anti-4EHP antibodies prevent the inhibitory action of Prep1. Inhibition of Luc-Hoxb4 3′UTR mRNA translation by Prep1 was reversed when 2 µg of anti-4EHP (but not an unrelated) antibody was added to the reaction. N-values are 3. (F) RNA-EMSA showing specific Prep1 binding to Hoxb4 3′UTR. First lane shows the <t>[alpha-32P]</t> <t>rUTP-labelled</t> probe. Second lane shows the shift induced by the addition of Prep1 to the reaction (arrow). Third lane shows the induction of a super-shift by the Prep1 antibody (arrowhead). Lane 4 shows that the effect of the antibody is specific since an anti-Pbx antibody has no effect. Same experiment using antisense probe is shown in lanes 5–8.
    Alpha 32p Rutp, supplied by Promega, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/alpha 32p rutp/product/Promega
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    alpha 32p rutp - by Bioz Stars, 2020-01
    77/100 stars
      Buy from Supplier

    93
    Promega rutp
    Prep1 inhibits translation of the luciferase- Hoxb4 mRNA and is able to bind the 3′-UTR region of Hoxb4 mRNA. (A) Luc-Hoxb4 3′UTR mRNA was translated in vitro in a rabbit reticulocytes system with the additions indicated at the bottom (Prep1 or 4EHP previously in vitro synthesized under T7 promoter). Luciferase activity is expressed in percent of the control; the 100% value is the level of luciferase translated in the absence of any added protein (column 6). Addition of in vitro translated Prep1 inhibits Luc-Hoxb4 3′UTR mRNA translation (columns 1 and 4) while no further effect is observed when the in vitro translated 4EHP protein is added to the reaction with Prep1 (column 1) or alone (column 3). Less inhibition is obtained with the in vitro translated Prep1 4EHP-binding (Y-LL) mutant (Prep1-Mut) (columns 2 and 5). N-values are 5. (B) This control shows that the differences observed in (A) are not due to interference with the in vitro transcription of the luciferase- Hoxb4 3′UTR mRNA. RT-PCR analysis of Luc-Hoxb4 3′UTR mRNA present in samples 1–6 (A). Each reaction was amplified for 25 and 30 cycles. Notice the absence of amplification in the RT(-), indicating that the plasmid used for Luc-Hoxb4 3′UTR transcription had been completely digested by the DNAse treatment. (C) Prep1 does not inhibit translation of Luc-Cdx2 3′UTR mRNA, independently of the presence of 4EHP. Thus the inhibitory effect appears to be dictated by the presence of the Hoxb4 3′UTR. N-values are 3. (D) Prep1 inhibits in vitro translation of Luc-Hoxb4 3′UTR mRNA in a dose-dependent manner. Compare non diluted Prep1 (column 1) with dilutions 1/2 and 1/5 (columns 2 and 3). N-values are 4. (E) Anti-4EHP antibodies prevent the inhibitory action of Prep1. Inhibition of Luc-Hoxb4 3′UTR mRNA translation by Prep1 was reversed when 2 µg of anti-4EHP (but not an unrelated) antibody was added to the reaction. N-values are 3. (F) RNA-EMSA showing specific Prep1 binding to Hoxb4 3′UTR. First lane shows the <t>[alpha-32P]</t> <t>rUTP-labelled</t> probe. Second lane shows the shift induced by the addition of Prep1 to the reaction (arrow). Third lane shows the induction of a super-shift by the Prep1 antibody (arrowhead). Lane 4 shows that the effect of the antibody is specific since an anti-Pbx antibody has no effect. Same experiment using antisense probe is shown in lanes 5–8.
    Rutp, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rutp/product/Promega
    Average 93 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    rutp - by Bioz Stars, 2020-01
    93/100 stars
      Buy from Supplier

    Image Search Results


    Prep1 inhibits translation of the luciferase- Hoxb4 mRNA and is able to bind the 3′-UTR region of Hoxb4 mRNA. (A) Luc-Hoxb4 3′UTR mRNA was translated in vitro in a rabbit reticulocytes system with the additions indicated at the bottom (Prep1 or 4EHP previously in vitro synthesized under T7 promoter). Luciferase activity is expressed in percent of the control; the 100% value is the level of luciferase translated in the absence of any added protein (column 6). Addition of in vitro translated Prep1 inhibits Luc-Hoxb4 3′UTR mRNA translation (columns 1 and 4) while no further effect is observed when the in vitro translated 4EHP protein is added to the reaction with Prep1 (column 1) or alone (column 3). Less inhibition is obtained with the in vitro translated Prep1 4EHP-binding (Y-LL) mutant (Prep1-Mut) (columns 2 and 5). N-values are 5. (B) This control shows that the differences observed in (A) are not due to interference with the in vitro transcription of the luciferase- Hoxb4 3′UTR mRNA. RT-PCR analysis of Luc-Hoxb4 3′UTR mRNA present in samples 1–6 (A). Each reaction was amplified for 25 and 30 cycles. Notice the absence of amplification in the RT(-), indicating that the plasmid used for Luc-Hoxb4 3′UTR transcription had been completely digested by the DNAse treatment. (C) Prep1 does not inhibit translation of Luc-Cdx2 3′UTR mRNA, independently of the presence of 4EHP. Thus the inhibitory effect appears to be dictated by the presence of the Hoxb4 3′UTR. N-values are 3. (D) Prep1 inhibits in vitro translation of Luc-Hoxb4 3′UTR mRNA in a dose-dependent manner. Compare non diluted Prep1 (column 1) with dilutions 1/2 and 1/5 (columns 2 and 3). N-values are 4. (E) Anti-4EHP antibodies prevent the inhibitory action of Prep1. Inhibition of Luc-Hoxb4 3′UTR mRNA translation by Prep1 was reversed when 2 µg of anti-4EHP (but not an unrelated) antibody was added to the reaction. N-values are 3. (F) RNA-EMSA showing specific Prep1 binding to Hoxb4 3′UTR. First lane shows the [alpha-32P] rUTP-labelled probe. Second lane shows the shift induced by the addition of Prep1 to the reaction (arrow). Third lane shows the induction of a super-shift by the Prep1 antibody (arrowhead). Lane 4 shows that the effect of the antibody is specific since an anti-Pbx antibody has no effect. Same experiment using antisense probe is shown in lanes 5–8.

    Journal: PLoS ONE

    Article Title: Cytoplasmic Prep1 Interacts with 4EHP Inhibiting Hoxb4 Translation

    doi: 10.1371/journal.pone.0005213

    Figure Lengend Snippet: Prep1 inhibits translation of the luciferase- Hoxb4 mRNA and is able to bind the 3′-UTR region of Hoxb4 mRNA. (A) Luc-Hoxb4 3′UTR mRNA was translated in vitro in a rabbit reticulocytes system with the additions indicated at the bottom (Prep1 or 4EHP previously in vitro synthesized under T7 promoter). Luciferase activity is expressed in percent of the control; the 100% value is the level of luciferase translated in the absence of any added protein (column 6). Addition of in vitro translated Prep1 inhibits Luc-Hoxb4 3′UTR mRNA translation (columns 1 and 4) while no further effect is observed when the in vitro translated 4EHP protein is added to the reaction with Prep1 (column 1) or alone (column 3). Less inhibition is obtained with the in vitro translated Prep1 4EHP-binding (Y-LL) mutant (Prep1-Mut) (columns 2 and 5). N-values are 5. (B) This control shows that the differences observed in (A) are not due to interference with the in vitro transcription of the luciferase- Hoxb4 3′UTR mRNA. RT-PCR analysis of Luc-Hoxb4 3′UTR mRNA present in samples 1–6 (A). Each reaction was amplified for 25 and 30 cycles. Notice the absence of amplification in the RT(-), indicating that the plasmid used for Luc-Hoxb4 3′UTR transcription had been completely digested by the DNAse treatment. (C) Prep1 does not inhibit translation of Luc-Cdx2 3′UTR mRNA, independently of the presence of 4EHP. Thus the inhibitory effect appears to be dictated by the presence of the Hoxb4 3′UTR. N-values are 3. (D) Prep1 inhibits in vitro translation of Luc-Hoxb4 3′UTR mRNA in a dose-dependent manner. Compare non diluted Prep1 (column 1) with dilutions 1/2 and 1/5 (columns 2 and 3). N-values are 4. (E) Anti-4EHP antibodies prevent the inhibitory action of Prep1. Inhibition of Luc-Hoxb4 3′UTR mRNA translation by Prep1 was reversed when 2 µg of anti-4EHP (but not an unrelated) antibody was added to the reaction. N-values are 3. (F) RNA-EMSA showing specific Prep1 binding to Hoxb4 3′UTR. First lane shows the [alpha-32P] rUTP-labelled probe. Second lane shows the shift induced by the addition of Prep1 to the reaction (arrow). Third lane shows the induction of a super-shift by the Prep1 antibody (arrowhead). Lane 4 shows that the effect of the antibody is specific since an anti-Pbx antibody has no effect. Same experiment using antisense probe is shown in lanes 5–8.

    Article Snippet: REMSA The probe for REMSA was prepared and labeled by the in vitro transcription of the cloned DNA fragment of Hoxb4 3′UTR using [alpha-32P]rUTP and Riboprobe® Combination System (Promega, Madison, WI).

    Techniques: Luciferase, In Vitro, Synthesized, Activity Assay, Inhibition, Binding Assay, Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Amplification, Plasmid Preparation