Structured Review

Thermo Fisher rnaseout
SAMHD1 interacts with LINE-1. a 293T cells were transfected with the L1 expression vector pAD2TE1 together with plasmids encoding wt SAMHD1, SAMHD1 T592A, or SAMHD1 T592D. Two days posttransfection, cells were lysed and ORF1p-T7 was precipitated using anti-T7 antibody coupled to magnetic beads. The precipitates were analyzed by immunoblot. SAMHD1-myc, T592A-myc, and T592D-myc signals were quantified using AIDA Image Analyzer software and normalized on the T7 signal in IP (bait) and the myc signal in WCL (input). b 293T cells were transfected with expression plasmids for L1 ORF1p-FLAG or ORF2p-3xFLAG together with empty vector (pcDNA) or SAMHD1 T592A. Two days posttransfection, cells were lysed and L1 proteins were precipitated with anti-FLAG antibody coupled to magnetic beads. A representative quantification of the precipitated SAMHD1 T592A signal is shown. HRP signals were quantified with AIDA Image analyzer software and normalized on bait signal and WCL input signal. c 293T cells were transfected with a L1 expression plasmid together with empty vector (pcDNA), SAMHD1 T592A, or MOV10. Cells were lysed 2 days posttransfection. Lysates were treated with either <t>RNaseOUT</t> or 15 μg/ml RNaseA prior to ORF1p-T7 precipitation using anti-T7 antibody coupled to magnetic beads. d 293T cells were transfected with empty vector (pcDNA), L1 expression vector and expression plasmids for SAMHD1 wt, T592A, or T592D. Cells were lysed 2 days posttransfection and SAMHD1 was precipitated with an anti-myc antibody coupled to magnetic beads. Subsequently, MLV-RT and LEAP-RT reactions were performed and amplification products were visualized on a 2% agarose gel. Input protein content was controlled by immunoblot. One out of three independent experiments is shown. WCL: Whole cell lysate, IP: immunoprecipitation
Rnaseout, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 249 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rnaseout/product/Thermo Fisher
Average 99 stars, based on 249 article reviews
Price from $9.99 to $1999.99
rnaseout - by Bioz Stars, 2020-01
99/100 stars

Images

1) Product Images from "The SAMHD1-mediated block of LINE-1 retroelements is regulated by phosphorylation"

Article Title: The SAMHD1-mediated block of LINE-1 retroelements is regulated by phosphorylation

Journal: Mobile DNA

doi: 10.1186/s13100-018-0116-5

SAMHD1 interacts with LINE-1. a 293T cells were transfected with the L1 expression vector pAD2TE1 together with plasmids encoding wt SAMHD1, SAMHD1 T592A, or SAMHD1 T592D. Two days posttransfection, cells were lysed and ORF1p-T7 was precipitated using anti-T7 antibody coupled to magnetic beads. The precipitates were analyzed by immunoblot. SAMHD1-myc, T592A-myc, and T592D-myc signals were quantified using AIDA Image Analyzer software and normalized on the T7 signal in IP (bait) and the myc signal in WCL (input). b 293T cells were transfected with expression plasmids for L1 ORF1p-FLAG or ORF2p-3xFLAG together with empty vector (pcDNA) or SAMHD1 T592A. Two days posttransfection, cells were lysed and L1 proteins were precipitated with anti-FLAG antibody coupled to magnetic beads. A representative quantification of the precipitated SAMHD1 T592A signal is shown. HRP signals were quantified with AIDA Image analyzer software and normalized on bait signal and WCL input signal. c 293T cells were transfected with a L1 expression plasmid together with empty vector (pcDNA), SAMHD1 T592A, or MOV10. Cells were lysed 2 days posttransfection. Lysates were treated with either RNaseOUT or 15 μg/ml RNaseA prior to ORF1p-T7 precipitation using anti-T7 antibody coupled to magnetic beads. d 293T cells were transfected with empty vector (pcDNA), L1 expression vector and expression plasmids for SAMHD1 wt, T592A, or T592D. Cells were lysed 2 days posttransfection and SAMHD1 was precipitated with an anti-myc antibody coupled to magnetic beads. Subsequently, MLV-RT and LEAP-RT reactions were performed and amplification products were visualized on a 2% agarose gel. Input protein content was controlled by immunoblot. One out of three independent experiments is shown. WCL: Whole cell lysate, IP: immunoprecipitation
Figure Legend Snippet: SAMHD1 interacts with LINE-1. a 293T cells were transfected with the L1 expression vector pAD2TE1 together with plasmids encoding wt SAMHD1, SAMHD1 T592A, or SAMHD1 T592D. Two days posttransfection, cells were lysed and ORF1p-T7 was precipitated using anti-T7 antibody coupled to magnetic beads. The precipitates were analyzed by immunoblot. SAMHD1-myc, T592A-myc, and T592D-myc signals were quantified using AIDA Image Analyzer software and normalized on the T7 signal in IP (bait) and the myc signal in WCL (input). b 293T cells were transfected with expression plasmids for L1 ORF1p-FLAG or ORF2p-3xFLAG together with empty vector (pcDNA) or SAMHD1 T592A. Two days posttransfection, cells were lysed and L1 proteins were precipitated with anti-FLAG antibody coupled to magnetic beads. A representative quantification of the precipitated SAMHD1 T592A signal is shown. HRP signals were quantified with AIDA Image analyzer software and normalized on bait signal and WCL input signal. c 293T cells were transfected with a L1 expression plasmid together with empty vector (pcDNA), SAMHD1 T592A, or MOV10. Cells were lysed 2 days posttransfection. Lysates were treated with either RNaseOUT or 15 μg/ml RNaseA prior to ORF1p-T7 precipitation using anti-T7 antibody coupled to magnetic beads. d 293T cells were transfected with empty vector (pcDNA), L1 expression vector and expression plasmids for SAMHD1 wt, T592A, or T592D. Cells were lysed 2 days posttransfection and SAMHD1 was precipitated with an anti-myc antibody coupled to magnetic beads. Subsequently, MLV-RT and LEAP-RT reactions were performed and amplification products were visualized on a 2% agarose gel. Input protein content was controlled by immunoblot. One out of three independent experiments is shown. WCL: Whole cell lysate, IP: immunoprecipitation

Techniques Used: Transfection, Expressing, Plasmid Preparation, Magnetic Beads, Software, Amplification, Agarose Gel Electrophoresis, Immunoprecipitation

2) Product Images from "The SAMHD1-mediated block of LINE-1 retroelements is regulated by phosphorylation"

Article Title: The SAMHD1-mediated block of LINE-1 retroelements is regulated by phosphorylation

Journal: Mobile DNA

doi: 10.1186/s13100-018-0116-5

SAMHD1 interacts with LINE-1. a 293T cells were transfected with the L1 expression vector pAD2TE1 together with plasmids encoding wt SAMHD1, SAMHD1 T592A, or SAMHD1 T592D. Two days posttransfection, cells were lysed and ORF1p-T7 was precipitated using anti-T7 antibody coupled to magnetic beads. The precipitates were analyzed by immunoblot. SAMHD1-myc, T592A-myc, and T592D-myc signals were quantified using AIDA Image Analyzer software and normalized on the T7 signal in IP (bait) and the myc signal in WCL (input). b 293T cells were transfected with expression plasmids for L1 ORF1p-FLAG or ORF2p-3xFLAG together with empty vector (pcDNA) or SAMHD1 T592A. Two days posttransfection, cells were lysed and L1 proteins were precipitated with anti-FLAG antibody coupled to magnetic beads. A representative quantification of the precipitated SAMHD1 T592A signal is shown. HRP signals were quantified with AIDA Image analyzer software and normalized on bait signal and WCL input signal. c 293T cells were transfected with a L1 expression plasmid together with empty vector (pcDNA), SAMHD1 T592A, or MOV10. Cells were lysed 2 days posttransfection. Lysates were treated with either RNaseOUT or 15 μg/ml RNaseA prior to ORF1p-T7 precipitation using anti-T7 antibody coupled to magnetic beads. d 293T cells were transfected with empty vector (pcDNA), L1 expression vector and expression plasmids for SAMHD1 wt, T592A, or T592D. Cells were lysed 2 days posttransfection and SAMHD1 was precipitated with an anti-myc antibody coupled to magnetic beads. Subsequently, MLV-RT and LEAP-RT reactions were performed and amplification products were visualized on a 2% agarose gel. Input protein content was controlled by immunoblot. One out of three independent experiments is shown. WCL: Whole cell lysate, IP: immunoprecipitation
Figure Legend Snippet: SAMHD1 interacts with LINE-1. a 293T cells were transfected with the L1 expression vector pAD2TE1 together with plasmids encoding wt SAMHD1, SAMHD1 T592A, or SAMHD1 T592D. Two days posttransfection, cells were lysed and ORF1p-T7 was precipitated using anti-T7 antibody coupled to magnetic beads. The precipitates were analyzed by immunoblot. SAMHD1-myc, T592A-myc, and T592D-myc signals were quantified using AIDA Image Analyzer software and normalized on the T7 signal in IP (bait) and the myc signal in WCL (input). b 293T cells were transfected with expression plasmids for L1 ORF1p-FLAG or ORF2p-3xFLAG together with empty vector (pcDNA) or SAMHD1 T592A. Two days posttransfection, cells were lysed and L1 proteins were precipitated with anti-FLAG antibody coupled to magnetic beads. A representative quantification of the precipitated SAMHD1 T592A signal is shown. HRP signals were quantified with AIDA Image analyzer software and normalized on bait signal and WCL input signal. c 293T cells were transfected with a L1 expression plasmid together with empty vector (pcDNA), SAMHD1 T592A, or MOV10. Cells were lysed 2 days posttransfection. Lysates were treated with either RNaseOUT or 15 μg/ml RNaseA prior to ORF1p-T7 precipitation using anti-T7 antibody coupled to magnetic beads. d 293T cells were transfected with empty vector (pcDNA), L1 expression vector and expression plasmids for SAMHD1 wt, T592A, or T592D. Cells were lysed 2 days posttransfection and SAMHD1 was precipitated with an anti-myc antibody coupled to magnetic beads. Subsequently, MLV-RT and LEAP-RT reactions were performed and amplification products were visualized on a 2% agarose gel. Input protein content was controlled by immunoblot. One out of three independent experiments is shown. WCL: Whole cell lysate, IP: immunoprecipitation

Techniques Used: Transfection, Expressing, Plasmid Preparation, Magnetic Beads, Software, Amplification, Agarose Gel Electrophoresis, Immunoprecipitation

Related Articles

Centrifugation:

Article Title: Converse Regulatory Functions of Estrogen Receptor-? and -? Subtypes Expressed in Hypothalamic Gonadotropin-Releasing Hormone Neurons
Article Snippet: Cellular contents were expelled into 8.5 μl of a cDNA conversion mixture containing 50 m m Tris-HCl (pH 8.3), 75 m m KCl, 3 m m MgCl2 , 20 m m dithiothreitol, 0.5 m m deoxynucleotide triphosphates, 100 ng random hexamer primers, 200 ng oligo (deoxythymidine)12–15 , and 20 U RNaseOUT (hexamers, oligo(deoxythymidine), and RNaseOUT; Invitrogen, Carlsbad, CA). .. SuperScript II RNA H- (Invitrogen) and RNaseOUT were mixed in equal amounts and 2 μl added to each single-cell cDNA mixture. cDNA synthesis was performed at room temperature for 5 min and then at 42 C for 1 h. Contents were collected by centrifugation, frozen on dry ice, and stored at −70 C before multiplex RT-PCR.

Article Title: CD8+ Lymphocyte-Mediated Injury of Dorsal Root Ganglion Neurons during Lentivirus Infection: CD154-Dependent Cell Contact Neurotoxicity
Article Snippet: Isopropyl alcohol (500 μl) was added to precipitate the total RNA at room temperature for 10 min followed by centrifugation at 13,000 × g for 20 min at 4°C. .. RNA was treated with DNase (2 μg/ml; Invitrogen) in the presence of 20 U of RNaseout (Invitrogen) at 37°C for 1 h followed by 10 min incubation at 70°C, shown to be free of contaminating cellular DNA. cDNA was synthesized using 1 μg of RNA, 5 μl of 10 μ m dNTP, 100 ng of random primers (Roche, Laval, Quebec, Canada), 200 U of Superscript (Invitrogen), and 20 U of RNaseout (Invitrogen).

Amplification:

Article Title: Vaccine-induced CD8+ T cells control AIDS virus replication
Article Snippet: Virus was amplified in the activated PBMC and cell-free supernatant was collected two days after peak syncytium formation. .. Viral RNA was dissolved in 30 μL molecular biology grade water with 1 mM DTT and 1 U/μL RNAseOUT (Invitrogen, Carlsbad, CA, USA).

Synthesized:

Article Title: CD8+ Lymphocyte-Mediated Injury of Dorsal Root Ganglion Neurons during Lentivirus Infection: CD154-Dependent Cell Contact Neurotoxicity
Article Snippet: .. RNA was treated with DNase (2 μg/ml; Invitrogen) in the presence of 20 U of RNaseout (Invitrogen) at 37°C for 1 h followed by 10 min incubation at 70°C, shown to be free of contaminating cellular DNA. cDNA was synthesized using 1 μg of RNA, 5 μl of 10 μ m dNTP, 100 ng of random primers (Roche, Laval, Quebec, Canada), 200 U of Superscript (Invitrogen), and 20 U of RNaseout (Invitrogen). ..

Article Title: Nucleic acid binding proteins affect the subcellular distribution of phosphorothioate antisense oligonucleotides
Article Snippet: AlexaFluor-594-labeled probe was synthesized from the gel-purified PCR product using the FISH Tag Multicolor Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. .. Cells were transiently transfected with tGFP-FUS-WT or tGFP-FUS-P525L plasmids for 24 h as described above, and subsequent processing steps were carried out using RNase-free reagents supplemented with RNaseOUT (Thermo Fisher Scientific).

Real-time Polymerase Chain Reaction:

Article Title: Methods to Quantify microRNAs in the Myc Gene Network for Posttranscriptional Gene Repression
Article Snippet: Poly(A) tailing of miRNAs: Poly(A) Polymerase Tailing Kit (Epicentre), RNaseOUT (Life Technologies), and nuclease-free water. cDNA synthesis of poly(A) tailed miRNAs: small RNA reverse transcription primer (CGAATTCTAGAGCTCGAGGCAGGCGACATGGCTGGCTAGTTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCTTTTTTTTTTTTTTTTTTTTTTTTTVN), 10 mM dNTP, nuclease-free water, RNaseOUT (Life Technologies), and SuperScript III reverse transcriptase (Life Technologies). .. Real-time PCR: miRNA-specific forward primer, universal reverse primer (CGAATTCTAGAGCTCGAGGC), TaqMan probe (6FAM-CTCGGATCCACTAGTC-MGBNFQ, Life Technologies), Taq Man Universal Master Mix without UNG AmpErase (Life Technologies), nuclease-free water. miRNA-specific forward primer is designed based on the sequences of target miRNAs, and this design should obey the general guidelines of primer design.

Multiplex Assay:

Article Title: Converse Regulatory Functions of Estrogen Receptor-? and -? Subtypes Expressed in Hypothalamic Gonadotropin-Releasing Hormone Neurons
Article Snippet: Cellular contents were expelled into 8.5 μl of a cDNA conversion mixture containing 50 m m Tris-HCl (pH 8.3), 75 m m KCl, 3 m m MgCl2 , 20 m m dithiothreitol, 0.5 m m deoxynucleotide triphosphates, 100 ng random hexamer primers, 200 ng oligo (deoxythymidine)12–15 , and 20 U RNaseOUT (hexamers, oligo(deoxythymidine), and RNaseOUT; Invitrogen, Carlsbad, CA). .. SuperScript II RNA H- (Invitrogen) and RNaseOUT were mixed in equal amounts and 2 μl added to each single-cell cDNA mixture. cDNA synthesis was performed at room temperature for 5 min and then at 42 C for 1 h. Contents were collected by centrifugation, frozen on dry ice, and stored at −70 C before multiplex RT-PCR.

Random Hexamer Labeling:

Article Title: Vaccine-induced CD8+ T cells control AIDS virus replication
Article Snippet: Viral RNA was dissolved in 30 μL molecular biology grade water with 1 mM DTT and 1 U/μL RNAseOUT (Invitrogen, Carlsbad, CA, USA). .. Each reaction contained 10 μL RNA and 20 μL of a reverse transcriptase (RT) master mix so that the final reactions contained 50 mM Tris-Cl, pH 8.3 and 50 mM KCl (1x PCR II Buffer; Applied Biosystems, Foster City, CA, USA), 0.05% gelatin (Sigma, St Louis, MO, USA), 0.02% Tween 20 (Sigma), 5 mM MgCl2 , 0.5 mM of each dNTP, 150 ng random hexamer primers (Promega, Madison, WI, USA), 20 U RNAseOUT, and 20 U Superscript II reverse transcriptase (Invitrogen).

Article Title: Converse Regulatory Functions of Estrogen Receptor-? and -? Subtypes Expressed in Hypothalamic Gonadotropin-Releasing Hormone Neurons
Article Snippet: .. Cellular contents were expelled into 8.5 μl of a cDNA conversion mixture containing 50 m m Tris-HCl (pH 8.3), 75 m m KCl, 3 m m MgCl2 , 20 m m dithiothreitol, 0.5 m m deoxynucleotide triphosphates, 100 ng random hexamer primers, 200 ng oligo (deoxythymidine)12–15 , and 20 U RNaseOUT (hexamers, oligo(deoxythymidine), and RNaseOUT; Invitrogen, Carlsbad, CA). .. SuperScript II RNA H- (Invitrogen) and RNaseOUT were mixed in equal amounts and 2 μl added to each single-cell cDNA mixture. cDNA synthesis was performed at room temperature for 5 min and then at 42 C for 1 h. Contents were collected by centrifugation, frozen on dry ice, and stored at −70 C before multiplex RT-PCR.

Infection:

Article Title: Vaccine-induced CD8+ T cells control AIDS virus replication
Article Snippet: Paragraph title: SIV infection and viral load measurement ... Viral RNA was dissolved in 30 μL molecular biology grade water with 1 mM DTT and 1 U/μL RNAseOUT (Invitrogen, Carlsbad, CA, USA).

Expressing:

Article Title: Converse Regulatory Functions of Estrogen Receptor-? and -? Subtypes Expressed in Hypothalamic Gonadotropin-Releasing Hormone Neurons
Article Snippet: Paragraph title: Expression of ER Subtypes in Cultured Hypothalamic GnRH Neurons ... Cellular contents were expelled into 8.5 μl of a cDNA conversion mixture containing 50 m m Tris-HCl (pH 8.3), 75 m m KCl, 3 m m MgCl2 , 20 m m dithiothreitol, 0.5 m m deoxynucleotide triphosphates, 100 ng random hexamer primers, 200 ng oligo (deoxythymidine)12–15 , and 20 U RNaseOUT (hexamers, oligo(deoxythymidine), and RNaseOUT; Invitrogen, Carlsbad, CA).

miRNA RT:

Article Title: Methods to Quantify microRNAs in the Myc Gene Network for Posttranscriptional Gene Repression
Article Snippet: Paragraph title: 2.1 miRNA Real- Time PCR ... Poly(A) tailing of miRNAs: Poly(A) Polymerase Tailing Kit (Epicentre), RNaseOUT (Life Technologies), and nuclease-free water. cDNA synthesis of poly(A) tailed miRNAs: small RNA reverse transcription primer (CGAATTCTAGAGCTCGAGGCAGGCGACATGGCTGGCTAGTTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCTTTTTTTTTTTTTTTTTTTTTTTTTVN), 10 mM dNTP, nuclease-free water, RNaseOUT (Life Technologies), and SuperScript III reverse transcriptase (Life Technologies).

Modification:

Article Title: Converse Regulatory Functions of Estrogen Receptor-? and -? Subtypes Expressed in Hypothalamic Gonadotropin-Releasing Hormone Neurons
Article Snippet: A modification of the protocol described by ( ) was used to complete cDNA conversion. .. Cellular contents were expelled into 8.5 μl of a cDNA conversion mixture containing 50 m m Tris-HCl (pH 8.3), 75 m m KCl, 3 m m MgCl2 , 20 m m dithiothreitol, 0.5 m m deoxynucleotide triphosphates, 100 ng random hexamer primers, 200 ng oligo (deoxythymidine)12–15 , and 20 U RNaseOUT (hexamers, oligo(deoxythymidine), and RNaseOUT; Invitrogen, Carlsbad, CA).

Allele-specific Oligonucleotide:

Article Title: A viral Sm-class RNA base-pairs with mRNAs and recruits miRNAs to inhibit apoptosis
Article Snippet: .. Thirty to forty million cj319-WT cells were transfected with Control or HSUR 2 ASO as described above and used to prepare whole cell extracts in 0.35–0.4 ml of NET-2 buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.05% Nonidet-40) containing cOmplete™ protease inhibitors, 1 mM PMSF and 5 μl of RNAseOUT™ (ThermoFisher Scientific). ..

Hybridization:

Article Title: Nucleic acid binding proteins affect the subcellular distribution of phosphorothioate antisense oligonucleotides
Article Snippet: Fluorescence in situ hybridization (FISH) detection of NEAT1 lncRNA A hybridization probe for detection of both NEAT1 –1 and NEAT1 –2 lncRNAs was prepared from HeLa genomic DNA (gDNA) isolated using the PureLink Genomic DNA isolation kit (Thermo Fisher Scientific). .. Cells were transiently transfected with tGFP-FUS-WT or tGFP-FUS-P525L plasmids for 24 h as described above, and subsequent processing steps were carried out using RNase-free reagents supplemented with RNaseOUT (Thermo Fisher Scientific).

Flow Cytometry:

Article Title: A viral Sm-class RNA base-pairs with mRNAs and recruits miRNAs to inhibit apoptosis
Article Snippet: Thirty to forty million cj319-WT cells were transfected with Control or HSUR 2 ASO as described above and used to prepare whole cell extracts in 0.35–0.4 ml of NET-2 buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.05% Nonidet-40) containing cOmplete™ protease inhibitors, 1 mM PMSF and 5 μl of RNAseOUT™ (ThermoFisher Scientific). .. Rabbit anti-mouse IgG (ThermoFisher Scientific) was immobilized on Protein A Sepharose 4 Fast Flow beads (GE Healthcare) in bulk overnight at 4°C and aliquoted into corresponding tubes before the last wash to guarantee that all samples were incubated with the same amount of antibody.

Cell Harvesting:

Article Title: Converse Regulatory Functions of Estrogen Receptor-? and -? Subtypes Expressed in Hypothalamic Gonadotropin-Releasing Hormone Neurons
Article Snippet: Before cell harvesting, the cultures were washed with ice-cold PBS, and GnRH neurons identified by their morphological characteristics were individually harvested with a polished glass pipette. .. Cellular contents were expelled into 8.5 μl of a cDNA conversion mixture containing 50 m m Tris-HCl (pH 8.3), 75 m m KCl, 3 m m MgCl2 , 20 m m dithiothreitol, 0.5 m m deoxynucleotide triphosphates, 100 ng random hexamer primers, 200 ng oligo (deoxythymidine)12–15 , and 20 U RNaseOUT (hexamers, oligo(deoxythymidine), and RNaseOUT; Invitrogen, Carlsbad, CA).

Protease Inhibitor:

Article Title: The SAMHD1-mediated block of LINE-1 retroelements is regulated by phosphorylation
Article Snippet: .. Immunoprecipitation assays 293T cells were lysed 48 h posttransfection in 160 mM NaCl, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, and 0.25% NP-40, supplemented with Halt Protease Inhibitor, 1 mM PMSF (Sigma), and RNaseOUT (Life Technologies). .. RNase inhibitors were omitted from samples treated with 15 μg/ml RNaseA (Life Technologies).

Article Title: The SAMHD1-mediated block of LINE-1 retroelements is regulated by phosphorylation
Article Snippet: .. 293T cells were lysed 48 h posttransfection in 160 mM NaCl, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, and 0.25% NP-40, supplemented with Halt Protease Inhibitor, 1 mM PMSF (Sigma), and RNaseOUT (Life Technologies). .. RNase inhibitors were omitted from samples treated with 15 μg/ml RNaseA (Life Technologies).

Transferring:

Article Title: Chronic nicotine differentially affects murine transcriptome profiling in isolated cortical interneurons and pyramidal neurons
Article Snippet: Fluorescent cells (Sst- or Thy1- positive) were carefully aspirated by a micropipette (30–50 μm) shaped by a pipette puller (P-97, Sutter, USA) [ ]. .. Cells (10 in each) were then transferred to 3.5 μl lysis buffer containing 2% Triton X-100 and 5% RNaseOUT (20U/μl, Invitrogen) in nuclease free water and were immediately stored at − 80 °C.

Article Title: Converse Regulatory Functions of Estrogen Receptor-? and -? Subtypes Expressed in Hypothalamic Gonadotropin-Releasing Hormone Neurons
Article Snippet: Before cell harvesting, the cultures were washed with ice-cold PBS, and GnRH neurons identified by their morphological characteristics were individually harvested with a polished glass pipette. .. Cellular contents were expelled into 8.5 μl of a cDNA conversion mixture containing 50 m m Tris-HCl (pH 8.3), 75 m m KCl, 3 m m MgCl2 , 20 m m dithiothreitol, 0.5 m m deoxynucleotide triphosphates, 100 ng random hexamer primers, 200 ng oligo (deoxythymidine)12–15 , and 20 U RNaseOUT (hexamers, oligo(deoxythymidine), and RNaseOUT; Invitrogen, Carlsbad, CA).

Cell Culture:

Article Title: Converse Regulatory Functions of Estrogen Receptor-? and -? Subtypes Expressed in Hypothalamic Gonadotropin-Releasing Hormone Neurons
Article Snippet: Paragraph title: Expression of ER Subtypes in Cultured Hypothalamic GnRH Neurons ... Cellular contents were expelled into 8.5 μl of a cDNA conversion mixture containing 50 m m Tris-HCl (pH 8.3), 75 m m KCl, 3 m m MgCl2 , 20 m m dithiothreitol, 0.5 m m deoxynucleotide triphosphates, 100 ng random hexamer primers, 200 ng oligo (deoxythymidine)12–15 , and 20 U RNaseOUT (hexamers, oligo(deoxythymidine), and RNaseOUT; Invitrogen, Carlsbad, CA).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Converse Regulatory Functions of Estrogen Receptor-? and -? Subtypes Expressed in Hypothalamic Gonadotropin-Releasing Hormone Neurons
Article Snippet: Cellular contents were expelled into 8.5 μl of a cDNA conversion mixture containing 50 m m Tris-HCl (pH 8.3), 75 m m KCl, 3 m m MgCl2 , 20 m m dithiothreitol, 0.5 m m deoxynucleotide triphosphates, 100 ng random hexamer primers, 200 ng oligo (deoxythymidine)12–15 , and 20 U RNaseOUT (hexamers, oligo(deoxythymidine), and RNaseOUT; Invitrogen, Carlsbad, CA). .. SuperScript II RNA H- (Invitrogen) and RNaseOUT were mixed in equal amounts and 2 μl added to each single-cell cDNA mixture. cDNA synthesis was performed at room temperature for 5 min and then at 42 C for 1 h. Contents were collected by centrifugation, frozen on dry ice, and stored at −70 C before multiplex RT-PCR.

Generated:

Article Title: Vaccine-induced CD8+ T cells control AIDS virus replication
Article Snippet: Clonal SIVmac239 was generated by transfection of Vero cells with plasmid DNA encoding proviral sequences. .. Viral RNA was dissolved in 30 μL molecular biology grade water with 1 mM DTT and 1 U/μL RNAseOUT (Invitrogen, Carlsbad, CA, USA).

Polymerase Chain Reaction:

Article Title: Vaccine-induced CD8+ T cells control AIDS virus replication
Article Snippet: Viral RNA was dissolved in 30 μL molecular biology grade water with 1 mM DTT and 1 U/μL RNAseOUT (Invitrogen, Carlsbad, CA, USA). .. Each reaction contained 10 μL RNA and 20 μL of a reverse transcriptase (RT) master mix so that the final reactions contained 50 mM Tris-Cl, pH 8.3 and 50 mM KCl (1x PCR II Buffer; Applied Biosystems, Foster City, CA, USA), 0.05% gelatin (Sigma, St Louis, MO, USA), 0.02% Tween 20 (Sigma), 5 mM MgCl2 , 0.5 mM of each dNTP, 150 ng random hexamer primers (Promega, Madison, WI, USA), 20 U RNAseOUT, and 20 U Superscript II reverse transcriptase (Invitrogen).

Article Title: Protein interaction mapping with ribosome-displayed using PLATO ORF libraries
Article Snippet: .. 7.5 μ g mRNA in a 50 μ l reaction containing 1 μ l RNAseOUT (Invitrogen) was subjected to in vitro translation performed on PCR machine at 30 °C for 15 min. 12.5 μ l aliquots of each translation reaction was diluted with 85.5 μ l ice cold RD selection buffer (RD wash buffer (50 mM Tris Acetate, 150 mM NaCl, pH to 7.5 50 mM Mg Acetate, 0.5% Tween 20), 2.5 mg/ml heparin, 1% BSA, 100 μ g/ml yeast tRNA with 2 μ l RNAseOUT. ..

Article Title: Methods to Quantify microRNAs in the Myc Gene Network for Posttranscriptional Gene Repression
Article Snippet: Paragraph title: 2.1 miRNA Real- Time PCR ... Poly(A) tailing of miRNAs: Poly(A) Polymerase Tailing Kit (Epicentre), RNaseOUT (Life Technologies), and nuclease-free water. cDNA synthesis of poly(A) tailed miRNAs: small RNA reverse transcription primer (CGAATTCTAGAGCTCGAGGCAGGCGACATGGCTGGCTAGTTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCTTTTTTTTTTTTTTTTTTTTTTTTTVN), 10 mM dNTP, nuclease-free water, RNaseOUT (Life Technologies), and SuperScript III reverse transcriptase (Life Technologies).

Article Title: Faustovirus E12 Transcriptome Analysis Reveals Complex Splicing in Capsid Gene
Article Snippet: RNaseOUT (Thermo Fisher Scientific, France) was added to the elute to prevent RNA degradation. .. Genomic DNA contamination was checked using a PCR system targeting Faustovirus E12 DNA (forward primer: TCGGCATCAATCGCCTTATAG; reverse primer: GGCCAGAAGGGTCATTAACA).

Article Title: Nucleic acid binding proteins affect the subcellular distribution of phosphorothioate antisense oligonucleotides
Article Snippet: AlexaFluor-594-labeled probe was synthesized from the gel-purified PCR product using the FISH Tag Multicolor Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. .. Cells were transiently transfected with tGFP-FUS-WT or tGFP-FUS-P525L plasmids for 24 h as described above, and subsequent processing steps were carried out using RNase-free reagents supplemented with RNaseOUT (Thermo Fisher Scientific).

DNA Extraction:

Article Title: Nucleic acid binding proteins affect the subcellular distribution of phosphorothioate antisense oligonucleotides
Article Snippet: Fluorescence in situ hybridization (FISH) detection of NEAT1 lncRNA A hybridization probe for detection of both NEAT1 –1 and NEAT1 –2 lncRNAs was prepared from HeLa genomic DNA (gDNA) isolated using the PureLink Genomic DNA isolation kit (Thermo Fisher Scientific). .. Cells were transiently transfected with tGFP-FUS-WT or tGFP-FUS-P525L plasmids for 24 h as described above, and subsequent processing steps were carried out using RNase-free reagents supplemented with RNaseOUT (Thermo Fisher Scientific).

Fluorescence:

Article Title: Nucleic acid binding proteins affect the subcellular distribution of phosphorothioate antisense oligonucleotides
Article Snippet: Paragraph title: Fluorescence in situ hybridization (FISH) detection of NEAT1 lncRNA ... Cells were transiently transfected with tGFP-FUS-WT or tGFP-FUS-P525L plasmids for 24 h as described above, and subsequent processing steps were carried out using RNase-free reagents supplemented with RNaseOUT (Thermo Fisher Scientific).

Magnetic Beads:

Article Title: The SAMHD1-mediated block of LINE-1 retroelements is regulated by phosphorylation
Article Snippet: Immunoprecipitation assays 293T cells were lysed 48 h posttransfection in 160 mM NaCl, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, and 0.25% NP-40, supplemented with Halt Protease Inhibitor, 1 mM PMSF (Sigma), and RNaseOUT (Life Technologies). .. FLAG- or T7-tagged L1 proteins were immunoprecipitated with anti-FLAG M2 (Sigma) or anti-T7 (Novagen) monoclonal antibodies coupled to magnetic beads (Dynabeads, Thermo Fisher).

Article Title: The SAMHD1-mediated block of LINE-1 retroelements is regulated by phosphorylation
Article Snippet: 293T cells were lysed 48 h posttransfection in 160 mM NaCl, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, and 0.25% NP-40, supplemented with Halt Protease Inhibitor, 1 mM PMSF (Sigma), and RNaseOUT (Life Technologies). .. FLAG- or T7-tagged L1 proteins were immunoprecipitated with anti-FLAG M2 (Sigma) or anti-T7 (Novagen) monoclonal antibodies coupled to magnetic beads (Dynabeads, Thermo Fisher).

Isolation:

Article Title: Methods to Quantify microRNAs in the Myc Gene Network for Posttranscriptional Gene Repression
Article Snippet: RNA isolation: TRIzol Reagent (Life Technologies), chloroform, isopropanol, 75 % ethanol, and nuclease-free water. .. Poly(A) tailing of miRNAs: Poly(A) Polymerase Tailing Kit (Epicentre), RNaseOUT (Life Technologies), and nuclease-free water. cDNA synthesis of poly(A) tailed miRNAs: small RNA reverse transcription primer (CGAATTCTAGAGCTCGAGGCAGGCGACATGGCTGGCTAGTTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCTTTTTTTTTTTTTTTTTTTTTTTTTVN), 10 mM dNTP, nuclease-free water, RNaseOUT (Life Technologies), and SuperScript III reverse transcriptase (Life Technologies).

Article Title: Nucleic acid binding proteins affect the subcellular distribution of phosphorothioate antisense oligonucleotides
Article Snippet: Fluorescence in situ hybridization (FISH) detection of NEAT1 lncRNA A hybridization probe for detection of both NEAT1 –1 and NEAT1 –2 lncRNAs was prepared from HeLa genomic DNA (gDNA) isolated using the PureLink Genomic DNA isolation kit (Thermo Fisher Scientific). .. Cells were transiently transfected with tGFP-FUS-WT or tGFP-FUS-P525L plasmids for 24 h as described above, and subsequent processing steps were carried out using RNase-free reagents supplemented with RNaseOUT (Thermo Fisher Scientific).

Transfection:

Article Title: Vaccine-induced CD8+ T cells control AIDS virus replication
Article Snippet: Activated PBMC from 4 SIV-naïve rhesus macaques were then added to the culture 1 day later and removed from the Vero cells into flasks 3 days after the initial transfection. .. Viral RNA was dissolved in 30 μL molecular biology grade water with 1 mM DTT and 1 U/μL RNAseOUT (Invitrogen, Carlsbad, CA, USA).

Article Title: A viral Sm-class RNA base-pairs with mRNAs and recruits miRNAs to inhibit apoptosis
Article Snippet: .. Thirty to forty million cj319-WT cells were transfected with Control or HSUR 2 ASO as described above and used to prepare whole cell extracts in 0.35–0.4 ml of NET-2 buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.05% Nonidet-40) containing cOmplete™ protease inhibitors, 1 mM PMSF and 5 μl of RNAseOUT™ (ThermoFisher Scientific). ..

Article Title: Nucleic acid binding proteins affect the subcellular distribution of phosphorothioate antisense oligonucleotides
Article Snippet: .. Cells were transiently transfected with tGFP-FUS-WT or tGFP-FUS-P525L plasmids for 24 h as described above, and subsequent processing steps were carried out using RNase-free reagents supplemented with RNaseOUT (Thermo Fisher Scientific). .. Following transfection, cells were fixed with 4% formaldehyde in 1× PBS for 30 min at room temperature, washed twice with 1× PBS, permeabilized with 0.4% Triton X-100 in 1× PBS for 5 min, washed three times with 1× PBS, and washed once in 2× SSC for 5 min. Probe hybridization mixture (50% formamide, 2× SSC, 5% dextran sulfate, 5 mM EDTA, 1× Denhardt's solution, 50 μg Escherichia coli tRNAs (Sigma-Aldrich), and 250 ng of labeled RNA probe) was heated for 10 min at 75°C and chilled immediately on ice.

Labeling:

Article Title: The N6-methyladenosine (m6A)-forming enzyme METTL3 controls myeloid differentiation of normal and leukemia cells
Article Snippet: 100 ng of poly(A) purified RNA was digested with 2U ribonuclease T1 for 2h at 37°C in the presence of RNAseOUT (Invitrogen). .. Digested RNA was 5′ labeled with 0.4 mBq [γ-32 P] ATP for 30 min at 37°C followed by removal of the γ– phosphate of ATP by incubation with 10U apyrase (NEB) for 30 min at 30°C.

Article Title: Nucleic acid binding proteins affect the subcellular distribution of phosphorothioate antisense oligonucleotides
Article Snippet: Cells were transiently transfected with tGFP-FUS-WT or tGFP-FUS-P525L plasmids for 24 h as described above, and subsequent processing steps were carried out using RNase-free reagents supplemented with RNaseOUT (Thermo Fisher Scientific). .. Following transfection, cells were fixed with 4% formaldehyde in 1× PBS for 30 min at room temperature, washed twice with 1× PBS, permeabilized with 0.4% Triton X-100 in 1× PBS for 5 min, washed three times with 1× PBS, and washed once in 2× SSC for 5 min. Probe hybridization mixture (50% formamide, 2× SSC, 5% dextran sulfate, 5 mM EDTA, 1× Denhardt's solution, 50 μg Escherichia coli tRNAs (Sigma-Aldrich), and 250 ng of labeled RNA probe) was heated for 10 min at 75°C and chilled immediately on ice.

Purification:

Article Title: Protein interaction mapping with ribosome-displayed using PLATO ORF libraries
Article Snippet: RNA products were purified using RNeasy® column (Qiagen). .. 7.5 μ g mRNA in a 50 μ l reaction containing 1 μ l RNAseOUT (Invitrogen) was subjected to in vitro translation performed on PCR machine at 30 °C for 15 min. 12.5 μ l aliquots of each translation reaction was diluted with 85.5 μ l ice cold RD selection buffer (RD wash buffer (50 mM Tris Acetate, 150 mM NaCl, pH to 7.5 50 mM Mg Acetate, 0.5% Tween 20), 2.5 mg/ml heparin, 1% BSA, 100 μ g/ml yeast tRNA with 2 μ l RNAseOUT.

Article Title: The N6-methyladenosine (m6A)-forming enzyme METTL3 controls myeloid differentiation of normal and leukemia cells
Article Snippet: .. 100 ng of poly(A) purified RNA was digested with 2U ribonuclease T1 for 2h at 37°C in the presence of RNAseOUT (Invitrogen). .. Digested RNA was 5′ labeled with 0.4 mBq [γ-32 P] ATP for 30 min at 37°C followed by removal of the γ– phosphate of ATP by incubation with 10U apyrase (NEB) for 30 min at 30°C.

Sequencing:

Article Title: Faustovirus E12 Transcriptome Analysis Reveals Complex Splicing in Capsid Gene
Article Snippet: Paragraph title: RNA Extraction and cDNA Sequencing ... RNaseOUT (Thermo Fisher Scientific, France) was added to the elute to prevent RNA degradation.

FACS:

Article Title: Chronic nicotine differentially affects murine transcriptome profiling in isolated cortical interneurons and pyramidal neurons
Article Snippet: Paragraph title: Brain slice preparation and cell sorting ... Cells (10 in each) were then transferred to 3.5 μl lysis buffer containing 2% Triton X-100 and 5% RNaseOUT (20U/μl, Invitrogen) in nuclease free water and were immediately stored at − 80 °C.

Mouse Assay:

Article Title: Chronic nicotine differentially affects murine transcriptome profiling in isolated cortical interneurons and pyramidal neurons
Article Snippet: Brain slice preparation and cell sorting Mice were deeply anesthetized with sodium pentobarbital (100 mg/kg; i.p.) and decapitated [ ]. .. Cells (10 in each) were then transferred to 3.5 μl lysis buffer containing 2% Triton X-100 and 5% RNaseOUT (20U/μl, Invitrogen) in nuclease free water and were immediately stored at − 80 °C.

In Situ Hybridization:

Article Title: Nucleic acid binding proteins affect the subcellular distribution of phosphorothioate antisense oligonucleotides
Article Snippet: Paragraph title: Fluorescence in situ hybridization (FISH) detection of NEAT1 lncRNA ... Cells were transiently transfected with tGFP-FUS-WT or tGFP-FUS-P525L plasmids for 24 h as described above, and subsequent processing steps were carried out using RNase-free reagents supplemented with RNaseOUT (Thermo Fisher Scientific).

Plasmid Preparation:

Article Title: Vaccine-induced CD8+ T cells control AIDS virus replication
Article Snippet: Clonal SIVmac239 was generated by transfection of Vero cells with plasmid DNA encoding proviral sequences. .. Viral RNA was dissolved in 30 μL molecular biology grade water with 1 mM DTT and 1 U/μL RNAseOUT (Invitrogen, Carlsbad, CA, USA).

RNA Extraction:

Article Title: Faustovirus E12 Transcriptome Analysis Reveals Complex Splicing in Capsid Gene
Article Snippet: Paragraph title: RNA Extraction and cDNA Sequencing ... RNaseOUT (Thermo Fisher Scientific, France) was added to the elute to prevent RNA degradation.

Article Title: CD8+ Lymphocyte-Mediated Injury of Dorsal Root Ganglion Neurons during Lentivirus Infection: CD154-Dependent Cell Contact Neurotoxicity
Article Snippet: Paragraph title: RNA extraction and cDNA synthesis. ... RNA was treated with DNase (2 μg/ml; Invitrogen) in the presence of 20 U of RNaseout (Invitrogen) at 37°C for 1 h followed by 10 min incubation at 70°C, shown to be free of contaminating cellular DNA. cDNA was synthesized using 1 μg of RNA, 5 μl of 10 μ m dNTP, 100 ng of random primers (Roche, Laval, Quebec, Canada), 200 U of Superscript (Invitrogen), and 20 U of RNaseout (Invitrogen).

Selection:

Article Title: Protein interaction mapping with ribosome-displayed using PLATO ORF libraries
Article Snippet: .. 7.5 μ g mRNA in a 50 μ l reaction containing 1 μ l RNAseOUT (Invitrogen) was subjected to in vitro translation performed on PCR machine at 30 °C for 15 min. 12.5 μ l aliquots of each translation reaction was diluted with 85.5 μ l ice cold RD selection buffer (RD wash buffer (50 mM Tris Acetate, 150 mM NaCl, pH to 7.5 50 mM Mg Acetate, 0.5% Tween 20), 2.5 mg/ml heparin, 1% BSA, 100 μ g/ml yeast tRNA with 2 μ l RNAseOUT. ..

In Vitro:

Article Title: Protein interaction mapping with ribosome-displayed using PLATO ORF libraries
Article Snippet: .. 7.5 μ g mRNA in a 50 μ l reaction containing 1 μ l RNAseOUT (Invitrogen) was subjected to in vitro translation performed on PCR machine at 30 °C for 15 min. 12.5 μ l aliquots of each translation reaction was diluted with 85.5 μ l ice cold RD selection buffer (RD wash buffer (50 mM Tris Acetate, 150 mM NaCl, pH to 7.5 50 mM Mg Acetate, 0.5% Tween 20), 2.5 mg/ml heparin, 1% BSA, 100 μ g/ml yeast tRNA with 2 μ l RNAseOUT. ..

Ethanol Precipitation:

Article Title: The N6-methyladenosine (m6A)-forming enzyme METTL3 controls myeloid differentiation of normal and leukemia cells
Article Snippet: 100 ng of poly(A) purified RNA was digested with 2U ribonuclease T1 for 2h at 37°C in the presence of RNAseOUT (Invitrogen). .. RNA was purified by phenol-chloroform extraction and ethanol precipitation and resuspended in 10 μl of DEPC-H2 O and digested to single nucleotides with 2U of P1 nuclease for 3h at 37°C.

Incubation:

Article Title: Pumilio directs deadenylation-associated translational repression of the cyclin-dependent kinase 1 activator RGC-32
Article Snippet: Cell pellets were lysed on ice for 30 min in 250 μl lysis buffer per 107 cells, supplemented with protease inhibitors (Roche) and RnaseOUT (Invitrogen) (50 mM Hepes pH 7.4, 1% NP40, 0.25% NaDOC, 1 mM EDTA, 2 mM DTT, 150 mM NaCl, 5 mM MgCl2 ). .. Pre-blocked protein G sepharose beads for use in immunoprecipitations were prepared by incubating 500 μl of a 50% protein G Sepharose (Sigma) slurry with incubation buffer supplemented with BSA 0.5% and yeast tRNA 100 μg/ml (Fisher) (50 mM Hepes pH 7.4, 0.2% NP40, 0.05% NaDOC, 1 mM EDTA, 2 mM DTT, 150 mM NaCl, 5 mM MgCl2 , protease inhibitors) for 30 min at 4°C with rotation.

Article Title: Chronic nicotine differentially affects murine transcriptome profiling in isolated cortical interneurons and pyramidal neurons
Article Snippet: The slices were then incubated in ACSF containing 50 μM APV, 20 μM DNQX and 100nM TTX for 30 min at 32 °C and then for at least 30 min at RT. .. Cells (10 in each) were then transferred to 3.5 μl lysis buffer containing 2% Triton X-100 and 5% RNaseOUT (20U/μl, Invitrogen) in nuclease free water and were immediately stored at − 80 °C.

Article Title: Faustovirus E12 Transcriptome Analysis Reveals Complex Splicing in Capsid Gene
Article Snippet: RNaseOUT (Thermo Fisher Scientific, France) was added to the elute to prevent RNA degradation. .. Two cycles of 30 min-DNase treatment using TURBO DNase (Invitrogen, France) incubation at 37°C were performed on the samples to achieve absence of DNA contamination.

Article Title: CD8+ Lymphocyte-Mediated Injury of Dorsal Root Ganglion Neurons during Lentivirus Infection: CD154-Dependent Cell Contact Neurotoxicity
Article Snippet: .. RNA was treated with DNase (2 μg/ml; Invitrogen) in the presence of 20 U of RNaseout (Invitrogen) at 37°C for 1 h followed by 10 min incubation at 70°C, shown to be free of contaminating cellular DNA. cDNA was synthesized using 1 μg of RNA, 5 μl of 10 μ m dNTP, 100 ng of random primers (Roche, Laval, Quebec, Canada), 200 U of Superscript (Invitrogen), and 20 U of RNaseout (Invitrogen). ..

Article Title: The N6-methyladenosine (m6A)-forming enzyme METTL3 controls myeloid differentiation of normal and leukemia cells
Article Snippet: 100 ng of poly(A) purified RNA was digested with 2U ribonuclease T1 for 2h at 37°C in the presence of RNAseOUT (Invitrogen). .. Digested RNA was 5′ labeled with 0.4 mBq [γ-32 P] ATP for 30 min at 37°C followed by removal of the γ– phosphate of ATP by incubation with 10U apyrase (NEB) for 30 min at 30°C.

Article Title: A viral Sm-class RNA base-pairs with mRNAs and recruits miRNAs to inhibit apoptosis
Article Snippet: Thirty to forty million cj319-WT cells were transfected with Control or HSUR 2 ASO as described above and used to prepare whole cell extracts in 0.35–0.4 ml of NET-2 buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.05% Nonidet-40) containing cOmplete™ protease inhibitors, 1 mM PMSF and 5 μl of RNAseOUT™ (ThermoFisher Scientific). .. Rabbit anti-mouse IgG (ThermoFisher Scientific) was immobilized on Protein A Sepharose 4 Fast Flow beads (GE Healthcare) in bulk overnight at 4°C and aliquoted into corresponding tubes before the last wash to guarantee that all samples were incubated with the same amount of antibody.

Slice Preparation:

Article Title: Chronic nicotine differentially affects murine transcriptome profiling in isolated cortical interneurons and pyramidal neurons
Article Snippet: Paragraph title: Brain slice preparation and cell sorting ... Cells (10 in each) were then transferred to 3.5 μl lysis buffer containing 2% Triton X-100 and 5% RNaseOUT (20U/μl, Invitrogen) in nuclease free water and were immediately stored at − 80 °C.

Immunoprecipitation:

Article Title: Pumilio directs deadenylation-associated translational repression of the cyclin-dependent kinase 1 activator RGC-32
Article Snippet: Paragraph title: RNA immunoprecipitation experiments ... Cell pellets were lysed on ice for 30 min in 250 μl lysis buffer per 107 cells, supplemented with protease inhibitors (Roche) and RnaseOUT (Invitrogen) (50 mM Hepes pH 7.4, 1% NP40, 0.25% NaDOC, 1 mM EDTA, 2 mM DTT, 150 mM NaCl, 5 mM MgCl2 ).

Article Title: The SAMHD1-mediated block of LINE-1 retroelements is regulated by phosphorylation
Article Snippet: .. Immunoprecipitation assays 293T cells were lysed 48 h posttransfection in 160 mM NaCl, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, and 0.25% NP-40, supplemented with Halt Protease Inhibitor, 1 mM PMSF (Sigma), and RNaseOUT (Life Technologies). .. RNase inhibitors were omitted from samples treated with 15 μg/ml RNaseA (Life Technologies).

Article Title: A viral Sm-class RNA base-pairs with mRNAs and recruits miRNAs to inhibit apoptosis
Article Snippet: Paragraph title: Immunoprecipitation ... Thirty to forty million cj319-WT cells were transfected with Control or HSUR 2 ASO as described above and used to prepare whole cell extracts in 0.35–0.4 ml of NET-2 buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.05% Nonidet-40) containing cOmplete™ protease inhibitors, 1 mM PMSF and 5 μl of RNAseOUT™ (ThermoFisher Scientific).

Article Title: The SAMHD1-mediated block of LINE-1 retroelements is regulated by phosphorylation
Article Snippet: Paragraph title: Immunoprecipitation assays ... 293T cells were lysed 48 h posttransfection in 160 mM NaCl, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, and 0.25% NP-40, supplemented with Halt Protease Inhibitor, 1 mM PMSF (Sigma), and RNaseOUT (Life Technologies).

Thin Layer Chromatography:

Article Title: The N6-methyladenosine (m6A)-forming enzyme METTL3 controls myeloid differentiation of normal and leukemia cells
Article Snippet: Paragraph title: Determination of relative m6 A levels by two-dimensional thin layer chromatography ... 100 ng of poly(A) purified RNA was digested with 2U ribonuclease T1 for 2h at 37°C in the presence of RNAseOUT (Invitrogen).

Lysis:

Article Title: Pumilio directs deadenylation-associated translational repression of the cyclin-dependent kinase 1 activator RGC-32
Article Snippet: .. Cell pellets were lysed on ice for 30 min in 250 μl lysis buffer per 107 cells, supplemented with protease inhibitors (Roche) and RnaseOUT (Invitrogen) (50 mM Hepes pH 7.4, 1% NP40, 0.25% NaDOC, 1 mM EDTA, 2 mM DTT, 150 mM NaCl, 5 mM MgCl2 ). ..

Article Title: Chronic nicotine differentially affects murine transcriptome profiling in isolated cortical interneurons and pyramidal neurons
Article Snippet: .. Cells (10 in each) were then transferred to 3.5 μl lysis buffer containing 2% Triton X-100 and 5% RNaseOUT (20U/μl, Invitrogen) in nuclease free water and were immediately stored at − 80 °C. ..

Fluorescence In Situ Hybridization:

Article Title: Nucleic acid binding proteins affect the subcellular distribution of phosphorothioate antisense oligonucleotides
Article Snippet: Paragraph title: Fluorescence in situ hybridization (FISH) detection of NEAT1 lncRNA ... Cells were transiently transfected with tGFP-FUS-WT or tGFP-FUS-P525L plasmids for 24 h as described above, and subsequent processing steps were carried out using RNase-free reagents supplemented with RNaseOUT (Thermo Fisher Scientific).

SDS Page:

Article Title: The SAMHD1-mediated block of LINE-1 retroelements is regulated by phosphorylation
Article Snippet: Immunoprecipitation assays 293T cells were lysed 48 h posttransfection in 160 mM NaCl, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, and 0.25% NP-40, supplemented with Halt Protease Inhibitor, 1 mM PMSF (Sigma), and RNaseOUT (Life Technologies). .. Precipitated proteins were separated by SDS page and transferred onto PVDF membranes and probed with anti-myc (9B11) antibody (Cell Signaling) anti-FLAG M2 (Sigma), or anti-T7 antibody (Novagen).

Article Title: The SAMHD1-mediated block of LINE-1 retroelements is regulated by phosphorylation
Article Snippet: 293T cells were lysed 48 h posttransfection in 160 mM NaCl, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, and 0.25% NP-40, supplemented with Halt Protease Inhibitor, 1 mM PMSF (Sigma), and RNaseOUT (Life Technologies). .. Precipitated proteins were separated by SDS page and transferred onto PVDF membranes and probed with anti-myc (9B11) antibody (Cell Signaling) anti-FLAG M2 (Sigma), or anti-T7 antibody (Novagen).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher rnaseout recombinant ribonuclease inhibitor
    Rnaseout Recombinant Ribonuclease Inhibitor, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 870 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnaseout recombinant ribonuclease inhibitor/product/Thermo Fisher
    Average 90 stars, based on 870 article reviews
    Price from $9.99 to $1999.99
    rnaseout recombinant ribonuclease inhibitor - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results