rna  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Carrier RNA
    Description:
    For use with multiple QIAamp Viral RNA Mini Kits on the QIAcube. Kit contents: Carrier RNA (Poly rA) (310l).
    Catalog Number:
    1068337
    Price:
    None
    Category:
    QIAamp Viral RNA Mini Accessory Set
    Score:
    85
    Buy from Supplier


    Structured Review

    Qiagen rna
    Carrier RNA
    For use with multiple QIAamp Viral RNA Mini Kits on the QIAcube. Kit contents: Carrier RNA (Poly rA) (310l).
    https://www.bioz.com/result/rna/product/Qiagen
    Average 99 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    rna - by Bioz Stars, 2019-10
    99/100 stars

    Images

    1) Product Images from "Direct Cell Lysis for Single-Cell Gene Expression Profiling"

    Article Title: Direct Cell Lysis for Single-Cell Gene Expression Profiling

    Journal: Frontiers in Oncology

    doi: 10.3389/fonc.2013.00274

    Evaluation of direct cell lysis protocols on RT-qPCR . (A) The RT-qPCR yields of Gapdh , Vim , Dll1 , Jag1 , DNA, and RNA spike using 17 lysis conditions. Five nanograms of purified RNA was used in all RT reactions. Relative RT yields are presented as Cq-values on the left y -axis and relative transcript numbers on the right y -axis. The relative transcript number is expressed in percentage relative to the water control for each gene, assuming 100% RT efficiency and 100% PCR efficiency. Lysis conditions with Cq-values below that of the water control are RT enhancing agents, while conditions with higher Cq-values are inhibitory. Data are shown as mean ± SD ( n = 4). Missing data were excluded and are shown in Table S4 in Supplementary Material. (B) Mean RT yield for Gapdh , Vim , Dll , and Jag1 . The relative transcript yield of each transcript was averaged and compared to the optimal RT-qPCR condition (RT mix). Data are shown as mean ± SD ( n = 4). 7-deaz GTP, 7-deaza-2′ deoxyguanosine 5′ triphosphate lithium salt; GTC, guanidine thiocyanate; LPA, linear polyacrylamide; polyI, polyinosinic acid potassium salt; 2× RT buffer, 2× reverse transcription buffer; RT mix, 2× RT buffer, 5 μM random hexamers, 5 μM oligo-dT, and 1 mM dNTP.
    Figure Legend Snippet: Evaluation of direct cell lysis protocols on RT-qPCR . (A) The RT-qPCR yields of Gapdh , Vim , Dll1 , Jag1 , DNA, and RNA spike using 17 lysis conditions. Five nanograms of purified RNA was used in all RT reactions. Relative RT yields are presented as Cq-values on the left y -axis and relative transcript numbers on the right y -axis. The relative transcript number is expressed in percentage relative to the water control for each gene, assuming 100% RT efficiency and 100% PCR efficiency. Lysis conditions with Cq-values below that of the water control are RT enhancing agents, while conditions with higher Cq-values are inhibitory. Data are shown as mean ± SD ( n = 4). Missing data were excluded and are shown in Table S4 in Supplementary Material. (B) Mean RT yield for Gapdh , Vim , Dll , and Jag1 . The relative transcript yield of each transcript was averaged and compared to the optimal RT-qPCR condition (RT mix). Data are shown as mean ± SD ( n = 4). 7-deaz GTP, 7-deaza-2′ deoxyguanosine 5′ triphosphate lithium salt; GTC, guanidine thiocyanate; LPA, linear polyacrylamide; polyI, polyinosinic acid potassium salt; 2× RT buffer, 2× reverse transcription buffer; RT mix, 2× RT buffer, 5 μM random hexamers, 5 μM oligo-dT, and 1 mM dNTP.

    Techniques Used: Lysis, Quantitative RT-PCR, Purification, Polymerase Chain Reaction

    Evaluation of direct cell lysis protocols . (A) The lysis yields of Gapdh , Vim , Dll1 , Jag1 , DNA, and RNA spike compared at 17 lysis conditions. Thirty-two astrocytes were sorted for each condition. Relative cDNA yields are presented as Cq-values on the left y -axis and relative transcript numbers on the right y -axis. The relative transcript number is expressed in percentage compared to the optimal lysis condition for each gene, assuming 100% RT efficiency and 100% PCR efficiency. Data are shown as mean ± SD ( n = 4). Missing data were excluded and are listed in Table S3 in Supplementary Material. (B) Mean cDNA yield of the transcripts. Expressions of Gapdh , Vim , Dll , and Jag1 were averaged and are compared to the overall optimal lysis condition (1 mg/ml BSA). Data are shown as mean ± SD ( n = 4). 7-deaz GTP, 7-deaza-2′ deoxyguanosine 5′ triphosphate lithium salt; GTC, guanidine thiocyanate; LPA, linear polyacrylamide; polyI, polyinosinic acid potassium salt; 2× RT buffer, 2× reverse transcription buffer; RT mix, 2× RT buffer, 5 μM random hexamers, 5 μM oligo-dT, and 1 mM dNTP.
    Figure Legend Snippet: Evaluation of direct cell lysis protocols . (A) The lysis yields of Gapdh , Vim , Dll1 , Jag1 , DNA, and RNA spike compared at 17 lysis conditions. Thirty-two astrocytes were sorted for each condition. Relative cDNA yields are presented as Cq-values on the left y -axis and relative transcript numbers on the right y -axis. The relative transcript number is expressed in percentage compared to the optimal lysis condition for each gene, assuming 100% RT efficiency and 100% PCR efficiency. Data are shown as mean ± SD ( n = 4). Missing data were excluded and are listed in Table S3 in Supplementary Material. (B) Mean cDNA yield of the transcripts. Expressions of Gapdh , Vim , Dll , and Jag1 were averaged and are compared to the overall optimal lysis condition (1 mg/ml BSA). Data are shown as mean ± SD ( n = 4). 7-deaz GTP, 7-deaza-2′ deoxyguanosine 5′ triphosphate lithium salt; GTC, guanidine thiocyanate; LPA, linear polyacrylamide; polyI, polyinosinic acid potassium salt; 2× RT buffer, 2× reverse transcription buffer; RT mix, 2× RT buffer, 5 μM random hexamers, 5 μM oligo-dT, and 1 mM dNTP.

    Techniques Used: Lysis, Polymerase Chain Reaction

    2) Product Images from "Expression of CD44 3?-untranslated region regulates endogenous microRNA functions in tumorigenesis and angiogenesis"

    Article Title: Expression of CD44 3?-untranslated region regulates endogenous microRNA functions in tumorigenesis and angiogenesis

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkq1003

    The CD44 3′-UTR decreases cell proliferation and tumor formation. ( a ) A fragment of CD44 3′-UTR (900 bp) was inserted into the pcDNA3.1 plasmid, downstream of the CMV promoter, NheI and ApaI sites, producing the CD44-UTR construct. Total RNA from CD44 3′-UTR and control cells were subjected to RT–PCR, and analyzed by agarose gel electrophoresis. CD44 3′-UTR cells had an increased expression of CD44 3′-UTR compared to control cells. There was a 3-fold increase in CD44 3′-UTR levels in the CD44 3′-UTR cells compared with the control cells as analyzed by real-time PCR. ** P
    Figure Legend Snippet: The CD44 3′-UTR decreases cell proliferation and tumor formation. ( a ) A fragment of CD44 3′-UTR (900 bp) was inserted into the pcDNA3.1 plasmid, downstream of the CMV promoter, NheI and ApaI sites, producing the CD44-UTR construct. Total RNA from CD44 3′-UTR and control cells were subjected to RT–PCR, and analyzed by agarose gel electrophoresis. CD44 3′-UTR cells had an increased expression of CD44 3′-UTR compared to control cells. There was a 3-fold increase in CD44 3′-UTR levels in the CD44 3′-UTR cells compared with the control cells as analyzed by real-time PCR. ** P

    Techniques Used: Plasmid Preparation, Construct, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis, Expressing, Real-time Polymerase Chain Reaction

    siRNA against the CD44 3′-UTR enhances proliferation and decreases CD44 and CDC42 protein levels and apoptosis. ( a ) Total RNA was collected from CD44 3′-UTR cells transfected with different siRNAs targeting CD44 3′-UTR. These samples were used in RT–PCR to measure CD44 mRNA levels. All siRNAs were found to decrease the levels of CD44 mRNA. ( b ) CD44 3′-UTR and control cells were transfected with different siRNAs targeting the CD44 3′-UTR. Cell lysates were subjected to western-blot analysis. Both CD44 and CDC42 levels decreased as a result of siRNA targeting CD44 3′-UTR. ( c ) Cell-cycle distribution was analyzed. There was an increase in the S and G2 phases of the siRNA treated cells compared with the control, which had an increased G1 population. n = 3. ( d ) Apoptosis of the siRNA treatment was analyzed using Annexin V staining. Treatments with siRNA-187, siRNA-541 and siRNA-650 decreased apoptosis compared with the control. n = 5.
    Figure Legend Snippet: siRNA against the CD44 3′-UTR enhances proliferation and decreases CD44 and CDC42 protein levels and apoptosis. ( a ) Total RNA was collected from CD44 3′-UTR cells transfected with different siRNAs targeting CD44 3′-UTR. These samples were used in RT–PCR to measure CD44 mRNA levels. All siRNAs were found to decrease the levels of CD44 mRNA. ( b ) CD44 3′-UTR and control cells were transfected with different siRNAs targeting the CD44 3′-UTR. Cell lysates were subjected to western-blot analysis. Both CD44 and CDC42 levels decreased as a result of siRNA targeting CD44 3′-UTR. ( c ) Cell-cycle distribution was analyzed. There was an increase in the S and G2 phases of the siRNA treated cells compared with the control, which had an increased G1 population. n = 3. ( d ) Apoptosis of the siRNA treatment was analyzed using Annexin V staining. Treatments with siRNA-187, siRNA-541 and siRNA-650 decreased apoptosis compared with the control. n = 5.

    Techniques Used: Transfection, Reverse Transcription Polymerase Chain Reaction, Western Blot, Staining

    3) Product Images from "Analysis of the contribution of cellular and viral RNA to the packaging of APOBEC3G into HIV-1 virions"

    Article Title: Analysis of the contribution of cellular and viral RNA to the packaging of APOBEC3G into HIV-1 virions

    Journal: Retrovirology

    doi: 10.1186/1742-4690-4-48

    7SL RNA interaction is insufficient for incorporation of SRP54 protein into HIV-1 particles. (A) Cell lysates of untransfected HeLa cells were immunoprecipitated with an SRP54-specific antibody (IP) or were mock-precipitated (Ctrl). Aliquots of total cell lysate (Total) and immunoprecipitates were subjected to immunoblot analysis using antibodies to SRP54 (α-SRP54), α-tubulin (α-tubulin). RNA was extracted from remaining cell lysate and immunoprecipitates and used for RT-PCR amplification of 7SL RNA. (B) HeLa cells were transfected vif -defective variants of either pNL4-3 (43ΔVif), pC-Help (C-HelpΔVif, or mS.1 (mS.1ΔVif). Transfected cells and virus-containing supernatants were harvested 24 h after transfection. Virus-containing supernatants were purified and concentrated as described in Methods. Cell and viral lysates were analyzed by immunoblotting for virus production using an HIV-positive patient serum (APS). Expression and packaging of SRP54 was analyzed using an SRP54-specific antibody oα-SRP54). Total cellular RNA and RNA extracted from concentrated viruses was used for RT-PCR amplification of 7SL RNA.
    Figure Legend Snippet: 7SL RNA interaction is insufficient for incorporation of SRP54 protein into HIV-1 particles. (A) Cell lysates of untransfected HeLa cells were immunoprecipitated with an SRP54-specific antibody (IP) or were mock-precipitated (Ctrl). Aliquots of total cell lysate (Total) and immunoprecipitates were subjected to immunoblot analysis using antibodies to SRP54 (α-SRP54), α-tubulin (α-tubulin). RNA was extracted from remaining cell lysate and immunoprecipitates and used for RT-PCR amplification of 7SL RNA. (B) HeLa cells were transfected vif -defective variants of either pNL4-3 (43ΔVif), pC-Help (C-HelpΔVif, or mS.1 (mS.1ΔVif). Transfected cells and virus-containing supernatants were harvested 24 h after transfection. Virus-containing supernatants were purified and concentrated as described in Methods. Cell and viral lysates were analyzed by immunoblotting for virus production using an HIV-positive patient serum (APS). Expression and packaging of SRP54 was analyzed using an SRP54-specific antibody oα-SRP54). Total cellular RNA and RNA extracted from concentrated viruses was used for RT-PCR amplification of 7SL RNA.

    Techniques Used: Immunoprecipitation, Reverse Transcription Polymerase Chain Reaction, Amplification, Transfection, Mass Spectrometry, Purification, Expressing

    Intracellular association of APO3G and host RNAs. (A) Expression and immunoprecipitation of APO3G. HeLa cells (5 × 10 6 ) were transfected with 5 μg of pcDNA-Apo3G-MycHis plasmid DNA. Cells were harvested 24 h post transfection. An aliquot of the transfected cells was used for the analysis of APO3G expression as follows: Cell lysates were immunoprecipitated with a polyclonal antibody to the myc epitope tag (α-myc) or were mock immunoprecipitated (mock). Immunoprecipitated samples and total cell lysate (Total) were analyzed for the presence of APO3G by immunoblotting using an APO3G-specific polyclonal peptide antibody. (B) The remaining cells from above were used for RT-PCR analysis as follows: Total cellular RNA (Total) or RNA present in the immune complexes (α-myc and mock, respectively) was extracted and used for RT-PCR analysis as described in Methods. Primer pairs were selected for the specific amplification of the RNAs as indicated on the left. Primer sequences are listed in table 1. All RT-PCR reactions were performed simultaneously to minimize experimental error. RT-PCR products were analyzed on 1% agarose gels and visualized by staining with ethidium bromide. (C) HeLa cells (5 × 10 6 ) were transfected with 5 μg of pcDNA-Apo3G-MycHis plasmid DNA (lanes 1 3) or 5 μg of pcDNA-Apo3G (lanes 2 4). Cells were harvested 24 h post transfection and analyzed as in panels A and B. (D) The specificity of the RT-PCR reaction was validated using 7SL RNA as a substrate. Total cellular RNA from panel B was either left untreated (-) or treated with RNase A (50 μg/ml) for 60 min at 37°C (+) prior to RT-PCR.
    Figure Legend Snippet: Intracellular association of APO3G and host RNAs. (A) Expression and immunoprecipitation of APO3G. HeLa cells (5 × 10 6 ) were transfected with 5 μg of pcDNA-Apo3G-MycHis plasmid DNA. Cells were harvested 24 h post transfection. An aliquot of the transfected cells was used for the analysis of APO3G expression as follows: Cell lysates were immunoprecipitated with a polyclonal antibody to the myc epitope tag (α-myc) or were mock immunoprecipitated (mock). Immunoprecipitated samples and total cell lysate (Total) were analyzed for the presence of APO3G by immunoblotting using an APO3G-specific polyclonal peptide antibody. (B) The remaining cells from above were used for RT-PCR analysis as follows: Total cellular RNA (Total) or RNA present in the immune complexes (α-myc and mock, respectively) was extracted and used for RT-PCR analysis as described in Methods. Primer pairs were selected for the specific amplification of the RNAs as indicated on the left. Primer sequences are listed in table 1. All RT-PCR reactions were performed simultaneously to minimize experimental error. RT-PCR products were analyzed on 1% agarose gels and visualized by staining with ethidium bromide. (C) HeLa cells (5 × 10 6 ) were transfected with 5 μg of pcDNA-Apo3G-MycHis plasmid DNA (lanes 1 3) or 5 μg of pcDNA-Apo3G (lanes 2 4). Cells were harvested 24 h post transfection and analyzed as in panels A and B. (D) The specificity of the RT-PCR reaction was validated using 7SL RNA as a substrate. Total cellular RNA from panel B was either left untreated (-) or treated with RNase A (50 μg/ml) for 60 min at 37°C (+) prior to RT-PCR.

    Techniques Used: Expressing, Immunoprecipitation, Transfection, Plasmid Preparation, Reverse Transcription Polymerase Chain Reaction, Amplification, Staining

    Correlation between cellular and viral RNA encapsidation and APO3G packaging. HeLa cells were co-transfected with pcDNA-APO3G-MycHis together with vif -defective variants of either pNL4-3 (43ΔVif), pC-Help (C-HelpΔVif), or mS.1 (mS.1ΔVif). Viruses were harvested 24 h after transfection and purified as described in Methods. (A) Virus production and packaging of APO3G was monitored by immunoblot analysis using an aliquot of the purified, concentrated virus preparations. APO3G encapsidation was identified using a polyclonal APO3G-specific peptide antibody. Viral capsid proteins (CA) were identified using an HIV-positive human patient serum (APS). (B) APO3G-specific bands in panel A were quantified by densitometric scanning and corrected for fluctuations in capsid levels. Results were calculated relative to APO3G associated with NL4-3ΔVif particles, which was defined as 100%. (C) RNAs were extracted from purified, concentrated viruses and amplified by RT-PCR using primer pairs specific for HIV-1 RNA or host RNAs as indicated on the left and detailed in table 1. RT-PCR products were separated on 1% agarose gels and visualized by staining with ethidium bromide.
    Figure Legend Snippet: Correlation between cellular and viral RNA encapsidation and APO3G packaging. HeLa cells were co-transfected with pcDNA-APO3G-MycHis together with vif -defective variants of either pNL4-3 (43ΔVif), pC-Help (C-HelpΔVif), or mS.1 (mS.1ΔVif). Viruses were harvested 24 h after transfection and purified as described in Methods. (A) Virus production and packaging of APO3G was monitored by immunoblot analysis using an aliquot of the purified, concentrated virus preparations. APO3G encapsidation was identified using a polyclonal APO3G-specific peptide antibody. Viral capsid proteins (CA) were identified using an HIV-positive human patient serum (APS). (B) APO3G-specific bands in panel A were quantified by densitometric scanning and corrected for fluctuations in capsid levels. Results were calculated relative to APO3G associated with NL4-3ΔVif particles, which was defined as 100%. (C) RNAs were extracted from purified, concentrated viruses and amplified by RT-PCR using primer pairs specific for HIV-1 RNA or host RNAs as indicated on the left and detailed in table 1. RT-PCR products were separated on 1% agarose gels and visualized by staining with ethidium bromide.

    Techniques Used: Transfection, Mass Spectrometry, Purification, Amplification, Reverse Transcription Polymerase Chain Reaction, Staining

    Packaging of hY RNAs requires the NC zinc finger domains. HeLa cells were co-transfected with pcDNA-APO3G-MycHis together with pNL4-3ΔVif (43ΔVif) or pDB653ΔVif. Viruses were harvested 24 h after transfection and purified as described in Methods. (A) Virus production and packaging of APO3G was monitored by immunoblot analysis using an aliquot of the purified, concentrated virus preparations. APO3G encapsidation was identified using a polyclonal APO3G-specific peptide antibody. Viral capsid proteins (CA) were identified using an HIV-positive human patient serum (APS). (B) RNAs were extracted from purified, concentrated viruses and amplified by RT-PCR using primer pairs specific for HIV-1 RNA or host RNAs as indicated on the left and detailed in table 1. RNA extracted from C-HelpΔVif preparations in figure 3 was included as control. RT-PCR products were separated on 1% agarose gels and visualized by staining with ethidium bromide.
    Figure Legend Snippet: Packaging of hY RNAs requires the NC zinc finger domains. HeLa cells were co-transfected with pcDNA-APO3G-MycHis together with pNL4-3ΔVif (43ΔVif) or pDB653ΔVif. Viruses were harvested 24 h after transfection and purified as described in Methods. (A) Virus production and packaging of APO3G was monitored by immunoblot analysis using an aliquot of the purified, concentrated virus preparations. APO3G encapsidation was identified using a polyclonal APO3G-specific peptide antibody. Viral capsid proteins (CA) were identified using an HIV-positive human patient serum (APS). (B) RNAs were extracted from purified, concentrated viruses and amplified by RT-PCR using primer pairs specific for HIV-1 RNA or host RNAs as indicated on the left and detailed in table 1. RNA extracted from C-HelpΔVif preparations in figure 3 was included as control. RT-PCR products were separated on 1% agarose gels and visualized by staining with ethidium bromide.

    Techniques Used: Transfection, Purification, Amplification, Reverse Transcription Polymerase Chain Reaction, Staining

    4) Product Images from "The plasmid-encoded Ipf and Klf fimbriae display different expression and varying roles in the virulence of Salmonella enterica serovar Infantis in mouse vs. avian hosts"

    Article Title: The plasmid-encoded Ipf and Klf fimbriae display different expression and varying roles in the virulence of Salmonella enterica serovar Infantis in mouse vs. avian hosts

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1006559

    OmpR, Lrp and Fur are involved in pESI fimbriae regulation. (A) Total RNA was extracted from S . Infantis wild-type (wt) strain and ten isogenic null mutants harboring deletion in key regulatory genes. qRT-PCR was applied to define the fold change in klfD transcription between the wild-type background and the mutant strains. All cultures were grown in LB under microaerobic conditions at 37°C. (B) S . Infantis wild-type and ten derivative deletion mutant strains expressing KlfC-2HA were grown in LB under microaerobic conditions at 37°C. Bacterial lysates were separated by SDS-PAGE followed by western blotting using antibodies against hemagglutinin and DnaK as a loading control. (C) The same strains were grown in LB under microaerobic conditions at 41°C. Bacterial lysates were analyzed by western blotting using antibodies against hemagglutinin and RpoD. ( D ) S . Infantis wild-type strain (wt), its isogenic lrp null strain ( lrp ), an lrp mutant strain complemented with the lrp gene expressed from pWSK29 ( lrp / pWSK29:: lrp ), an lrp mutant harboring the empty vector ( lrp / pWSK29), all expressing KlfC-2HA from a low copy-number vector (pACYC184) were grown in LB broth under microaerobic conditions at 41°C. Wild-type strain harboring the empty plasmid pACYC184 (vector) was also included as a negative control. Bacterial lysates were separated by SDS-PAGE followed by western blotting using antibodies against hemagglutinin and RpoD. KlfC-2HA bands densitometry (normalized to the corresponding DnaK bands) are presented relative to the wt, under the DnaK blot. ( E ) qRT-PCR was applied to determine the fold change in ipfD transcription between the wild-type background and the mutant strains as in panel (A). ( F ) S . Infantis wild-type and ten isogenic mutant strains expressing IpfD-2HA were grown in LB under microaerobic conditions at 37°C. S . Infantis wild-type strain harboring the pWSK29 (vector) was used as a control for the western blotting. Bacterial lysates were separated by SDS-PAGE followed by western blotting as in panel (B). ( G ) The same strains were grown in LB under microaerobic conditions at 41°C. Bacterial lysates were analyzed by western blotting using antibodies against hemagglutinin and RpoD. ( H ) S . Infantis wild-type strain (wt), its isogenic fur mutant strain ( fur ), a fur mutant strain complemented with the fur gene expressed from pACYC184 ( fur / pACYC184:: fur ), and a fur mutant harboring the empty vector ( fur / pACYC184), all expressing IpfD-2HA from a low copy-number vector (pWSK29) were grown in LB broth under microaerobic conditions at 37°C. Bacterial lysates were separated by SDS-PAGE followed by western blotting using antibodies against hemagglutinin and RpoD. IpfD-2HA bands densitometry (normalized to the corresponding RpoD bands) are presented relative to the wt below the RpoD blot. ( I ) S . Infantis wild-type (wt) strain and its isogenic fur null mutant were grown at 37°C to the stationary phase under microaerobic conditions in LB or in LB supplemented with Dip (to a final concentration of 0.2 mM). qRT-PCR was applied to determine the fold change in ipfA transcription of the different cultures, relative to the wt strain grown in LB.
    Figure Legend Snippet: OmpR, Lrp and Fur are involved in pESI fimbriae regulation. (A) Total RNA was extracted from S . Infantis wild-type (wt) strain and ten isogenic null mutants harboring deletion in key regulatory genes. qRT-PCR was applied to define the fold change in klfD transcription between the wild-type background and the mutant strains. All cultures were grown in LB under microaerobic conditions at 37°C. (B) S . Infantis wild-type and ten derivative deletion mutant strains expressing KlfC-2HA were grown in LB under microaerobic conditions at 37°C. Bacterial lysates were separated by SDS-PAGE followed by western blotting using antibodies against hemagglutinin and DnaK as a loading control. (C) The same strains were grown in LB under microaerobic conditions at 41°C. Bacterial lysates were analyzed by western blotting using antibodies against hemagglutinin and RpoD. ( D ) S . Infantis wild-type strain (wt), its isogenic lrp null strain ( lrp ), an lrp mutant strain complemented with the lrp gene expressed from pWSK29 ( lrp / pWSK29:: lrp ), an lrp mutant harboring the empty vector ( lrp / pWSK29), all expressing KlfC-2HA from a low copy-number vector (pACYC184) were grown in LB broth under microaerobic conditions at 41°C. Wild-type strain harboring the empty plasmid pACYC184 (vector) was also included as a negative control. Bacterial lysates were separated by SDS-PAGE followed by western blotting using antibodies against hemagglutinin and RpoD. KlfC-2HA bands densitometry (normalized to the corresponding DnaK bands) are presented relative to the wt, under the DnaK blot. ( E ) qRT-PCR was applied to determine the fold change in ipfD transcription between the wild-type background and the mutant strains as in panel (A). ( F ) S . Infantis wild-type and ten isogenic mutant strains expressing IpfD-2HA were grown in LB under microaerobic conditions at 37°C. S . Infantis wild-type strain harboring the pWSK29 (vector) was used as a control for the western blotting. Bacterial lysates were separated by SDS-PAGE followed by western blotting as in panel (B). ( G ) The same strains were grown in LB under microaerobic conditions at 41°C. Bacterial lysates were analyzed by western blotting using antibodies against hemagglutinin and RpoD. ( H ) S . Infantis wild-type strain (wt), its isogenic fur mutant strain ( fur ), a fur mutant strain complemented with the fur gene expressed from pACYC184 ( fur / pACYC184:: fur ), and a fur mutant harboring the empty vector ( fur / pACYC184), all expressing IpfD-2HA from a low copy-number vector (pWSK29) were grown in LB broth under microaerobic conditions at 37°C. Bacterial lysates were separated by SDS-PAGE followed by western blotting using antibodies against hemagglutinin and RpoD. IpfD-2HA bands densitometry (normalized to the corresponding RpoD bands) are presented relative to the wt below the RpoD blot. ( I ) S . Infantis wild-type (wt) strain and its isogenic fur null mutant were grown at 37°C to the stationary phase under microaerobic conditions in LB or in LB supplemented with Dip (to a final concentration of 0.2 mM). qRT-PCR was applied to determine the fold change in ipfA transcription of the different cultures, relative to the wt strain grown in LB.

    Techniques Used: Quantitative RT-PCR, Mutagenesis, Expressing, SDS Page, Western Blot, Plasmid Preparation, Low Copy Number, Negative Control, Concentration Assay

    KlfB and KlfL are positive and negative regulators, respectively of the klf operon. (A) RNA was extracted from S . Infantis wild-type (wt) strain and three isogenic mutants containing null mutations in klfA , klfB and klfL grown in LB under microaerobic conditions at 37°C. qRT-PCR was conducted to define the fold change in klfD transcription between the wild-type background and the mutant strains. ( B ) S . Infantis wild-type and the klfA , klfB and klfL mutant strains expressing KlfC-2HA were grown to the stationary phase in LB under microaerobic conditions at 37°C. Wild-type strain harboring the empty plasmid pACYC184 (vector) was included as a negative control. Bacterial lysates were separated by SDS-PAGE followed by western blotting using antibodies against hemagglutinin and DnaK. KlfC-2HA bands densitometry (normalized to the corresponding DnaK bands) are presented relative to the wt, below the DnaK blot. ( C ) S . Infantis wild-type and the klfB mutant strain expressing KlfC-2HA were grown to the stationary phase in LB under microaerobic conditions at 41°C. Expression of KlfC-2HA was determined as in (B).
    Figure Legend Snippet: KlfB and KlfL are positive and negative regulators, respectively of the klf operon. (A) RNA was extracted from S . Infantis wild-type (wt) strain and three isogenic mutants containing null mutations in klfA , klfB and klfL grown in LB under microaerobic conditions at 37°C. qRT-PCR was conducted to define the fold change in klfD transcription between the wild-type background and the mutant strains. ( B ) S . Infantis wild-type and the klfA , klfB and klfL mutant strains expressing KlfC-2HA were grown to the stationary phase in LB under microaerobic conditions at 37°C. Wild-type strain harboring the empty plasmid pACYC184 (vector) was included as a negative control. Bacterial lysates were separated by SDS-PAGE followed by western blotting using antibodies against hemagglutinin and DnaK. KlfC-2HA bands densitometry (normalized to the corresponding DnaK bands) are presented relative to the wt, below the DnaK blot. ( C ) S . Infantis wild-type and the klfB mutant strain expressing KlfC-2HA were grown to the stationary phase in LB under microaerobic conditions at 41°C. Expression of KlfC-2HA was determined as in (B).

    Techniques Used: Quantitative RT-PCR, Mutagenesis, Expressing, Plasmid Preparation, Negative Control, SDS Page, Western Blot

    klf and ipf genes are induced under microaerobiosis. ( A ) RNA was extracted from S . Infantis wild-type strain grown to the stationary phase under microaerobic conditions in LB, N-minimal medium pH 7 and N-minimal medium pH 5.8. Quantitative RT-PCR analyses were conducted to determine the fold change in the transcription of ipfC and klfD in cultures grown in LB or N-minimal medium pH 5.8 relative to their transcription in N-minimal medium pH 7.0. ( B ) qRT-PCR analyses were performed to determine the fold change in the transcription of ipfA , ipfB , ipfC and ipfD in cultures grown in LB to the stationary phase under microaerobic conditions or under aerobic conditions, relative to their transcription at the late logarithmic phase under aerobic conditions. ( C ) qRT-PCR analyses were performed to determine the fold change in the transcription of klfC , klfD , klfE and klfG in cultures grown in LB to stationary phase under microaerobic or aerobic conditions, relative to their transcription at the late logarithmic phase under aerobic conditions. One way ANOVA with Dunnett's Multiple Comparison Test were performed to determine statistical significance. ns, not significant; *, P
    Figure Legend Snippet: klf and ipf genes are induced under microaerobiosis. ( A ) RNA was extracted from S . Infantis wild-type strain grown to the stationary phase under microaerobic conditions in LB, N-minimal medium pH 7 and N-minimal medium pH 5.8. Quantitative RT-PCR analyses were conducted to determine the fold change in the transcription of ipfC and klfD in cultures grown in LB or N-minimal medium pH 5.8 relative to their transcription in N-minimal medium pH 7.0. ( B ) qRT-PCR analyses were performed to determine the fold change in the transcription of ipfA , ipfB , ipfC and ipfD in cultures grown in LB to the stationary phase under microaerobic conditions or under aerobic conditions, relative to their transcription at the late logarithmic phase under aerobic conditions. ( C ) qRT-PCR analyses were performed to determine the fold change in the transcription of klfC , klfD , klfE and klfG in cultures grown in LB to stationary phase under microaerobic or aerobic conditions, relative to their transcription at the late logarithmic phase under aerobic conditions. One way ANOVA with Dunnett's Multiple Comparison Test were performed to determine statistical significance. ns, not significant; *, P

    Techniques Used: Quantitative RT-PCR

    5) Product Images from "Comparison of Matrix-Based and Filter Paper-Based Systems for Transport of Plasma for HIV-1 RNA Quantification and Amplicon Preparation for Genotyping"

    Article Title: Comparison of Matrix-Based and Filter Paper-Based Systems for Transport of Plasma for HIV-1 RNA Quantification and Amplicon Preparation for Genotyping

    Journal:

    doi: 10.1128/JCM.00541-16

    Comparison of HIV-1 RNA quantification and drug resistance genotyping following preservation of plasma samples in ViveST tubes (extracted by QIAamp or MiniMag) versus on RNA Sound cards (extracted by QIAamp) versus frozen (extracted by QIAamp). Aliquots
    Figure Legend Snippet: Comparison of HIV-1 RNA quantification and drug resistance genotyping following preservation of plasma samples in ViveST tubes (extracted by QIAamp or MiniMag) versus on RNA Sound cards (extracted by QIAamp) versus frozen (extracted by QIAamp). Aliquots

    Techniques Used: Preserving

    6) Product Images from "Non‐invasive lung cancer diagnosis by detection of GATA6 and NKX2‐1 isoforms in exhaled breath condensate"

    Article Title: Non‐invasive lung cancer diagnosis by detection of GATA6 and NKX2‐1 isoforms in exhaled breath condensate

    Journal: EMBO Molecular Medicine

    doi: 10.15252/emmm.201606382

    Optimization of EBC ‐based expression analysis for LC diagnosis RTube is suitable for RNA isolation. Two main EBC collection devices, RTube and TurboDECCS, were compared for the total RNA yield ( y ‐axis, ng) obtained using the QIAGEN RNeasy Micro kit and 500 μl EBC as starting material. Triangles and rhombuses are used to denote RNA yield of each individual sample using EBCs collected from the different EBC collection devices. Data are represented as mean ± s.e.m.; n = 6. P ‐values after one‐way ANOVA. 500 μl of EBC is optimal for RNA isolation. Total RNA isolation with the RNeasy Micro kit was performed using 200, 350, 500, or 1,000 μl EBC as starting material. Data are represented as mean ± s.e.m.; n = 4. The High Capacity cDNA Reverse Transcriptase kit is more efficient than EpiScript Reverse Transcriptase. Two RT kits were tested for qRT–PCR‐based analysis of GATA6 Ad. CT values were plotted. Each dot represents the CT value for a technical triplicate. Data are represented as mean ± s.e.m.; n = 3. Serial dilution of cDNA template to determine the linear range of detection of GATA6 Ad. cDNA from control EBC was serially diluted and used as template for qRT–PCR‐based expression analysis of GATA6 Ad. Each dot represents the CT value for a technical triplicate. Data are represented as mean ± s.e.m.; n = 3. Delayed snap‐freezing of EBC after collection compromises mRNA integrity. Top, schematic representation of the precursor mRNAs from GAPDH (E) and HPRT1 (F) showing exons (boxes), introns (lines), and location of primer pairs (arrowheads) used for qRT–PCR‐based expression analysis. Bottom, EBCs were collected and incubated on ice for 0, 5, and 15 min prior to snap‐freezing in liquid nitrogen. Expression of GAPDH and HPRT1 was determined in the EBCs using the indicated primers, and the expression ratios (5′/3′) of each gene were calculated as indicators of mRNA integrity. RNA purified from EBCs with expression ratios of GAPDH and HPRT1 between 0.75 and 1.5 (dashed lines) was considered as acceptable for further analysis. Data are represented as mean ± s.e.m.; n = 3. Each colored triangle represents one individual. EBCs should be thawed on ice, for a maximum of 15 min, before further processing. EBCs, that were stored at −80°C, were thawed on ice (green line) or 25°C (red dashed line) for 15, 30, and 60 min. GAPDH 5′/3′ expression ratios were determined as in (E) as indicators of mRNA integrity. Each triangle refers to the 5′/3′ expression ratio for GAPDH of one sample. Each sample was measured in triplicates and the mean was used for the calculation of the ratio. Long‐term storage at −80°C or transportation on dry ice did not compromise mRNA integrity. EBCs were collected either in Germany (GER, green line) or in Mexico (MEX, red dashed line) and subsequently transported to Germany on dry ice. EBCs were stored at −80°C for 7, 30, or 365 days before they were thawed on ice and further processed in less than 15 min. GAPDH 5′/3′ expression ratios were determined as in (E) as indicators of mRNA integrity.
    Figure Legend Snippet: Optimization of EBC ‐based expression analysis for LC diagnosis RTube is suitable for RNA isolation. Two main EBC collection devices, RTube and TurboDECCS, were compared for the total RNA yield ( y ‐axis, ng) obtained using the QIAGEN RNeasy Micro kit and 500 μl EBC as starting material. Triangles and rhombuses are used to denote RNA yield of each individual sample using EBCs collected from the different EBC collection devices. Data are represented as mean ± s.e.m.; n = 6. P ‐values after one‐way ANOVA. 500 μl of EBC is optimal for RNA isolation. Total RNA isolation with the RNeasy Micro kit was performed using 200, 350, 500, or 1,000 μl EBC as starting material. Data are represented as mean ± s.e.m.; n = 4. The High Capacity cDNA Reverse Transcriptase kit is more efficient than EpiScript Reverse Transcriptase. Two RT kits were tested for qRT–PCR‐based analysis of GATA6 Ad. CT values were plotted. Each dot represents the CT value for a technical triplicate. Data are represented as mean ± s.e.m.; n = 3. Serial dilution of cDNA template to determine the linear range of detection of GATA6 Ad. cDNA from control EBC was serially diluted and used as template for qRT–PCR‐based expression analysis of GATA6 Ad. Each dot represents the CT value for a technical triplicate. Data are represented as mean ± s.e.m.; n = 3. Delayed snap‐freezing of EBC after collection compromises mRNA integrity. Top, schematic representation of the precursor mRNAs from GAPDH (E) and HPRT1 (F) showing exons (boxes), introns (lines), and location of primer pairs (arrowheads) used for qRT–PCR‐based expression analysis. Bottom, EBCs were collected and incubated on ice for 0, 5, and 15 min prior to snap‐freezing in liquid nitrogen. Expression of GAPDH and HPRT1 was determined in the EBCs using the indicated primers, and the expression ratios (5′/3′) of each gene were calculated as indicators of mRNA integrity. RNA purified from EBCs with expression ratios of GAPDH and HPRT1 between 0.75 and 1.5 (dashed lines) was considered as acceptable for further analysis. Data are represented as mean ± s.e.m.; n = 3. Each colored triangle represents one individual. EBCs should be thawed on ice, for a maximum of 15 min, before further processing. EBCs, that were stored at −80°C, were thawed on ice (green line) or 25°C (red dashed line) for 15, 30, and 60 min. GAPDH 5′/3′ expression ratios were determined as in (E) as indicators of mRNA integrity. Each triangle refers to the 5′/3′ expression ratio for GAPDH of one sample. Each sample was measured in triplicates and the mean was used for the calculation of the ratio. Long‐term storage at −80°C or transportation on dry ice did not compromise mRNA integrity. EBCs were collected either in Germany (GER, green line) or in Mexico (MEX, red dashed line) and subsequently transported to Germany on dry ice. EBCs were stored at −80°C for 7, 30, or 365 days before they were thawed on ice and further processed in less than 15 min. GAPDH 5′/3′ expression ratios were determined as in (E) as indicators of mRNA integrity.

    Techniques Used: Expressing, Liquid Chromatography, Isolation, Quantitative RT-PCR, Serial Dilution, Incubation, Purification

    7) Product Images from "Massively parallel functional annotation of 3' untranslated regions"

    Article Title: Massively parallel functional annotation of 3' untranslated regions

    Journal: Nature biotechnology

    doi: 10.1038/nbt.2851

    Functional elements identified using fast-UTR (a) Examples of known and novel elements. ΔStability values represent median differences in the fraction of mRNA remaining after 4 h of doxycycline treatment between mutant and wild type clones for 8-mer sliding windows. Black bars below the graphs show positions of known motifs or novel elements identified by fast-UTR. AREs, constitutive decay element (CDEs), and the sterile alpha motif domain containing 4A (SAMD4A) motif are associated with destabilizing RNA binding proteins and CU-rich elements (CUREs) are associated with stabilizing RNA binding proteins. Novel elements did not contain known RNA binding protein motifs or predicted miRNA targets. P values were calculated by comparing clones with mutations in motifs to clones without motif mutations using the Wilcoxon rank sum test. Horizontal axis values represent nucleotide positions within each 160 nt segment. Each active element shown here and all other elements identified by fast-UTR are listed in Supplementary Data 6 , which includes the numbers of mutant and wild type clones used to produce statistics for each active element. (b) Two predicted targets for the miR-17 family have identical seed sequences and similar TargetScan context+ scores (97 for SLC22A23 , 95 for HLF ) but only one has detectable activity by fast-UTR. Statistics for the inactive predicted miR-17 family target site in HLF were computed using data from 48 clones with mutations and 432 wild type clones. (c) Systematic analysis of mutations within known RNA binding protein recognition motifs. Boxplots represent 77 AREs, 13 CDEs, 72 canonical human Pumilio motifs (hPUM), 120 UGUACAG motifs (identical to a previously identified Drosophila Pumilio motif), 20 CUREs and 67 conserved short hairpin structures identified by EvoFold (Cons. hairpin). Mutations in each type of motif had significant effects on mRNA stability ( p
    Figure Legend Snippet: Functional elements identified using fast-UTR (a) Examples of known and novel elements. ΔStability values represent median differences in the fraction of mRNA remaining after 4 h of doxycycline treatment between mutant and wild type clones for 8-mer sliding windows. Black bars below the graphs show positions of known motifs or novel elements identified by fast-UTR. AREs, constitutive decay element (CDEs), and the sterile alpha motif domain containing 4A (SAMD4A) motif are associated with destabilizing RNA binding proteins and CU-rich elements (CUREs) are associated with stabilizing RNA binding proteins. Novel elements did not contain known RNA binding protein motifs or predicted miRNA targets. P values were calculated by comparing clones with mutations in motifs to clones without motif mutations using the Wilcoxon rank sum test. Horizontal axis values represent nucleotide positions within each 160 nt segment. Each active element shown here and all other elements identified by fast-UTR are listed in Supplementary Data 6 , which includes the numbers of mutant and wild type clones used to produce statistics for each active element. (b) Two predicted targets for the miR-17 family have identical seed sequences and similar TargetScan context+ scores (97 for SLC22A23 , 95 for HLF ) but only one has detectable activity by fast-UTR. Statistics for the inactive predicted miR-17 family target site in HLF were computed using data from 48 clones with mutations and 432 wild type clones. (c) Systematic analysis of mutations within known RNA binding protein recognition motifs. Boxplots represent 77 AREs, 13 CDEs, 72 canonical human Pumilio motifs (hPUM), 120 UGUACAG motifs (identical to a previously identified Drosophila Pumilio motif), 20 CUREs and 67 conserved short hairpin structures identified by EvoFold (Cons. hairpin). Mutations in each type of motif had significant effects on mRNA stability ( p

    Techniques Used: Functional Assay, Mutagenesis, Clone Assay, RNA Binding Assay, Activity Assay

    8) Product Images from "Activation of HIV Transcription with Short-Course Vorinostat in HIV-Infected Patients on Suppressive Antiretroviral Therapy"

    Article Title: Activation of HIV Transcription with Short-Course Vorinostat in HIV-Infected Patients on Suppressive Antiretroviral Therapy

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1004473

    Changes in virological and immunological parameters from one patient with viral rebound on study. Changes in (A) CA-US HIV RNA (red), (B) plasma HIV RNA (green) and (C) CA-HIV DNA (blue) are shown as the mean± SD for replicates of CA-US HIV RNA and HIV DNA. Programmed death-1 (PD1) expression on CD4+ and CD8+ CD45RA- T-cells is shown. Grey shaded box represents the time on vorinostat. (D) Dot plot analysis of flow cytometry for co-expression of PD-1 and CD45RA on CD4+ (top panel) and CD8+ (lower panel) T-cells at baseline, after 7 days of vorinostat and at day 84 of follow up.
    Figure Legend Snippet: Changes in virological and immunological parameters from one patient with viral rebound on study. Changes in (A) CA-US HIV RNA (red), (B) plasma HIV RNA (green) and (C) CA-HIV DNA (blue) are shown as the mean± SD for replicates of CA-US HIV RNA and HIV DNA. Programmed death-1 (PD1) expression on CD4+ and CD8+ CD45RA- T-cells is shown. Grey shaded box represents the time on vorinostat. (D) Dot plot analysis of flow cytometry for co-expression of PD-1 and CD45RA on CD4+ (top panel) and CD8+ (lower panel) T-cells at baseline, after 7 days of vorinostat and at day 84 of follow up.

    Techniques Used: Expressing, Flow Cytometry, Cytometry

    Effects of vorinostat on CA-US HIV RNA, HIV DNA and HIV RNA in blood and tissue. Changes in (A) CA-US HIV RNA (red), (B) plasma HIV RNA (green) and (C) HIV DNA (blue) is shown for each study participant (solid circle) and the median (IQR) at each time point in CD4+ T-cells from blood (left panel) and rectal tissue (right panel). Open circles represent data when at least one of the replicates were below the lower limit of detection (LLOD). The mean fold change in each parameter is also shown using a generalised estimating equation analysis (middle panel; boxes represent the median, 50 th and 75 th percentiles and whiskers represent the range). Grey shaded box represents the time on vorinostat. *p
    Figure Legend Snippet: Effects of vorinostat on CA-US HIV RNA, HIV DNA and HIV RNA in blood and tissue. Changes in (A) CA-US HIV RNA (red), (B) plasma HIV RNA (green) and (C) HIV DNA (blue) is shown for each study participant (solid circle) and the median (IQR) at each time point in CD4+ T-cells from blood (left panel) and rectal tissue (right panel). Open circles represent data when at least one of the replicates were below the lower limit of detection (LLOD). The mean fold change in each parameter is also shown using a generalised estimating equation analysis (middle panel; boxes represent the median, 50 th and 75 th percentiles and whiskers represent the range). Grey shaded box represents the time on vorinostat. *p

    Techniques Used:

    9) Product Images from "Efficient genome editing in hematopoietic stem cells with helper-dependent Ad5/35 vectors expressing site-specific endonucleases under microRNA regulation"

    Article Title: Efficient genome editing in hematopoietic stem cells with helper-dependent Ad5/35 vectors expressing site-specific endonucleases under microRNA regulation

    Journal: Molecular Therapy. Methods & Clinical Development

    doi: 10.1038/mtm.2014.57

    miRNA expression profiling in 293-Cre versus CD34+ cells. ( a ) MicroRNA log2 intensity scatterplots of CD34+ cells (Y-axis) and 293-Cre cells (X-axis). miRNAs that fulfill our selection criteria (high expression level in 293-Cre cells and absent/low expression in CD34+ cells are labeled in red. 293-Cre and CD34+ cells (pooled from four different donors) were infected with Ad vectors as described in the text. Twenty-four hours after infection, total RNA was isolated and hybridized to an array chip containing > 2,000 miRNA probes. ( b ) Confirmation of array results by real-time PCR analysis for selected miRNA using the same RNA samples used for the array study. The C t value was presented as average and SD from quadruplicate experiments. hsa-miR-130a-3p was selected as a positive control because, based on miRNA array and qRT-PCR assays, it was expressed at high levels in all 293 and CD34+ cell samples. The C t value correlates inversely with the RNA concentration. n.d., not detectable.
    Figure Legend Snippet: miRNA expression profiling in 293-Cre versus CD34+ cells. ( a ) MicroRNA log2 intensity scatterplots of CD34+ cells (Y-axis) and 293-Cre cells (X-axis). miRNAs that fulfill our selection criteria (high expression level in 293-Cre cells and absent/low expression in CD34+ cells are labeled in red. 293-Cre and CD34+ cells (pooled from four different donors) were infected with Ad vectors as described in the text. Twenty-four hours after infection, total RNA was isolated and hybridized to an array chip containing > 2,000 miRNA probes. ( b ) Confirmation of array results by real-time PCR analysis for selected miRNA using the same RNA samples used for the array study. The C t value was presented as average and SD from quadruplicate experiments. hsa-miR-130a-3p was selected as a positive control because, based on miRNA array and qRT-PCR assays, it was expressed at high levels in all 293 and CD34+ cell samples. The C t value correlates inversely with the RNA concentration. n.d., not detectable.

    Techniques Used: Expressing, Selection, Labeling, Infection, Isolation, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Positive Control, Quantitative RT-PCR, Concentration Assay

    10) Product Images from "Single-Tube Reaction Using Perfluorocarbons: A Prerequisite Step Leading to the Whole-Slide In Situ Technique on Histopathological Slides"

    Article Title: Single-Tube Reaction Using Perfluorocarbons: A Prerequisite Step Leading to the Whole-Slide In Situ Technique on Histopathological Slides

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0158018

    RNA isolation/purification from frozen mouse liver tissue, ITRI (I, duplicate), and Qiagen (Q) samples analyzed by Agilent 2100 ® gel electrophoresis. Compared with the conventional methods, using single-tube reaction greatly simplified the procedures (see above). Analysis by Agilent 2100 ® bioanalyzer revealed that the sample qualities were comparable. This demonstrates that by using single-tube reaction the experiment time can be greatly reduced while the nucleic acid quality is maintained.
    Figure Legend Snippet: RNA isolation/purification from frozen mouse liver tissue, ITRI (I, duplicate), and Qiagen (Q) samples analyzed by Agilent 2100 ® gel electrophoresis. Compared with the conventional methods, using single-tube reaction greatly simplified the procedures (see above). Analysis by Agilent 2100 ® bioanalyzer revealed that the sample qualities were comparable. This demonstrates that by using single-tube reaction the experiment time can be greatly reduced while the nucleic acid quality is maintained.

    Techniques Used: Isolation, Purification, Nucleic Acid Electrophoresis

    11) Product Images from "Apoptotic tumor cell-derived microRNA-375 uses CD36 to alter the tumor-associated macrophage phenotype"

    Article Title: Apoptotic tumor cell-derived microRNA-375 uses CD36 to alter the tumor-associated macrophage phenotype

    Journal: Nature Communications

    doi: 10.1038/s41467-019-08989-2

    MCF-7 cell-derived miR-375 is taken up by MΦ via CD36. a MCF-7 cell ACM was prepared with (+ FCS) or without (− FCS) FCS, and miR-375 and miR-183-5p abundance was measured by qPCR. Synthetic cel-miR-39a was used as spike-in control for RNA purification efficiency and normalization control ( n = 4). b LDL and HDL fractions were separated from ACM (with or without FCS in the media) and analyzed for the abundance of miR-375 and miR-183-5p by qPCR ( n = 3). c , d MΦ were pre-incubated with IgG control or anti-CD36 blocking mAb for 1 h and during the whole experiment. c MΦ were treated with ACM for 30 min. Cells were washed and further cultured in MΦ media for 24 h. MiR-375 abundance was measured by qPCR and normalized to untreated control MΦ ( n = 7). d MΦ were cocultured with MCF-7 cells for 24 h and miR-375 abundance was measured via qPCR, and normalized to untreated control MΦ ( n = 4). e MΦ were treated with MCF-7 ACM alone or together with a CD36-blocking peptide for 30 min. The peptide was added 1 h before ACM treatment. Afterwards, cells were washed and further cultured in MΦ media alone or together with the peptide for 24 h. miR-375 level was measured by qPCR and normalized to untreated control MΦ ( n = 8). f , g MΦ were transfected with control (nonspecific siRNA) or CD36 siRNA for 24 h and cocultured with MCF-7 cells for another 24 h. f CD36 mRNA expression and g miR-375 levels were measured by qPCR ( n = 6). Data of a – g are mean ± SEM and p -values were calculated using two-tailed Student’s t -test ( a , b , f , g ) and one-sample t -test ( c – e ); * p
    Figure Legend Snippet: MCF-7 cell-derived miR-375 is taken up by MΦ via CD36. a MCF-7 cell ACM was prepared with (+ FCS) or without (− FCS) FCS, and miR-375 and miR-183-5p abundance was measured by qPCR. Synthetic cel-miR-39a was used as spike-in control for RNA purification efficiency and normalization control ( n = 4). b LDL and HDL fractions were separated from ACM (with or without FCS in the media) and analyzed for the abundance of miR-375 and miR-183-5p by qPCR ( n = 3). c , d MΦ were pre-incubated with IgG control or anti-CD36 blocking mAb for 1 h and during the whole experiment. c MΦ were treated with ACM for 30 min. Cells were washed and further cultured in MΦ media for 24 h. MiR-375 abundance was measured by qPCR and normalized to untreated control MΦ ( n = 7). d MΦ were cocultured with MCF-7 cells for 24 h and miR-375 abundance was measured via qPCR, and normalized to untreated control MΦ ( n = 4). e MΦ were treated with MCF-7 ACM alone or together with a CD36-blocking peptide for 30 min. The peptide was added 1 h before ACM treatment. Afterwards, cells were washed and further cultured in MΦ media alone or together with the peptide for 24 h. miR-375 level was measured by qPCR and normalized to untreated control MΦ ( n = 8). f , g MΦ were transfected with control (nonspecific siRNA) or CD36 siRNA for 24 h and cocultured with MCF-7 cells for another 24 h. f CD36 mRNA expression and g miR-375 levels were measured by qPCR ( n = 6). Data of a – g are mean ± SEM and p -values were calculated using two-tailed Student’s t -test ( a , b , f , g ) and one-sample t -test ( c – e ); * p

    Techniques Used: Derivative Assay, Real-time Polymerase Chain Reaction, Purification, Incubation, Blocking Assay, Cell Culture, Transfection, Expressing, Two Tailed Test

    12) Product Images from "N-Myc expression enhances the oncolytic effects of vesicular stomatitis virus in human neuroblastoma cells"

    Article Title: N-Myc expression enhances the oncolytic effects of vesicular stomatitis virus in human neuroblastoma cells

    Journal: Molecular Therapy Oncolytics

    doi: 10.1038/mto.2016.5

    Differential expression of DDIT-3. ( a ) TET21 cells were either treated or not with doxycycline for 48 hours and infected with VSVΔM51 at multiplicity of infection (MOI) of 0.5 for 12, 18, and 24 hours. Alternatively, cells were treated with 1 μg/ml tunicamycin (an ER poison) as controls for DDIT-3/CHOP expression. Expression of DDIT-3/CHOP was analyzed by western blot ( a ). NB cell lines were either infected at MOI of 0.1 or treated with tunicamycin for 15 hours. RNA was extracted and the expression of DDIT-3/CHOP was analyzed by RT-PCR ( b ). Dox (-), no doxycycline added. Dox (+), doxycycline added.
    Figure Legend Snippet: Differential expression of DDIT-3. ( a ) TET21 cells were either treated or not with doxycycline for 48 hours and infected with VSVΔM51 at multiplicity of infection (MOI) of 0.5 for 12, 18, and 24 hours. Alternatively, cells were treated with 1 μg/ml tunicamycin (an ER poison) as controls for DDIT-3/CHOP expression. Expression of DDIT-3/CHOP was analyzed by western blot ( a ). NB cell lines were either infected at MOI of 0.1 or treated with tunicamycin for 15 hours. RNA was extracted and the expression of DDIT-3/CHOP was analyzed by RT-PCR ( b ). Dox (-), no doxycycline added. Dox (+), doxycycline added.

    Techniques Used: Expressing, Infection, Western Blot, Reverse Transcription Polymerase Chain Reaction

    13) Product Images from "In vitro selection of RNA aptamers against a conserved region of the Plasmodium falciparum erythrocyte membrane protein 1"

    Article Title: In vitro selection of RNA aptamers against a conserved region of the Plasmodium falciparum erythrocyte membrane protein 1

    Journal: Parasitology Research

    doi: 10.1007/s00436-009-1583-x

    RNA association to the surface of FCR3S1.2 infected erythrocytes. RNA, 9.8 pmol (10 nM), from clone d12, e05, e02 and pool 0 was incubated with 1 ml blood culture of FCR3S1.2. Cell pellet was washed with PBS. Bound labelled RNA from resuspended cell pellet was measured with scintillator. Units on y axis = Bound RNA in mol. Error bars present SDs, ** P ≤ 0.001, from a two-tailed Student’s t test
    Figure Legend Snippet: RNA association to the surface of FCR3S1.2 infected erythrocytes. RNA, 9.8 pmol (10 nM), from clone d12, e05, e02 and pool 0 was incubated with 1 ml blood culture of FCR3S1.2. Cell pellet was washed with PBS. Bound labelled RNA from resuspended cell pellet was measured with scintillator. Units on y axis = Bound RNA in mol. Error bars present SDs, ** P ≤ 0.001, from a two-tailed Student’s t test

    Techniques Used: Infection, Incubation, Two Tailed Test

    14) Product Images from "Inhibition of HIV-1 Maturation via Small-Molecule Targeting of the Amino-Terminal Domain in the Viral Capsid Protein"

    Article Title: Inhibition of HIV-1 Maturation via Small-Molecule Targeting of the Amino-Terminal Domain in the Viral Capsid Protein

    Journal: Journal of Virology

    doi: 10.1128/JVI.02155-16

    C1 does not inhibit HIV-1 particle encapsidation of viral RNA. RNA was extracted from DNase-treated HIV-1 particles produced in the presence or absence of C1 (40 μM) and analyzed by quantitative RT-PCR using primers specific for HIV-1 sequences.
    Figure Legend Snippet: C1 does not inhibit HIV-1 particle encapsidation of viral RNA. RNA was extracted from DNase-treated HIV-1 particles produced in the presence or absence of C1 (40 μM) and analyzed by quantitative RT-PCR using primers specific for HIV-1 sequences.

    Techniques Used: Produced, Quantitative RT-PCR

    15) Product Images from "Double In situ Hybridization for MicroRNAs and mRNAs in Brain Tissues"

    Article Title: Double In situ Hybridization for MicroRNAs and mRNAs in Brain Tissues

    Journal: Frontiers in Molecular Neuroscience

    doi: 10.3389/fnmol.2016.00126

    miR-34a expression in parvalbumin-positive neurons in the TRN and cortical layer V . Double FISH was performed using miR-34a and parvalbumin (PV) probes. DIG-labeled LNA-modified probes for miR-34a and fluorescein-labeled RNA probes for PV were hybridized at 48°C. Detection was carried out using the TSA Plus fluorescent kit for PV (green), followed by the TSA Plus biotin kit and Texas red streptavidin for miR-34a (red). The insert images are a higher magnification of the boxed brain areas including the TRN. EP, entopeduncular nucleus; GP, globus pallidus. Scale bars, 1 mm.
    Figure Legend Snippet: miR-34a expression in parvalbumin-positive neurons in the TRN and cortical layer V . Double FISH was performed using miR-34a and parvalbumin (PV) probes. DIG-labeled LNA-modified probes for miR-34a and fluorescein-labeled RNA probes for PV were hybridized at 48°C. Detection was carried out using the TSA Plus fluorescent kit for PV (green), followed by the TSA Plus biotin kit and Texas red streptavidin for miR-34a (red). The insert images are a higher magnification of the boxed brain areas including the TRN. EP, entopeduncular nucleus; GP, globus pallidus. Scale bars, 1 mm.

    Techniques Used: Expressing, Fluorescence In Situ Hybridization, Labeling, Modification

    Comparisons of the signal intensities of miRNA ISH in fresh and fixed brain sections with or without proteinase K digestion . In situ detection of miR-34a (A) and miR-181a (B) was performed in adult mouse brain sections. The hybridization temperature was 37°C below the T m of each RNA. Detection was carried out using the NBT/BCIP colorimetric method. The sections were treated with or without proteinase K at the indicated concentrations. (A) Representative images of miR-34a in fresh (upper panels) and PFA perfusion-fixed (lower panels) brain sections are shown. The insert images are a higher magnification of the boxed brain sections including the TRN. Scale bars in (A) , 1 mm; 0.2 mm in the inserted images. (B) ISH signals for miR-181a in fresh (left panels) and PFA perfusion-fixed (right panels) brain sections are shown. The insert images are a higher magnification of the boxed brain sections including the hippocampal DG (B) . Scale bars in (B) , 500 μm; 100 μm in the inserted images.
    Figure Legend Snippet: Comparisons of the signal intensities of miRNA ISH in fresh and fixed brain sections with or without proteinase K digestion . In situ detection of miR-34a (A) and miR-181a (B) was performed in adult mouse brain sections. The hybridization temperature was 37°C below the T m of each RNA. Detection was carried out using the NBT/BCIP colorimetric method. The sections were treated with or without proteinase K at the indicated concentrations. (A) Representative images of miR-34a in fresh (upper panels) and PFA perfusion-fixed (lower panels) brain sections are shown. The insert images are a higher magnification of the boxed brain sections including the TRN. Scale bars in (A) , 1 mm; 0.2 mm in the inserted images. (B) ISH signals for miR-181a in fresh (left panels) and PFA perfusion-fixed (right panels) brain sections are shown. The insert images are a higher magnification of the boxed brain sections including the hippocampal DG (B) . Scale bars in (B) , 500 μm; 100 μm in the inserted images.

    Techniques Used: In Situ Hybridization, In Situ, Hybridization, RNA Detection

    16) Product Images from "The Varicella-Zoster Virus Immediate-Early 63 protein affects chromatin controlled gene transcription in a cell-type dependent manner"

    Article Title: The Varicella-Zoster Virus Immediate-Early 63 protein affects chromatin controlled gene transcription in a cell-type dependent manner

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-8-99

    RNA polymerase II recruitment on selected cellular genes in HeLa cells expressing or not IE63 . ChIP assay using RNA polymerase II antibody or unspecific antibody (lane 1) was performed on total cell lysates. Real-time PCR amplification of a 100 bp fragment from the WIF1 (A), and C3 (B) promoter encompassing [59] the transcription initiation site was carried out. ρ-values were calculated using the graphpad quickcalcs software [59]: *, significantly different from control (Inv ; p-value
    Figure Legend Snippet: RNA polymerase II recruitment on selected cellular genes in HeLa cells expressing or not IE63 . ChIP assay using RNA polymerase II antibody or unspecific antibody (lane 1) was performed on total cell lysates. Real-time PCR amplification of a 100 bp fragment from the WIF1 (A), and C3 (B) promoter encompassing [59] the transcription initiation site was carried out. ρ-values were calculated using the graphpad quickcalcs software [59]: *, significantly different from control (Inv ; p-value

    Techniques Used: Expressing, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Amplification, Software

    Relative expression of IL-8, IL-6, ICAM-1 and IκBα genes in HeLa cells expressing IE63, IE63-S224/T222A, and IE63-Full versus control cells stimulated or not with TNFα . HeLa cells expressing IE63 wild-type, IE63-S224/T222A, IE63-Full or IE63 in inverted orientation (Inv, control) were treated for increasing times (from 0 to 2 h) with TNFα at a final concentration of 200 U/mL. (A) Total RNA extracts were isolated and analyzed by Real-time RT-PCR using primers for the IL-8 mRNA, IL-6 mRNA, ICAM-1 mRNA, and IκBα mRNA. (B) The IκBα degradation. HeLa cells expressing IE63wt or control cells were treated for increasing times (from 0 to 2 h) with TNFα (200 U/mL). IκBα degradation was followed by Western Blotting on total cellular extracts. β-actin Western Blotting detection was used as loading control (lower panel). ρ-values were calculated using the graphpad quickcalcs software [59]: *, significantly different from control (Inv ; p-value
    Figure Legend Snippet: Relative expression of IL-8, IL-6, ICAM-1 and IκBα genes in HeLa cells expressing IE63, IE63-S224/T222A, and IE63-Full versus control cells stimulated or not with TNFα . HeLa cells expressing IE63 wild-type, IE63-S224/T222A, IE63-Full or IE63 in inverted orientation (Inv, control) were treated for increasing times (from 0 to 2 h) with TNFα at a final concentration of 200 U/mL. (A) Total RNA extracts were isolated and analyzed by Real-time RT-PCR using primers for the IL-8 mRNA, IL-6 mRNA, ICAM-1 mRNA, and IκBα mRNA. (B) The IκBα degradation. HeLa cells expressing IE63wt or control cells were treated for increasing times (from 0 to 2 h) with TNFα (200 U/mL). IκBα degradation was followed by Western Blotting on total cellular extracts. β-actin Western Blotting detection was used as loading control (lower panel). ρ-values were calculated using the graphpad quickcalcs software [59]: *, significantly different from control (Inv ; p-value

    Techniques Used: Expressing, Concentration Assay, Isolation, Quantitative RT-PCR, Western Blot, Software

    17) Product Images from "Minocycline Attenuates HIV Infection and Reactivation by Suppressing Cellular Activation in Human CD4+ T Cells"

    Article Title: Minocycline Attenuates HIV Infection and Reactivation by Suppressing Cellular Activation in Human CD4+ T Cells

    Journal:

    doi: 10.1086/651277

    Intracellular human immunodeficiency virus (HIV) DNA and RNA levels after in vitro HIV NL4-3 infection of CD4 + T cells. CD4 + T cells were pretreated with minocycline ( diamonds ) or not pretreated ( squares ), followed by activation with anti-CD3/CD28 antibodies
    Figure Legend Snippet: Intracellular human immunodeficiency virus (HIV) DNA and RNA levels after in vitro HIV NL4-3 infection of CD4 + T cells. CD4 + T cells were pretreated with minocycline ( diamonds ) or not pretreated ( squares ), followed by activation with anti-CD3/CD28 antibodies

    Techniques Used: In Vitro, Infection, Activation Assay

    18) Product Images from "Exosome-delivered microRNAs modulate the inflammatory response to endotoxin"

    Article Title: Exosome-delivered microRNAs modulate the inflammatory response to endotoxin

    Journal: Nature Communications

    doi: 10.1038/ncomms8321

    Functional transfer of miR-146a via exosomes in vitro . ( a ) Levels of miR-146a in the exosomal pellet derived from BMDCs that were treated with or without GW4869 and LPS ( n =2). ( b ) miR-146a levels in Wt and Rab27 DKO BMDC-derived exosomal pellets ( n =2). ( c ) Schematic of miR-146a exosome-transfer experiment where Wt or miR-146a−/− exosomes were isolated from BMDCs and transferred to recipient miR-146a−/− BMDCs. RNA was isolated after 24 h and the presence of miR-146a was assayed via qRT–PCR. ( d ) Relative levels of miR-146a in miR-146a−/− BMDCs given exosomes derived from Wt or miR-146a−/− BMDCs ( n =4). ( e ) mRNA levels of miR-146a target, IRAK1, were measured from the same cells as in d via qRT–PCR ( n =4). ( f ) Representative western blottings of IRAK1 and β-actin from miR-146a−/− cells given either Wt or miR-146a−/− exosomes. ( g ) IRAK1 protein levels were quantified using ImageJ software ( n =2). ( h ) mRNA levels of miR-146a target, TRAF6, were measured in the same cells as in d via qRT–PCR. ( i ) Western blottings for TRAF6 and β-actin from miR-146a−/− BMDCs given either Wt or miR-146a−/− exosomes ( n =2). ( j ) Western blotting results are quantified with ImageJ software. ( k ) Copy number of miR-146a in Wt and miR-146a−/− exosomes ( n =3). Copy number is calculated based on a standard curve where a known amount of synthetic miR-146a was spiked into miR-146a−/− BMDC-derived exosome pellet followed by RNA isolation and qRT–PCR. ( l ) Copy number of miR-146a was measured via qRT–PCR in miR-146a−/− recipient BMDCs that received either Wt or miR-146a−/− exosomes (146a−/− BMDC+ Wt exos and 146a−/− BMDC+146a−/− exos), as well as in Wt and miR-146a−/− donor BMDCs ( n =3). Average copy number is displayed above. Copy number is calculated based on a standard curve where a known amount of synthetic miR-146a was spiked into miR-146a−/− BMDC pellet followed by RNA isolation and qRT–PCR. Data represent two independent experiments and are presented as the mean±s.d. (error bars). * P
    Figure Legend Snippet: Functional transfer of miR-146a via exosomes in vitro . ( a ) Levels of miR-146a in the exosomal pellet derived from BMDCs that were treated with or without GW4869 and LPS ( n =2). ( b ) miR-146a levels in Wt and Rab27 DKO BMDC-derived exosomal pellets ( n =2). ( c ) Schematic of miR-146a exosome-transfer experiment where Wt or miR-146a−/− exosomes were isolated from BMDCs and transferred to recipient miR-146a−/− BMDCs. RNA was isolated after 24 h and the presence of miR-146a was assayed via qRT–PCR. ( d ) Relative levels of miR-146a in miR-146a−/− BMDCs given exosomes derived from Wt or miR-146a−/− BMDCs ( n =4). ( e ) mRNA levels of miR-146a target, IRAK1, were measured from the same cells as in d via qRT–PCR ( n =4). ( f ) Representative western blottings of IRAK1 and β-actin from miR-146a−/− cells given either Wt or miR-146a−/− exosomes. ( g ) IRAK1 protein levels were quantified using ImageJ software ( n =2). ( h ) mRNA levels of miR-146a target, TRAF6, were measured in the same cells as in d via qRT–PCR. ( i ) Western blottings for TRAF6 and β-actin from miR-146a−/− BMDCs given either Wt or miR-146a−/− exosomes ( n =2). ( j ) Western blotting results are quantified with ImageJ software. ( k ) Copy number of miR-146a in Wt and miR-146a−/− exosomes ( n =3). Copy number is calculated based on a standard curve where a known amount of synthetic miR-146a was spiked into miR-146a−/− BMDC-derived exosome pellet followed by RNA isolation and qRT–PCR. ( l ) Copy number of miR-146a was measured via qRT–PCR in miR-146a−/− recipient BMDCs that received either Wt or miR-146a−/− exosomes (146a−/− BMDC+ Wt exos and 146a−/− BMDC+146a−/− exos), as well as in Wt and miR-146a−/− donor BMDCs ( n =3). Average copy number is displayed above. Copy number is calculated based on a standard curve where a known amount of synthetic miR-146a was spiked into miR-146a−/− BMDC pellet followed by RNA isolation and qRT–PCR. Data represent two independent experiments and are presented as the mean±s.d. (error bars). * P

    Techniques Used: Functional Assay, In Vitro, Derivative Assay, Isolation, Quantitative RT-PCR, Western Blot, Software

    miR-146a-containing exosomes reduce inflammatory responses to LPS in miR-146a−/− mice. ( a ) Schematic of the experimental design where miR-146a−/− mice were i.p. injected with either Wt or miR-146a−/− BMDC-derived exosomes and then challenged with LPS 24 h later. Blood was taken 2 h post LPS injection and the spleen, liver and BM were harvested 24 h post injection. ( b , c ) Serum TNFα and IL-6 were analysed via enzyme-linked immunosorbent assay 2 h after injection of LPS ( n =5). ( d – f ) qRT–PCR was preformed using RNA isolated from the spleen, liver and BM, to assay the relative levels of exosomally delivered miR-146a ( n =5). ( g – i ) mRNA levels of the miR-146a targets TRAF6 and IRAK1 were measured in the spleen, liver and/or the BM using qRT–PCR ( n =5). All data are presented as the mean±s.d. (error bars). * P
    Figure Legend Snippet: miR-146a-containing exosomes reduce inflammatory responses to LPS in miR-146a−/− mice. ( a ) Schematic of the experimental design where miR-146a−/− mice were i.p. injected with either Wt or miR-146a−/− BMDC-derived exosomes and then challenged with LPS 24 h later. Blood was taken 2 h post LPS injection and the spleen, liver and BM were harvested 24 h post injection. ( b , c ) Serum TNFα and IL-6 were analysed via enzyme-linked immunosorbent assay 2 h after injection of LPS ( n =5). ( d – f ) qRT–PCR was preformed using RNA isolated from the spleen, liver and BM, to assay the relative levels of exosomally delivered miR-146a ( n =5). ( g – i ) mRNA levels of the miR-146a targets TRAF6 and IRAK1 were measured in the spleen, liver and/or the BM using qRT–PCR ( n =5). All data are presented as the mean±s.d. (error bars). * P

    Techniques Used: Mouse Assay, Injection, Derivative Assay, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR, Isolation

    miR-146a-containing exosomes reduce inflammatory response to LPS in Wt mice. ( a ) Schematic of the experimental design where Wt mice were i.p. injected with either Wt or miR-146a−/− BMDC-derived exosomes and then challenged with LPS 24 h later. Blood was taken 2 h post LPS injection and the spleen, liver and BM were harvested 24 h post injection. ( b , c ) Serum TNFα and IL-6 were analysed via enzyme-linked immunosorbent assay 2 h after injection of LPS ( n =5). ( d – f ) qRT–PCR using RNA isolated from the spleen, liver and BM was performed to assay the relative levels of exosomally delivered miR-146a ( n =5). ( g – i ) mRNA levels of the miR-146a targets TRAF6 and IRAK1 were measured in the spleen, liver and/or the BM using qRT–PCR ( n =5). Results represent two independent experiments. All data are presented as the mean±s.d. (error bars). * P
    Figure Legend Snippet: miR-146a-containing exosomes reduce inflammatory response to LPS in Wt mice. ( a ) Schematic of the experimental design where Wt mice were i.p. injected with either Wt or miR-146a−/− BMDC-derived exosomes and then challenged with LPS 24 h later. Blood was taken 2 h post LPS injection and the spleen, liver and BM were harvested 24 h post injection. ( b , c ) Serum TNFα and IL-6 were analysed via enzyme-linked immunosorbent assay 2 h after injection of LPS ( n =5). ( d – f ) qRT–PCR using RNA isolated from the spleen, liver and BM was performed to assay the relative levels of exosomally delivered miR-146a ( n =5). ( g – i ) mRNA levels of the miR-146a targets TRAF6 and IRAK1 were measured in the spleen, liver and/or the BM using qRT–PCR ( n =5). Results represent two independent experiments. All data are presented as the mean±s.d. (error bars). * P

    Techniques Used: Mouse Assay, Injection, Derivative Assay, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR, Isolation

    miR-155-containing exosomes promote a heightened response to LPS in miR-155−/− mice. ( a ) Schematic of the experimental design where miR-155−/− mice were i.p. injected with either Wt or miR-155−/− BMDC-derived exosomes and then challenged with LPS 24 h later. Blood was taken 2 h post LPS injection and the spleen, liver and BM were harvested 24 h post injection. ( b , c ) Serum TNFα and IL-6 concentrations were analysed via enzyme-linked immunosorbent assay 2 h after injection of LPS in miR-155−/− mice that had been pretreated with either Wt or miR-155−/− exosomes ( n =5). ( d – f ) qRT–PCR was preformed using RNA isolated from the spleen, liver and BM, to assay the relative levels of exosomally delivered miR-155 ( n =5). ( g – i ) mRNA levels of the miR-155 targets SHIP1 and BACH1 were measured in the spleen, liver and/or the BM using qRT–PCR ( n =5). All data are presented as the mean±s.d. (error bars). * P
    Figure Legend Snippet: miR-155-containing exosomes promote a heightened response to LPS in miR-155−/− mice. ( a ) Schematic of the experimental design where miR-155−/− mice were i.p. injected with either Wt or miR-155−/− BMDC-derived exosomes and then challenged with LPS 24 h later. Blood was taken 2 h post LPS injection and the spleen, liver and BM were harvested 24 h post injection. ( b , c ) Serum TNFα and IL-6 concentrations were analysed via enzyme-linked immunosorbent assay 2 h after injection of LPS in miR-155−/− mice that had been pretreated with either Wt or miR-155−/− exosomes ( n =5). ( d – f ) qRT–PCR was preformed using RNA isolated from the spleen, liver and BM, to assay the relative levels of exosomally delivered miR-155 ( n =5). ( g – i ) mRNA levels of the miR-155 targets SHIP1 and BACH1 were measured in the spleen, liver and/or the BM using qRT–PCR ( n =5). All data are presented as the mean±s.d. (error bars). * P

    Techniques Used: Mouse Assay, Injection, Derivative Assay, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR, Isolation

    19) Product Images from "Fine needle aspirates of kidneys: a promising tool for RNA sequencing in native and transplanted kidneys"

    Article Title: Fine needle aspirates of kidneys: a promising tool for RNA sequencing in native and transplanted kidneys

    Journal: BMC Nephrology

    doi: 10.1186/s12882-018-1012-4

    RNA yield and RNA quality of FNA samples (G19-G25) and of corresponding core biopsy samples (G16). a . RNA yield (ng/sample) was higher in G16 biopsies compared to all FNA (G19–25) samples (***p = 0,0003; ****p < 0,0001) . b . RNA quality by RIN values, and c . RNA quality by DV200 values
    Figure Legend Snippet: RNA yield and RNA quality of FNA samples (G19-G25) and of corresponding core biopsy samples (G16). a . RNA yield (ng/sample) was higher in G16 biopsies compared to all FNA (G19–25) samples (***p = 0,0003; ****p < 0,0001) . b . RNA quality by RIN values, and c . RNA quality by DV200 values

    Techniques Used:

    20) Product Images from "Fine needle aspirates of kidneys: a promising tool for RNA sequencing in native and transplanted kidneys"

    Article Title: Fine needle aspirates of kidneys: a promising tool for RNA sequencing in native and transplanted kidneys

    Journal: BMC Nephrology

    doi: 10.1186/s12882-018-1012-4

    RNA yield and RNA quality of FNA samples (G19-G25) and of corresponding core biopsy samples (G16). a . RNA yield (ng/sample) was higher in G16 biopsies compared to all FNA (G19–25) samples (***p = 0,0003; ****p
    Figure Legend Snippet: RNA yield and RNA quality of FNA samples (G19-G25) and of corresponding core biopsy samples (G16). a . RNA yield (ng/sample) was higher in G16 biopsies compared to all FNA (G19–25) samples (***p = 0,0003; ****p

    Techniques Used:

    Related Articles

    Centrifugation:

    Article Title: First insights on the genetic diversity of MDR Mycobacterium tuberculosis in Lebanon
    Article Snippet: Mycobacterial cells were harvested from MGIT liquid media by centrifugation for 10 min at 7500 rpm. .. 1 ul carrier RNA (Qiagen, Hilden, Germany) was added to 200 ul AL buffer (Qiagen, Hilden, Germany) and mixed into the sample.

    Article Title: High-throughput detection of RNA processing in bacteria
    Article Snippet: For growth temperatures, sample cultures OD600 and rates of shaking, see Table . .. RNA was extracted using Qiagen’s RNA Protect Bacteria Reagent and RNeasy Midi kit (Qiagen) using the manufacturer’s protocol except that all centrifugation steps were carried out at 4 °C. .. A DNase digestion step was carried out on the columns as per the manufacturer’s protocol.

    Amplification:

    Article Title: A Versatile Panel of Reference Gene Assays for the Measurement of Chicken mRNA by Quantitative PCR
    Article Snippet: Amplification and detection of specific products was performed with the 7500 Fast Real Time System (TaqMan®; Applied Biosystems) with the following cycle profile: 50°C for 5 min, 95°C for 2 min and then 40 cycles of 95°C for 3 sec and 60°C for 30 sec. Generally, 20 ng of RNA was used for each assay. .. Dilutions were carried out in 100 μg/ml carrier RNA (Qiagen) in buffer AVE (Qiagen).

    Article Title: Low Postseroconversion CD4+ T-cell Level Is Associated with Faster Disease Progression and Higher Viral Evolutionary Rate in HIV-2 Infection
    Article Snippet: Paragraph title: Amplification and sequencing. ... Briefly, 200 μl of plasma was disrupted in 2,000 μl QIAzol and loaded onto an RNeasy MinElute Spin column in the presence of 15 μg carrier RNA (Qiagen, Stockholm, Sweden).

    Positive Control:

    Article Title: Comparison of Filters for Concentrating Microbial Indicators and Pathogens in Lake Water Samples
    Article Snippet: Viral RNA and DNA were extracted from 400 μl of the final concentrates using a QIAamp DNA Mini Extraction kit (Qiagen, Valencia, CA) according to the manufacturer's instructions, except the AL general lysis buffer was substituted for the AVL viral lysis buffer with the addition of carrier RNA (Qiagen, Valencia, CA). .. Of the 100 μl of extracted concentrate, 5 μl was analyzed by use of quantitative PCR (qPCR) for adenovirus ( ) or quantitative reverse transcriptase PCR (qRT-PCR) for enterovirus ( ) and norovirus GII ( ).

    Synthesized:

    Article Title: High-throughput RNA profiling via up-front sample parallelization
    Article Snippet: RNA oligonucleotides comprised of 90 microRNA and 6 control RNA sequences ( ) were synthesized at a 40 nmole scale with 2′-deprotection and purification at the Yale Keck oligonucleotide synthesis core facility. .. The RNAs were dissolved in a buffer containing 10mM Tris (pH 7.6), 0.1 mM EDTA, and 300 ng/mL poly-A carrier RNA (Qiagen) in RNAse-free water.

    Article Title: Lipid Droplet-Binding Protein TIP47 Regulates Hepatitis C Virus RNA Replication through Interaction with the Viral NS5A Protein
    Article Snippet: 20 ug of carrier RNA (Qiagen) was added to 150 ul of each fraction. .. 20 ug of carrier RNA (Qiagen) was added to 150 ul of each fraction.

    Blocking Assay:

    Article Title: Initial B-Cell Responses to Transmitted Human Immunodeficiency Virus Type 1: Virion-Binding Immunoglobulin M (IgM) and IgG Antibodies Followed by Plasma Anti-gp41 Antibodies with Ineffective Control of Initial Viremia
    Article Snippet: After blocking and washing, 90 μl of undiluted plasma was added to each well and incubated for 90 min, followed by four washes with PBS supplemented with 0.05% Tween. .. A total of 200 μl of AVL lysis buffer with carrier RNA (Qiagen) was added and shaken for 15 min, and viral RNA in the lysis was extracted by a Qiagen viral mini kit.

    SYBR Green Assay:

    Article Title: A Prospective Study of Leukocyte Telomere Length and Risk of Type 2 Diabetes in Postmenopausal Women
    Article Snippet: The 36B4 reaction consisted of 1× Roche Faststart Universal SYBR Green Master Mix, 200 nM 36B4U primer (CAGCAAGTGGGAAGGTGTAATCC), and 200 nM 36B4D primer (CCCATTCTATCATCAACGGGTACAA). .. Carrier RNA (Qiagen, Inc., Valencia, CA) was added to each standard to maintain a constant 10 ng of total DNA per reaction.

    Incubation:

    Article Title: First insights on the genetic diversity of MDR Mycobacterium tuberculosis in Lebanon
    Article Snippet: Each sample pellet was resuspended in a digestion buffer composed of 100 ul TE buffer, 3 ul Mutanolysin (5000 U/ml) (Sigma, Darmstadt, Germany), and 5 mg lysozyme (Sigma, Darmstadt, Germany) and incubated for 40 min at 37 °C on a shaking incubator. .. 1 ul carrier RNA (Qiagen, Hilden, Germany) was added to 200 ul AL buffer (Qiagen, Hilden, Germany) and mixed into the sample.

    Article Title: Expansion of a subset of CD14highCD16negCCR2low/neg monocytes functionally similar to myeloid-derived suppressor cells during SIV and HIV infection
    Article Snippet: Lysates were centrifuged at 10,000 g for 15 min. Pellets were resuspended in ATL buffer, and DNA was extracted, according to the manufacturer's instructions. .. Supernatants containing the RNA were incubated for 15 min at 80°C and then mixed with two volumes of 100% ethanol and 1 μg carrier RNA (Qiagen). .. After 30 min at −20°C, RNA was pelleted by centrifugation and resuspended in 6 μl RNase-free water.

    Article Title: Initial B-Cell Responses to Transmitted Human Immunodeficiency Virus Type 1: Virion-Binding Immunoglobulin M (IgM) and IgG Antibodies Followed by Plasma Anti-gp41 Antibodies with Ineffective Control of Initial Viremia
    Article Snippet: After blocking and washing, 90 μl of undiluted plasma was added to each well and incubated for 90 min, followed by four washes with PBS supplemented with 0.05% Tween. .. A total of 200 μl of AVL lysis buffer with carrier RNA (Qiagen) was added and shaken for 15 min, and viral RNA in the lysis was extracted by a Qiagen viral mini kit.

    Formalin-fixed Paraffin-Embedded:

    Article Title: Expansion of a subset of CD14highCD16negCCR2low/neg monocytes functionally similar to myeloid-derived suppressor cells during SIV and HIV infection
    Article Snippet: Genomic DNA and total RNA were isolated from sorted cells using the Allprep DNA RNA formalin-fixed, paraffin-embedded kit (Qiagen) with modifications. .. Supernatants containing the RNA were incubated for 15 min at 80°C and then mixed with two volumes of 100% ethanol and 1 μg carrier RNA (Qiagen).

    Expressing:

    Article Title: Expression of the IGF Axis Is Decreased in Local Prostate Cancer but Enhanced after Benign Prostate Epithelial Differentiation and TGF-? Treatment
    Article Snippet: After LCM the tissues were lysed in 50 μL of PicoPure extraction buffer (Arcturus) supplemented with 50 ng of Poly-A-RNA carrier (Qiagen, Germantown, MD) and stored at −80°C until used for RNA isolation. .. After LCM the tissues were lysed in 50 μL of PicoPure extraction buffer (Arcturus) supplemented with 50 ng of Poly-A-RNA carrier (Qiagen, Germantown, MD) and stored at −80°C until used for RNA isolation.

    Inhibition:

    Article Title: Comparison of Filters for Concentrating Microbial Indicators and Pathogens in Lake Water Samples
    Article Snippet: Viral RNA and DNA were extracted from 400 μl of the final concentrates using a QIAamp DNA Mini Extraction kit (Qiagen, Valencia, CA) according to the manufacturer's instructions, except the AL general lysis buffer was substituted for the AVL viral lysis buffer with the addition of carrier RNA (Qiagen, Valencia, CA). .. Of the 100 μl of extracted concentrate, 5 μl was analyzed by use of quantitative PCR (qPCR) for adenovirus ( ) or quantitative reverse transcriptase PCR (qRT-PCR) for enterovirus ( ) and norovirus GII ( ).

    Sequencing:

    Article Title: Enhanced methods for unbiased deep sequencing of Lassa and Ebola RNA viruses from clinical and biological samples
    Article Snippet: As with most RNA-seq approaches, unwanted RNA contaminants waste many sequencing reads and negatively impact sequencing performance. .. In addition, a prevalent artificial contaminant in RNA preparations is poly(rA) carrier RNA, present in commonly used commercial viral RNA extraction kits (for example, those from QIAGEN and Ambion).

    Article Title: Low Postseroconversion CD4+ T-cell Level Is Associated with Faster Disease Progression and Higher Viral Evolutionary Rate in HIV-2 Infection
    Article Snippet: Paragraph title: Amplification and sequencing. ... Briefly, 200 μl of plasma was disrupted in 2,000 μl QIAzol and loaded onto an RNeasy MinElute Spin column in the presence of 15 μg carrier RNA (Qiagen, Stockholm, Sweden).

    Article Title: A Prospective Study of Leukocyte Telomere Length and Risk of Type 2 Diabetes in Postmenopausal Women
    Article Snippet: The number of repeats in each standard was calculated as follows: 30 pg 84-oligomer TEL standard = (30 × 10−12 g) ÷ (26,667.2[MW] /6.02 × 1023 [Avogadro’s number] ) × 84 ÷ 1,000 = 5.69 × 107 kb of telomere sequence in the 1× telomere standard. .. Carrier RNA (Qiagen, Inc., Valencia, CA) was added to each standard to maintain a constant 10 ng of total DNA per reaction.

    Concentration Assay:

    Article Title: Comparison of Filters for Concentrating Microbial Indicators and Pathogens in Lake Water Samples
    Article Snippet: Viral RNA and DNA were extracted from 400 μl of the final concentrates using a QIAamp DNA Mini Extraction kit (Qiagen, Valencia, CA) according to the manufacturer's instructions, except the AL general lysis buffer was substituted for the AVL viral lysis buffer with the addition of carrier RNA (Qiagen, Valencia, CA). .. PCR inhibition was determined using matrix spikes by seeding the sample with an extracted positive-control virus in a duplicate qPCR or qRT-PCR.

    Article Title: Initial B-Cell Responses to Transmitted Human Immunodeficiency Virus Type 1: Virion-Binding Immunoglobulin M (IgM) and IgG Antibodies Followed by Plasma Anti-gp41 Antibodies with Ineffective Control of Initial Viremia
    Article Snippet: ELISA plates (NUNC) were coated overnight at 4°C with anti-human IgM or IgG at a concentration of 1 μg/ml diluted in PBS. .. A total of 200 μl of AVL lysis buffer with carrier RNA (Qiagen) was added and shaken for 15 min, and viral RNA in the lysis was extracted by a Qiagen viral mini kit.

    Serial Dilution:

    Article Title: A Prospective Study of Leukocyte Telomere Length and Risk of Type 2 Diabetes in Postmenopausal Women
    Article Snippet: The standard curve of 36B4 contained 100 pg of the 36B4 75-oligomer oligonucleotide at a serial dilution of 10−1 to 10−6 . .. Carrier RNA (Qiagen, Inc., Valencia, CA) was added to each standard to maintain a constant 10 ng of total DNA per reaction.

    Article Title: Lipid Droplet-Binding Protein TIP47 Regulates Hepatitis C Virus RNA Replication through Interaction with the Viral NS5A Protein
    Article Snippet: 20 ug of carrier RNA (Qiagen) was added to 150 ul of each fraction. .. 20 ug of carrier RNA (Qiagen) was added to 150 ul of each fraction.

    Generated:

    Article Title: Lipid Droplet-Binding Protein TIP47 Regulates Hepatitis C Virus RNA Replication through Interaction with the Viral NS5A Protein
    Article Snippet: 20 ug of carrier RNA (Qiagen) was added to 150 ul of each fraction. .. RNA was eluted using 35 ul H2 O. cDNA was synthesized using an HCV replicon (Con1, genotype 1b) antisense probe (nt 283-302; 5′-ctttcgcgacccaacactac-3′ ) and AMV reverse transcriptase (Promega) followed by RNase A (Thermo Scientific) digestion.

    other:

    Article Title: A Versatile Panel of Reference Gene Assays for the Measurement of Chicken mRNA by Quantitative PCR
    Article Snippet: We also found that standard curves showing the best linearity over a large dynamic range required the presence of carrier RNA in the diluent.

    Article Title: Murine Norovirus: Propagation, Quantification and Genetic Manipulation
    Article Snippet: It is important to dilute the standard RNA in presence of a carrier RNA.

    Article Title: Cytomegalovirus-specific CD8+ T cells targeting different peptide/HLA combinations demonstrate varying T-cell receptor diversity
    Article Snippet: Cell pellets were used for extraction of total RNA using the RNeasy Micro Kit with poly-A RNA carrier solution and RNase-free DNase (all reagents; Qiagen, Sussex, UK) according to the manufacturer's instructions.

    Article Title: Airborne rhinovirus detection and effect of ultraviolet irradiation on detection by a semi-nested RT-PCR assay
    Article Snippet: We then added 560 μl of prepared AVL buffer containing carrier RNA (Qiagen QIAamp Viral RNA Mini Kit) and 140 μl phosphate buffered saline (PBS).

    Article Title: Design and Validation of Real-Time Reverse Transcription-PCR Assays for Detection of Pandemic (H1N1) 2009 Virus
    Article Snippet: Tenfold serial dilutions of the pandemic (H1N1) 2009 virus control nucleic acid diluted in carrier RNA were used to determine the dynamic range of the in-house assays and the CDC-M and CDC-H1-swine assays.

    Polymerase Chain Reaction:

    Article Title: Comparison of Filters for Concentrating Microbial Indicators and Pathogens in Lake Water Samples
    Article Snippet: Viral RNA and DNA were extracted from 400 μl of the final concentrates using a QIAamp DNA Mini Extraction kit (Qiagen, Valencia, CA) according to the manufacturer's instructions, except the AL general lysis buffer was substituted for the AVL viral lysis buffer with the addition of carrier RNA (Qiagen, Valencia, CA). .. Of the 100 μl of extracted concentrate, 5 μl was analyzed by use of quantitative PCR (qPCR) for adenovirus ( ) or quantitative reverse transcriptase PCR (qRT-PCR) for enterovirus ( ) and norovirus GII ( ).

    Article Title: Low Postseroconversion CD4+ T-cell Level Is Associated with Faster Disease Progression and Higher Viral Evolutionary Rate in HIV-2 Infection
    Article Snippet: Briefly, 200 μl of plasma was disrupted in 2,000 μl QIAzol and loaded onto an RNeasy MinElute Spin column in the presence of 15 μg carrier RNA (Qiagen, Stockholm, Sweden). .. Briefly, 200 μl of plasma was disrupted in 2,000 μl QIAzol and loaded onto an RNeasy MinElute Spin column in the presence of 15 μg carrier RNA (Qiagen, Stockholm, Sweden).

    Article Title: Chk2 is dispensable for p53-mediated G1 arrest but is required for a latent p53-mediated apoptotic response
    Article Snippet: RNA was obtained from both untreated MEFs and cells treated with 5 Gy IR (18 h post-IR). .. Quantitative reverse transcriptase (RT)–PCR was carried out by using 2 μg of RNA for the RT reaction (as per the manufacturer's instruction, Qiagen). p21 primers toward mouse p21 were then used in the PCR to measure p21 RNA levels (5′-CGGTCCCGTGGACAGTGAGCAG-3′ and 5′-GTCAGGCTGGTCTGCCTCCG-3′). .. Glyceraldehyde-3-phosphate dehydrogenase primers were used on the same RT reaction as a quantitative control for PCR.

    DNA Extraction:

    Article Title: First insights on the genetic diversity of MDR Mycobacterium tuberculosis in Lebanon
    Article Snippet: Paragraph title: DNA extraction ... 1 ul carrier RNA (Qiagen, Hilden, Germany) was added to 200 ul AL buffer (Qiagen, Hilden, Germany) and mixed into the sample.

    RNA Sequencing Assay:

    Article Title: Enhanced methods for unbiased deep sequencing of Lassa and Ebola RNA viruses from clinical and biological samples
    Article Snippet: As with most RNA-seq approaches, unwanted RNA contaminants waste many sequencing reads and negatively impact sequencing performance. .. In addition, a prevalent artificial contaminant in RNA preparations is poly(rA) carrier RNA, present in commonly used commercial viral RNA extraction kits (for example, those from QIAGEN and Ambion).

    Isolation:

    Article Title: Expansion of a subset of CD14highCD16negCCR2low/neg monocytes functionally similar to myeloid-derived suppressor cells during SIV and HIV infection
    Article Snippet: Genomic DNA and total RNA were isolated from sorted cells using the Allprep DNA RNA formalin-fixed, paraffin-embedded kit (Qiagen) with modifications. .. Supernatants containing the RNA were incubated for 15 min at 80°C and then mixed with two volumes of 100% ethanol and 1 μg carrier RNA (Qiagen).

    Article Title: Expression of the IGF Axis Is Decreased in Local Prostate Cancer but Enhanced after Benign Prostate Epithelial Differentiation and TGF-? Treatment
    Article Snippet: Total working time for the isolation of cells for one RNA isolation was 30 to 40 minutes. .. After LCM the tissues were lysed in 50 μL of PicoPure extraction buffer (Arcturus) supplemented with 50 ng of Poly-A-RNA carrier (Qiagen, Germantown, MD) and stored at −80°C until used for RNA isolation. .. The different cell populations (benign epithelial, benign epithelial–associated stromal, cancer, and -cancer-associated stromal cells for sample set 1 and benign epithelial and cancer cells for sample set 2) were isolated from one slide of every tissue (representative microdissection in ; available at ).

    Article Title: Phenotypic characterization of a Csf1r haploinsufficient mouse model of adult-onset leukodystrophy with axonal spheroids and pigmented glia (ALSP)
    Article Snippet: Paragraph title: RNA isolation and QRT-PCR profiling ... Reverse transcription was carried out using 160 ng of total RNA and the RT2 First Strand Kit (Qiagen).

    Size-exclusion Chromatography:

    Article Title: A Versatile Panel of Reference Gene Assays for the Measurement of Chicken mRNA by Quantitative PCR
    Article Snippet: Amplification and detection of specific products was performed with the 7500 Fast Real Time System (TaqMan®; Applied Biosystems) with the following cycle profile: 50°C for 5 min, 95°C for 2 min and then 40 cycles of 95°C for 3 sec and 60°C for 30 sec. Generally, 20 ng of RNA was used for each assay. .. Dilutions were carried out in 100 μg/ml carrier RNA (Qiagen) in buffer AVE (Qiagen).

    Microscopy:

    Article Title: Expression of the IGF Axis Is Decreased in Local Prostate Cancer but Enhanced after Benign Prostate Epithelial Differentiation and TGF-? Treatment
    Article Snippet: The LCM was performed on a Pix Cell II microdissection microscope (Arcturus, Life Technologies, Carlsbad, CA) using 3000 laser impulses (settings: spot size, 15 μm; pulse time, 1–3 milliseconds; pulse energy, 60–90 mW) to obtain tissue material for one RNA isolation. .. After LCM the tissues were lysed in 50 μL of PicoPure extraction buffer (Arcturus) supplemented with 50 ng of Poly-A-RNA carrier (Qiagen, Germantown, MD) and stored at −80°C until used for RNA isolation.

    Purification:

    Article Title: High-throughput RNA profiling via up-front sample parallelization
    Article Snippet: RNA oligonucleotides comprised of 90 microRNA and 6 control RNA sequences ( ) were synthesized at a 40 nmole scale with 2′-deprotection and purification at the Yale Keck oligonucleotide synthesis core facility. .. The RNAs were dissolved in a buffer containing 10mM Tris (pH 7.6), 0.1 mM EDTA, and 300 ng/mL poly-A carrier RNA (Qiagen) in RNAse-free water.

    Article Title: High-throughput detection of RNA processing in bacteria
    Article Snippet: RNA was extracted using Qiagen’s RNA Protect Bacteria Reagent and RNeasy Midi kit (Qiagen) using the manufacturer’s protocol except that all centrifugation steps were carried out at 4 °C. .. RNA was extracted using Qiagen’s RNA Protect Bacteria Reagent and RNeasy Midi kit (Qiagen) using the manufacturer’s protocol except that all centrifugation steps were carried out at 4 °C.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Low Postseroconversion CD4+ T-cell Level Is Associated with Faster Disease Progression and Higher Viral Evolutionary Rate in HIV-2 Infection
    Article Snippet: Briefly, 200 μl of plasma was disrupted in 2,000 μl QIAzol and loaded onto an RNeasy MinElute Spin column in the presence of 15 μg carrier RNA (Qiagen, Stockholm, Sweden). .. DNA was removed using an on-column DNase treatment (Qiagen, Stockholm, Sweden), and purified RNA was eluted in 22 μl RNase-free H2 O.

    Article Title: Chk2 is dispensable for p53-mediated G1 arrest but is required for a latent p53-mediated apoptotic response
    Article Snippet: RNA was obtained from both untreated MEFs and cells treated with 5 Gy IR (18 h post-IR). .. Quantitative reverse transcriptase (RT)–PCR was carried out by using 2 μg of RNA for the RT reaction (as per the manufacturer's instruction, Qiagen). p21 primers toward mouse p21 were then used in the PCR to measure p21 RNA levels (5′-CGGTCCCGTGGACAGTGAGCAG-3′ and 5′-GTCAGGCTGGTCTGCCTCCG-3′). .. Glyceraldehyde-3-phosphate dehydrogenase primers were used on the same RT reaction as a quantitative control for PCR.

    Quantitative RT-PCR:

    Article Title: A Versatile Panel of Reference Gene Assays for the Measurement of Chicken mRNA by Quantitative PCR
    Article Snippet: Paragraph title: RT-qPCR with TaqMan Probe ... Dilutions were carried out in 100 μg/ml carrier RNA (Qiagen) in buffer AVE (Qiagen).

    Article Title: Comparison of Filters for Concentrating Microbial Indicators and Pathogens in Lake Water Samples
    Article Snippet: Viral RNA and DNA were extracted from 400 μl of the final concentrates using a QIAamp DNA Mini Extraction kit (Qiagen, Valencia, CA) according to the manufacturer's instructions, except the AL general lysis buffer was substituted for the AVL viral lysis buffer with the addition of carrier RNA (Qiagen, Valencia, CA). .. Of the 100 μl of extracted concentrate, 5 μl was analyzed by use of quantitative PCR (qPCR) for adenovirus ( ) or quantitative reverse transcriptase PCR (qRT-PCR) for enterovirus ( ) and norovirus GII ( ).

    Article Title: Phenotypic characterization of a Csf1r haploinsufficient mouse model of adult-onset leukodystrophy with axonal spheroids and pigmented glia (ALSP)
    Article Snippet: Paragraph title: RNA isolation and QRT-PCR profiling ... Reverse transcription was carried out using 160 ng of total RNA and the RT2 First Strand Kit (Qiagen).

    Article Title: Lipid Droplet-Binding Protein TIP47 Regulates Hepatitis C Virus RNA Replication through Interaction with the Viral NS5A Protein
    Article Snippet: Paragraph title: RNA extraction and quantification by real-time RT-PCR ... 20 ug of carrier RNA (Qiagen) was added to 150 ul of each fraction.

    Lysis:

    Article Title: Comparison of Filters for Concentrating Microbial Indicators and Pathogens in Lake Water Samples
    Article Snippet: The slides were stained with EasyStain G & C (BTF Pty Ltd., North Ryde, New South Wales, Australia) following the manufacturer's protocol, except steps 3, 6, and 7 were omitted. .. Viral RNA and DNA were extracted from 400 μl of the final concentrates using a QIAamp DNA Mini Extraction kit (Qiagen, Valencia, CA) according to the manufacturer's instructions, except the AL general lysis buffer was substituted for the AVL viral lysis buffer with the addition of carrier RNA (Qiagen, Valencia, CA). .. Of the 100 μl of extracted concentrate, 5 μl was analyzed by use of quantitative PCR (qPCR) for adenovirus ( ) or quantitative reverse transcriptase PCR (qRT-PCR) for enterovirus ( ) and norovirus GII ( ).

    Article Title: Initial B-Cell Responses to Transmitted Human Immunodeficiency Virus Type 1: Virion-Binding Immunoglobulin M (IgM) and IgG Antibodies Followed by Plasma Anti-gp41 Antibodies with Ineffective Control of Initial Viremia
    Article Snippet: After blocking and washing, 90 μl of undiluted plasma was added to each well and incubated for 90 min, followed by four washes with PBS supplemented with 0.05% Tween. .. A total of 200 μl of AVL lysis buffer with carrier RNA (Qiagen) was added and shaken for 15 min, and viral RNA in the lysis was extracted by a Qiagen viral mini kit. .. HIV-1 RNA from the virion-antibody complexes was measured by Gag real-time reverse transcription-PCR.

    Article Title: The immunomodulating V and W proteins of Nipah virus determine disease course
    Article Snippet: The tissue samples included the right lung upper lobe, right lung middle lobe, right lung lower lobe, left lung upper lobe, left lung middle lobe, left lung lower lobe, liver, spleen, kidney, adrenal gland, pancreas and brain (frontal cortex). .. All whole-blood samples were inactivated in AVL viral lysis buffer with carrier RNA, and tissue samples were homogenized and inactivated in RLT buffer before removal from the BSL-4 laboratory. .. Subsequently, RNA was isolated from whole blood and swabs using the QIAamp viral RNA kit (Qiagen) from tissues using the RNeasy minikit (Qiagen) according to the manufacturer's instructions supplied with each kit.

    Nested PCR:

    Article Title: Low Postseroconversion CD4+ T-cell Level Is Associated with Faster Disease Progression and Higher Viral Evolutionary Rate in HIV-2 Infection
    Article Snippet: Briefly, 200 μl of plasma was disrupted in 2,000 μl QIAzol and loaded onto an RNeasy MinElute Spin column in the presence of 15 μg carrier RNA (Qiagen, Stockholm, Sweden). .. Briefly, 200 μl of plasma was disrupted in 2,000 μl QIAzol and loaded onto an RNeasy MinElute Spin column in the presence of 15 μg carrier RNA (Qiagen, Stockholm, Sweden).

    RNA Extraction:

    Article Title: Enhanced methods for unbiased deep sequencing of Lassa and Ebola RNA viruses from clinical and biological samples
    Article Snippet: The largest single component of RNA in clinical samples is human RNA, particularly ribosomal RNA (rRNA). .. In addition, a prevalent artificial contaminant in RNA preparations is poly(rA) carrier RNA, present in commonly used commercial viral RNA extraction kits (for example, those from QIAGEN and Ambion). .. Although non-nucleic-acid carriers such as linear polyacrylamide are suitable substitutes, many existing sample collections already contain poly(rA).

    Article Title: High-throughput detection of RNA processing in bacteria
    Article Snippet: Paragraph title: RNA extraction ... RNA was extracted using Qiagen’s RNA Protect Bacteria Reagent and RNeasy Midi kit (Qiagen) using the manufacturer’s protocol except that all centrifugation steps were carried out at 4 °C.

    Article Title: Lipid Droplet-Binding Protein TIP47 Regulates Hepatitis C Virus RNA Replication through Interaction with the Viral NS5A Protein
    Article Snippet: Paragraph title: RNA extraction and quantification by real-time RT-PCR ... 20 ug of carrier RNA (Qiagen) was added to 150 ul of each fraction.

    Real-time Polymerase Chain Reaction:

    Article Title: Comparison of Filters for Concentrating Microbial Indicators and Pathogens in Lake Water Samples
    Article Snippet: Viral RNA and DNA were extracted from 400 μl of the final concentrates using a QIAamp DNA Mini Extraction kit (Qiagen, Valencia, CA) according to the manufacturer's instructions, except the AL general lysis buffer was substituted for the AVL viral lysis buffer with the addition of carrier RNA (Qiagen, Valencia, CA). .. Of the 100 μl of extracted concentrate, 5 μl was analyzed by use of quantitative PCR (qPCR) for adenovirus ( ) or quantitative reverse transcriptase PCR (qRT-PCR) for enterovirus ( ) and norovirus GII ( ).

    Article Title: Lipid Droplet-Binding Protein TIP47 Regulates Hepatitis C Virus RNA Replication through Interaction with the Viral NS5A Protein
    Article Snippet: 20 ug of carrier RNA (Qiagen) was added to 150 ul of each fraction. .. For the generation of RNA standards, cDNA was generated for a 2-fold serial dilution of in vitro transcribed HCV replicon RNAs using the above protocol.

    Virus Quantification:

    Article Title: Comparison of Filters for Concentrating Microbial Indicators and Pathogens in Lake Water Samples
    Article Snippet: Paragraph title: Enteric virus quantification. ... Viral RNA and DNA were extracted from 400 μl of the final concentrates using a QIAamp DNA Mini Extraction kit (Qiagen, Valencia, CA) according to the manufacturer's instructions, except the AL general lysis buffer was substituted for the AVL viral lysis buffer with the addition of carrier RNA (Qiagen, Valencia, CA).

    In Vitro:

    Article Title: Lipid Droplet-Binding Protein TIP47 Regulates Hepatitis C Virus RNA Replication through Interaction with the Viral NS5A Protein
    Article Snippet: 20 ug of carrier RNA (Qiagen) was added to 150 ul of each fraction. .. RNA was eluted using 35 ul H2 O. cDNA was synthesized using an HCV replicon (Con1, genotype 1b) antisense probe (nt 283-302; 5′-ctttcgcgacccaacactac-3′ ) and AMV reverse transcriptase (Promega) followed by RNase A (Thermo Scientific) digestion.

    Enzyme-linked Immunosorbent Assay:

    Article Title: Initial B-Cell Responses to Transmitted Human Immunodeficiency Virus Type 1: Virion-Binding Immunoglobulin M (IgM) and IgG Antibodies Followed by Plasma Anti-gp41 Antibodies with Ineffective Control of Initial Viremia
    Article Snippet: ELISA plates (NUNC) were coated overnight at 4°C with anti-human IgM or IgG at a concentration of 1 μg/ml diluted in PBS. .. A total of 200 μl of AVL lysis buffer with carrier RNA (Qiagen) was added and shaken for 15 min, and viral RNA in the lysis was extracted by a Qiagen viral mini kit.

    Laser Capture Microdissection:

    Article Title: Expression of the IGF Axis Is Decreased in Local Prostate Cancer but Enhanced after Benign Prostate Epithelial Differentiation and TGF-? Treatment
    Article Snippet: Total working time for the isolation of cells for one RNA isolation was 30 to 40 minutes. .. After LCM the tissues were lysed in 50 μL of PicoPure extraction buffer (Arcturus) supplemented with 50 ng of Poly-A-RNA carrier (Qiagen, Germantown, MD) and stored at −80°C until used for RNA isolation. .. The different cell populations (benign epithelial, benign epithelial–associated stromal, cancer, and -cancer-associated stromal cells for sample set 1 and benign epithelial and cancer cells for sample set 2) were isolated from one slide of every tissue (representative microdissection in ; available at ).

    Oligonucleotide Synthesis:

    Article Title: High-throughput RNA profiling via up-front sample parallelization
    Article Snippet: RNA oligonucleotides comprised of 90 microRNA and 6 control RNA sequences ( ) were synthesized at a 40 nmole scale with 2′-deprotection and purification at the Yale Keck oligonucleotide synthesis core facility. .. The RNAs were dissolved in a buffer containing 10mM Tris (pH 7.6), 0.1 mM EDTA, and 300 ng/mL poly-A carrier RNA (Qiagen) in RNAse-free water.

    Staining:

    Article Title: Expression of the IGF Axis Is Decreased in Local Prostate Cancer but Enhanced after Benign Prostate Epithelial Differentiation and TGF-? Treatment
    Article Snippet: The slides were stained with H & E. Histopathologic analysis, tumor grading, and exact definition of tumor localization and extent were performed by a uropathologist (G.S.). .. After LCM the tissues were lysed in 50 μL of PicoPure extraction buffer (Arcturus) supplemented with 50 ng of Poly-A-RNA carrier (Qiagen, Germantown, MD) and stored at −80°C until used for RNA isolation.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 79
    Qiagen frabin fgd4 expression silencing fgd4 small interfering rna
    Cell type-specific gene ablation reveals that Schwann cells require <t>Frabin/Fgd4</t> for proper myelination. ( A ) Schwann cell- or motor neuron-specific ablation of Fgd4 by Dhh- or Hb9-gene regulatory elements-driven Cre recombinase (Dhh- or Hb9-Cre/ Fgd4 flox/flox animals) results in B , Schwann cell-specific (Dhh-Cre) loss of detectable Frabin/Fgd4 on cryosections of sciatic nerves (white arrows mark Schwann cells, arrowheads mark axons) or ( C ) strongly reduced Frabin/Fgd4 expressed by motor neurons (Hb9-Cre) as shown by western blot analysis of mutant ventral roots lysates compared with wild-type (wt/wt). ( D ) Schwann cell-specific loss of Frabin/Fgd4 (Dhh-Cre) in plantaris nerves of 60-week-old mice or quadriceps and saphenous nerve of 30-week-old mice leads to aberrant myelin formation, similar to that seen in Fgd4 − / − mice (white arrows mark aberrant myelin features). Motor neuron-specific ablation of Frabin/Fgd4 (Hb9-Cre), however, does not result in a detectable pathological phenotype at electron microscopy level in plantaris, quadriceps or saphenous nerves at the corresponding ages. ( E ) Quantification of aberrant myelin features shown in D . Note the similar numbers of fibres with aberrant myelin features (affected fibres) present in DhhCre/ Fgd4 flox/flox mice (Dhh-Cre) compared with Fgd4 − / − mice. Both are significantly increased compared with wild-type mice (wt/wt). The numbers in Hb9Cre/ Fgd4 flox/flox mice (Hb9-Cre), however, were not different from wild-type mice. Total numbers of myelinated fibres were not changed in all genotypes. Three mice were analysed for each genotype, time point and type of nerve. Scale bars = 5 µm; n.s. = not significant. * P > 0.05, ** P
    Frabin Fgd4 Expression Silencing Fgd4 Small Interfering Rna, supplied by Qiagen, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/frabin fgd4 expression silencing fgd4 small interfering rna/product/Qiagen
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    frabin fgd4 expression silencing fgd4 small interfering rna - by Bioz Stars, 2019-10
    79/100 stars
      Buy from Supplier

    99
    Qiagen total rna
    Identification and characterization of FAM133B/CDK6 in J.RT3-T3.5. ( A ) Heatmap depicting rearrangement of CDK6 in J.RT3-T3.5 (Jurkat derivative). ( B ) Discovery of the FAM133B/CDK6 rearrangement by paired-end <t>RNA-seq.</t> The fusion junction was confirmed by <t>RT-PCR</t> (not shown) and Sanger sequencing. ( C ) Gene expression profiling reveals high-level expression of CDK6 in J.RT3-T3.5 compared to other leukemia cell lines. Note that array probes mapped to the portion of CDK6 retained in the fusion. ( D ) Jurkat demonstrates marked sensitivity to the CDK4/6 inhibitor PD0332991 (IC 50 = 0.27 µM). K562, which expresses only wildtype CDK6, is used as a negative control cell line and shows minimal sensitivity to PD0332991 (IC 50 = 5.9 µM).
    Total Rna, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/total rna/product/Qiagen
    Average 99 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    total rna - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    99
    Qiagen allprep dna rna ffpe kit
    MicroRNA expression analysis of matched fresh and <t>FFPE</t> <t>RNA</t> from MCF10A cells using different RNA extraction methods. The upper panel displays a graphic representation of quantitative RT-PCR (Taqman® miRNA assays). Measurements obtain for miR-10a, miR-196b, miR-135b, miR-32a and miR-21 using matched fresh and FFPE RNA from MCF10A cells. MiRNAs were quantified using FFPE RNA extracted with TRIzol (TRI), Qiagen <t>AllPrep</t> <t>DNA/RNA</t> FFPE (QDR), AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB) kits and compared to control RNA extracted from fresh cells with TRIzol (TRI-Fr). Results are represented as ΔδC t (δC t target miRNA - δC t miR-10a (least expressed miRNA)). The lower panels show the comparison of global miRNA quantification obtained between fresh and FFPE RNA samples using the Illumina miRNA platform. Comparisons were performed between triplicate RNA extractions obtained from matched fresh (TRI-Fr1, TRI-Fr2, TRI-Fr3) and FFPE (TRI1-3, QDR1-3, and AMB1-3) cells. The correlation coefficient (r) between matched fresh and FFPE RNAs is displayed in each graph.
    Allprep Dna Rna Ffpe Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/allprep dna rna ffpe kit/product/Qiagen
    Average 99 stars, based on 66 article reviews
    Price from $9.99 to $1999.99
    allprep dna rna ffpe kit - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Cell type-specific gene ablation reveals that Schwann cells require Frabin/Fgd4 for proper myelination. ( A ) Schwann cell- or motor neuron-specific ablation of Fgd4 by Dhh- or Hb9-gene regulatory elements-driven Cre recombinase (Dhh- or Hb9-Cre/ Fgd4 flox/flox animals) results in B , Schwann cell-specific (Dhh-Cre) loss of detectable Frabin/Fgd4 on cryosections of sciatic nerves (white arrows mark Schwann cells, arrowheads mark axons) or ( C ) strongly reduced Frabin/Fgd4 expressed by motor neurons (Hb9-Cre) as shown by western blot analysis of mutant ventral roots lysates compared with wild-type (wt/wt). ( D ) Schwann cell-specific loss of Frabin/Fgd4 (Dhh-Cre) in plantaris nerves of 60-week-old mice or quadriceps and saphenous nerve of 30-week-old mice leads to aberrant myelin formation, similar to that seen in Fgd4 − / − mice (white arrows mark aberrant myelin features). Motor neuron-specific ablation of Frabin/Fgd4 (Hb9-Cre), however, does not result in a detectable pathological phenotype at electron microscopy level in plantaris, quadriceps or saphenous nerves at the corresponding ages. ( E ) Quantification of aberrant myelin features shown in D . Note the similar numbers of fibres with aberrant myelin features (affected fibres) present in DhhCre/ Fgd4 flox/flox mice (Dhh-Cre) compared with Fgd4 − / − mice. Both are significantly increased compared with wild-type mice (wt/wt). The numbers in Hb9Cre/ Fgd4 flox/flox mice (Hb9-Cre), however, were not different from wild-type mice. Total numbers of myelinated fibres were not changed in all genotypes. Three mice were analysed for each genotype, time point and type of nerve. Scale bars = 5 µm; n.s. = not significant. * P > 0.05, ** P

    Journal: Brain

    Article Title: Myelin is dependent on the Charcot-Marie-Tooth Type 4H disease culprit protein FRABIN/FGD4 in Schwann cells

    doi: 10.1093/brain/aws275

    Figure Lengend Snippet: Cell type-specific gene ablation reveals that Schwann cells require Frabin/Fgd4 for proper myelination. ( A ) Schwann cell- or motor neuron-specific ablation of Fgd4 by Dhh- or Hb9-gene regulatory elements-driven Cre recombinase (Dhh- or Hb9-Cre/ Fgd4 flox/flox animals) results in B , Schwann cell-specific (Dhh-Cre) loss of detectable Frabin/Fgd4 on cryosections of sciatic nerves (white arrows mark Schwann cells, arrowheads mark axons) or ( C ) strongly reduced Frabin/Fgd4 expressed by motor neurons (Hb9-Cre) as shown by western blot analysis of mutant ventral roots lysates compared with wild-type (wt/wt). ( D ) Schwann cell-specific loss of Frabin/Fgd4 (Dhh-Cre) in plantaris nerves of 60-week-old mice or quadriceps and saphenous nerve of 30-week-old mice leads to aberrant myelin formation, similar to that seen in Fgd4 − / − mice (white arrows mark aberrant myelin features). Motor neuron-specific ablation of Frabin/Fgd4 (Hb9-Cre), however, does not result in a detectable pathological phenotype at electron microscopy level in plantaris, quadriceps or saphenous nerves at the corresponding ages. ( E ) Quantification of aberrant myelin features shown in D . Note the similar numbers of fibres with aberrant myelin features (affected fibres) present in DhhCre/ Fgd4 flox/flox mice (Dhh-Cre) compared with Fgd4 − / − mice. Both are significantly increased compared with wild-type mice (wt/wt). The numbers in Hb9Cre/ Fgd4 flox/flox mice (Hb9-Cre), however, were not different from wild-type mice. Total numbers of myelinated fibres were not changed in all genotypes. Three mice were analysed for each genotype, time point and type of nerve. Scale bars = 5 µm; n.s. = not significant. * P > 0.05, ** P

    Article Snippet: Frabin/Fgd4 expression silencing: Fgd4 small interfering RNA (SI01512574; Qiagen) with the targeting sequence 5′-CTG AAT GGA GTA AGA AAC GAA-3′.

    Techniques: Western Blot, Mutagenesis, Mouse Assay, Electron Microscopy

    Frabin/Fgd4-deficient mice form aberrant PNS myelin. Fgd4 − / − mice display aberrant myelin features during early steps of myelination ( A–D : post-natal Day 5; sciatic nerve) and in myelin maintenance ( E–G , I and K : 80 weeks old mice; H , J and M–P : 60 weeks old mice; L : 10 weeks old mice; plantaris nerve), including simple myelin outfoldings ( A ), redundant myelin ( B ), complex myelin outfoldings ( E ) and highly complex myelin outfoldings ( C and D ), redundant myelin loops outside ( F ) and protruding into the axon ( G ), degradation of myelin ( I ), signs of demyelination ( K ) and remyelination ( H and J ) and rarely polyaxonal myelination ( L ). Aberrant myelin features tend to be located in the vicinity of nodes of Ranvier and Schmidt–Lanterman incisures ( M , N and P ). ( A–L ) Cross-sections. ( M–P ) Longitudinal sections. Scale bars = 1 µm ( A–L ); 5 µm ( M–P ).

    Journal: Brain

    Article Title: Myelin is dependent on the Charcot-Marie-Tooth Type 4H disease culprit protein FRABIN/FGD4 in Schwann cells

    doi: 10.1093/brain/aws275

    Figure Lengend Snippet: Frabin/Fgd4-deficient mice form aberrant PNS myelin. Fgd4 − / − mice display aberrant myelin features during early steps of myelination ( A–D : post-natal Day 5; sciatic nerve) and in myelin maintenance ( E–G , I and K : 80 weeks old mice; H , J and M–P : 60 weeks old mice; L : 10 weeks old mice; plantaris nerve), including simple myelin outfoldings ( A ), redundant myelin ( B ), complex myelin outfoldings ( E ) and highly complex myelin outfoldings ( C and D ), redundant myelin loops outside ( F ) and protruding into the axon ( G ), degradation of myelin ( I ), signs of demyelination ( K ) and remyelination ( H and J ) and rarely polyaxonal myelination ( L ). Aberrant myelin features tend to be located in the vicinity of nodes of Ranvier and Schmidt–Lanterman incisures ( M , N and P ). ( A–L ) Cross-sections. ( M–P ) Longitudinal sections. Scale bars = 1 µm ( A–L ); 5 µm ( M–P ).

    Article Snippet: Frabin/Fgd4 expression silencing: Fgd4 small interfering RNA (SI01512574; Qiagen) with the targeting sequence 5′-CTG AAT GGA GTA AGA AAC GAA-3′.

    Techniques: Mouse Assay

    Ablation of Frabin/Fgd4 reduces activation of the RhoGTPase Cdc42 in peripheral nerves in vivo . ( A and B ) Western blot analyses demonstrating that total and active levels of AKT, ErbB2 receptor and JNK, and total levels of MBP and Dlg1, are not changed in sciatic nerve of Fgd4 − / − mice compared with wild-type (wt/wt) mice at the age of 10 weeks. ( C and D ) Active, but not total levels of Cdc42 are significantly reduced in sciatic nerves of adult Fgd4 − / − mice compared with age-matched wild-type mice. Tissues from four wild-type and Fgd4 − / − mice were analysed. *** P

    Journal: Brain

    Article Title: Myelin is dependent on the Charcot-Marie-Tooth Type 4H disease culprit protein FRABIN/FGD4 in Schwann cells

    doi: 10.1093/brain/aws275

    Figure Lengend Snippet: Ablation of Frabin/Fgd4 reduces activation of the RhoGTPase Cdc42 in peripheral nerves in vivo . ( A and B ) Western blot analyses demonstrating that total and active levels of AKT, ErbB2 receptor and JNK, and total levels of MBP and Dlg1, are not changed in sciatic nerve of Fgd4 − / − mice compared with wild-type (wt/wt) mice at the age of 10 weeks. ( C and D ) Active, but not total levels of Cdc42 are significantly reduced in sciatic nerves of adult Fgd4 − / − mice compared with age-matched wild-type mice. Tissues from four wild-type and Fgd4 − / − mice were analysed. *** P

    Article Snippet: Frabin/Fgd4 expression silencing: Fgd4 small interfering RNA (SI01512574; Qiagen) with the targeting sequence 5′-CTG AAT GGA GTA AGA AAC GAA-3′.

    Techniques: Activation Assay, In Vivo, Western Blot, Mouse Assay

    Inducible gene ablation reveals that loss of Cdc42 in adult myelinating Schwann cells causes histopathological aberrations phenocopying loss of Frabin/Fgd4. ( A ) Tamoxifen-mediated induction of Cdc42 ablation in 10-week-old Cdc42 flox/flox mice through activation of Plp promotor-driven Cre recombinase (Plp-CreERT2) results in ( B ) strongly reduced Cdc42 protein as shown by western blot analysis of sciatic nerve lysates obtained 7 months post-tamoxifen injection. ( C ) Aberrant myelin formations, including outfoldings and redundant myelin, in sciatic nerves of 10 months old PlpCreERT2/ Cdc42 flox/flox (Cdc42 mutant) mice (electron microscopy cross-sections). ( D ) Representative FIB-SEM-derived longitudinal section of Cdc42 mutant sciatic nerves prepared as in C (see also Supplementary Videos 1 and 2 ) showing myelin outfoldings in the vicinity of nodes of Ranvier. Scale bars = 5 µm. White arrows indicate fibres with aberrant myelin features.

    Journal: Brain

    Article Title: Myelin is dependent on the Charcot-Marie-Tooth Type 4H disease culprit protein FRABIN/FGD4 in Schwann cells

    doi: 10.1093/brain/aws275

    Figure Lengend Snippet: Inducible gene ablation reveals that loss of Cdc42 in adult myelinating Schwann cells causes histopathological aberrations phenocopying loss of Frabin/Fgd4. ( A ) Tamoxifen-mediated induction of Cdc42 ablation in 10-week-old Cdc42 flox/flox mice through activation of Plp promotor-driven Cre recombinase (Plp-CreERT2) results in ( B ) strongly reduced Cdc42 protein as shown by western blot analysis of sciatic nerve lysates obtained 7 months post-tamoxifen injection. ( C ) Aberrant myelin formations, including outfoldings and redundant myelin, in sciatic nerves of 10 months old PlpCreERT2/ Cdc42 flox/flox (Cdc42 mutant) mice (electron microscopy cross-sections). ( D ) Representative FIB-SEM-derived longitudinal section of Cdc42 mutant sciatic nerves prepared as in C (see also Supplementary Videos 1 and 2 ) showing myelin outfoldings in the vicinity of nodes of Ranvier. Scale bars = 5 µm. White arrows indicate fibres with aberrant myelin features.

    Article Snippet: Frabin/Fgd4 expression silencing: Fgd4 small interfering RNA (SI01512574; Qiagen) with the targeting sequence 5′-CTG AAT GGA GTA AGA AAC GAA-3′.

    Techniques: Mouse Assay, Activation Assay, Plasmid Purification, Western Blot, Injection, Mutagenesis, Electron Microscopy, Derivative Assay

    Inducible Schwann cell-specific gene ablation reveals that myelin maintenance depends on Frabin/Fgd4. ( A ) Tamoxifen-mediated induction of Frabin/Fgd4 ablation in 10-week-old Fgd4 flox/flox mice through activation of Plp promotor-driven Cre recombinase (Plp-CreERT2) results in ( B ) Schwann cell-specific loss of Frabin/Fgd4 protein in peripheral nerves of adult mice, shown on cryosections of sciatic nerve, 4 months after tamoxifen injections (arrow: Schwann cell; arrowhead: axon). ( C ) Aberrant myelin formation in plantaris nerves of 30-week-old Plp-CreERT2/ Fgd4 flox/flox (Plp-CreERT2) mice, tamoxifen-treated at 10 weeks of age as control mice, compared with age-matched Fgd4 − / − and wild-type (wt/wt) mice. ( D ) Quantification of myelinated fibres displaying aberrant myelin features (affected fibres) of identically obtained nerves as shown in C , revealing significantly increased numbers of affected fibres in Plp-CreERT2/ Fgd4 flox/flox mice (Plp-CreERT2) compared with wild-type or tamoxifen-injected control mice. Comparison of Plp-CreERT2 with Fgd4 − / − mice shows only a slight reduction in affected fibres. Total numbers of myelinated fibres were unchanged between the groups. Three mice were analysed for each group in all experiments. Scale bars = 5 µm. White arrows indicate affected fibres. ** P

    Journal: Brain

    Article Title: Myelin is dependent on the Charcot-Marie-Tooth Type 4H disease culprit protein FRABIN/FGD4 in Schwann cells

    doi: 10.1093/brain/aws275

    Figure Lengend Snippet: Inducible Schwann cell-specific gene ablation reveals that myelin maintenance depends on Frabin/Fgd4. ( A ) Tamoxifen-mediated induction of Frabin/Fgd4 ablation in 10-week-old Fgd4 flox/flox mice through activation of Plp promotor-driven Cre recombinase (Plp-CreERT2) results in ( B ) Schwann cell-specific loss of Frabin/Fgd4 protein in peripheral nerves of adult mice, shown on cryosections of sciatic nerve, 4 months after tamoxifen injections (arrow: Schwann cell; arrowhead: axon). ( C ) Aberrant myelin formation in plantaris nerves of 30-week-old Plp-CreERT2/ Fgd4 flox/flox (Plp-CreERT2) mice, tamoxifen-treated at 10 weeks of age as control mice, compared with age-matched Fgd4 − / − and wild-type (wt/wt) mice. ( D ) Quantification of myelinated fibres displaying aberrant myelin features (affected fibres) of identically obtained nerves as shown in C , revealing significantly increased numbers of affected fibres in Plp-CreERT2/ Fgd4 flox/flox mice (Plp-CreERT2) compared with wild-type or tamoxifen-injected control mice. Comparison of Plp-CreERT2 with Fgd4 − / − mice shows only a slight reduction in affected fibres. Total numbers of myelinated fibres were unchanged between the groups. Three mice were analysed for each group in all experiments. Scale bars = 5 µm. White arrows indicate affected fibres. ** P

    Article Snippet: Frabin/Fgd4 expression silencing: Fgd4 small interfering RNA (SI01512574; Qiagen) with the targeting sequence 5′-CTG AAT GGA GTA AGA AAC GAA-3′.

    Techniques: Mouse Assay, Activation Assay, Plasmid Purification, Injection

    Knock-down of Frabin/Fgd4 leads to reduced activation of the RhoGTPase Cdc42 and impaired endocytosis. ( A and B ) Active, but not total levels of Cdc42 are significantly reduced in RT4 cells transfected with small interfering RNA (siRNA) targeting Frabin/Fgd4 in comparison with control-transfected cells. Four independent experiments were quantified. ( C ) Frabin/Fgd4-silenced RT4 cells qualitatively display reduced transferrin uptake ability compared with control-transfected cells. ( D ) Fluorescence activated cell sorting quantifications of Frabin/Fgd4-silenced RT4 cells reveal significant reductions in levels of incorporated transferrin. Transferrin fluorescence levels in cells transfected with small interfering RNA ( upper panel) or short hairpin RNA ( lower panel) targeting Frabin/Fgd4 were compared with transferrin fluorescence levels in cells transfected with control small interfering RNA or short hairpin RNA. Three independent experiments were quantified with small interfering RNA-transfected cells and four independent experiments with short hairpin RNA-transfected cells. Scale bars = 10 µm; ** P

    Journal: Brain

    Article Title: Myelin is dependent on the Charcot-Marie-Tooth Type 4H disease culprit protein FRABIN/FGD4 in Schwann cells

    doi: 10.1093/brain/aws275

    Figure Lengend Snippet: Knock-down of Frabin/Fgd4 leads to reduced activation of the RhoGTPase Cdc42 and impaired endocytosis. ( A and B ) Active, but not total levels of Cdc42 are significantly reduced in RT4 cells transfected with small interfering RNA (siRNA) targeting Frabin/Fgd4 in comparison with control-transfected cells. Four independent experiments were quantified. ( C ) Frabin/Fgd4-silenced RT4 cells qualitatively display reduced transferrin uptake ability compared with control-transfected cells. ( D ) Fluorescence activated cell sorting quantifications of Frabin/Fgd4-silenced RT4 cells reveal significant reductions in levels of incorporated transferrin. Transferrin fluorescence levels in cells transfected with small interfering RNA ( upper panel) or short hairpin RNA ( lower panel) targeting Frabin/Fgd4 were compared with transferrin fluorescence levels in cells transfected with control small interfering RNA or short hairpin RNA. Three independent experiments were quantified with small interfering RNA-transfected cells and four independent experiments with short hairpin RNA-transfected cells. Scale bars = 10 µm; ** P

    Article Snippet: Frabin/Fgd4 expression silencing: Fgd4 small interfering RNA (SI01512574; Qiagen) with the targeting sequence 5′-CTG AAT GGA GTA AGA AAC GAA-3′.

    Techniques: Activation Assay, Transfection, Small Interfering RNA, Fluorescence, FACS, shRNA

    Aberrant development of PNS myelination in Fgd4 − / − mice. ( A ) Aberrant myelin structures of post-natal Day 5 (P5) sciatic nerves were categorized in four sets (simple, complex, very complex outfoldings and infoldings) and quantified at electron microscopy level. Very complex outfoldings were significantly increased in Fgd4 − / − animals. ( B ) Overall number of fibres showing aberrant myelin features was also increased in Frabin/Fgd4-deficient mice. ( C ) Total number of myelinated fibres was not significantly altered between Fgd4 − / − and wild-type (wt/wt) animals. Three mice per genotype were analysed. Scale bars = 1 µm. * P

    Journal: Brain

    Article Title: Myelin is dependent on the Charcot-Marie-Tooth Type 4H disease culprit protein FRABIN/FGD4 in Schwann cells

    doi: 10.1093/brain/aws275

    Figure Lengend Snippet: Aberrant development of PNS myelination in Fgd4 − / − mice. ( A ) Aberrant myelin structures of post-natal Day 5 (P5) sciatic nerves were categorized in four sets (simple, complex, very complex outfoldings and infoldings) and quantified at electron microscopy level. Very complex outfoldings were significantly increased in Fgd4 − / − animals. ( B ) Overall number of fibres showing aberrant myelin features was also increased in Frabin/Fgd4-deficient mice. ( C ) Total number of myelinated fibres was not significantly altered between Fgd4 − / − and wild-type (wt/wt) animals. Three mice per genotype were analysed. Scale bars = 1 µm. * P

    Article Snippet: Frabin/Fgd4 expression silencing: Fgd4 small interfering RNA (SI01512574; Qiagen) with the targeting sequence 5′-CTG AAT GGA GTA AGA AAC GAA-3′.

    Techniques: Mouse Assay, Electron Microscopy

    Loss of Frabin/Fgd4 leads to electrophysiological characteristics of demyelinating peripheral neuropathies. ( A ) Ablation of exon 4 in the Fgd4 locus generates a premature stop codon in exon 5 because of a frame shift (filled triangles = introduced loxP sites; START = translational start codon; STOP = conventional translational stop codon; STOP (bold) = premature translational stop codon generated after Fgd4 exon 4 ablation), resulting in B , loss of Frabin/Fgd4 protein (western blot; asterisk: unspecific signal). ( C and D ) At 60 weeks, Fgd4 − / − mice show longer distal latency, disperse compound muscle action potentials with mild reduction in amplitude, longer F-wave latency and reduced nerve conduction velocity in sciatic nerve compared with wild-type mice; in C , a representative original recording is shown. Arrowhead indicates stimulus artefact; open arrow indicates onset of compound muscle action potential (distal latency); filled arrow indicates onset of F-wave. Data represent the mean ± standard error of the mean. Wild-type mice, n = 7; Fgd4 − / − mice, n = 10. P -values in D : * P

    Journal: Brain

    Article Title: Myelin is dependent on the Charcot-Marie-Tooth Type 4H disease culprit protein FRABIN/FGD4 in Schwann cells

    doi: 10.1093/brain/aws275

    Figure Lengend Snippet: Loss of Frabin/Fgd4 leads to electrophysiological characteristics of demyelinating peripheral neuropathies. ( A ) Ablation of exon 4 in the Fgd4 locus generates a premature stop codon in exon 5 because of a frame shift (filled triangles = introduced loxP sites; START = translational start codon; STOP = conventional translational stop codon; STOP (bold) = premature translational stop codon generated after Fgd4 exon 4 ablation), resulting in B , loss of Frabin/Fgd4 protein (western blot; asterisk: unspecific signal). ( C and D ) At 60 weeks, Fgd4 − / − mice show longer distal latency, disperse compound muscle action potentials with mild reduction in amplitude, longer F-wave latency and reduced nerve conduction velocity in sciatic nerve compared with wild-type mice; in C , a representative original recording is shown. Arrowhead indicates stimulus artefact; open arrow indicates onset of compound muscle action potential (distal latency); filled arrow indicates onset of F-wave. Data represent the mean ± standard error of the mean. Wild-type mice, n = 7; Fgd4 − / − mice, n = 10. P -values in D : * P

    Article Snippet: Frabin/Fgd4 expression silencing: Fgd4 small interfering RNA (SI01512574; Qiagen) with the targeting sequence 5′-CTG AAT GGA GTA AGA AAC GAA-3′.

    Techniques: Generated, Western Blot, Mouse Assay

    Identification and characterization of FAM133B/CDK6 in J.RT3-T3.5. ( A ) Heatmap depicting rearrangement of CDK6 in J.RT3-T3.5 (Jurkat derivative). ( B ) Discovery of the FAM133B/CDK6 rearrangement by paired-end RNA-seq. The fusion junction was confirmed by RT-PCR (not shown) and Sanger sequencing. ( C ) Gene expression profiling reveals high-level expression of CDK6 in J.RT3-T3.5 compared to other leukemia cell lines. Note that array probes mapped to the portion of CDK6 retained in the fusion. ( D ) Jurkat demonstrates marked sensitivity to the CDK4/6 inhibitor PD0332991 (IC 50 = 0.27 µM). K562, which expresses only wildtype CDK6, is used as a negative control cell line and shows minimal sensitivity to PD0332991 (IC 50 = 5.9 µM).

    Journal: PLoS Genetics

    Article Title: Breakpoint Analysis of Transcriptional and Genomic Profiles Uncovers Novel Gene Fusions Spanning Multiple Human Cancer Types

    doi: 10.1371/journal.pgen.1003464

    Figure Lengend Snippet: Identification and characterization of FAM133B/CDK6 in J.RT3-T3.5. ( A ) Heatmap depicting rearrangement of CDK6 in J.RT3-T3.5 (Jurkat derivative). ( B ) Discovery of the FAM133B/CDK6 rearrangement by paired-end RNA-seq. The fusion junction was confirmed by RT-PCR (not shown) and Sanger sequencing. ( C ) Gene expression profiling reveals high-level expression of CDK6 in J.RT3-T3.5 compared to other leukemia cell lines. Note that array probes mapped to the portion of CDK6 retained in the fusion. ( D ) Jurkat demonstrates marked sensitivity to the CDK4/6 inhibitor PD0332991 (IC 50 = 0.27 µM). K562, which expresses only wildtype CDK6, is used as a negative control cell line and shows minimal sensitivity to PD0332991 (IC 50 = 5.9 µM).

    Article Snippet: For validation of the EGFRvIII gene product , RT-PCR was performed using 200 ng of total RNA and the One-Step RT-PCR kit (Qiagen).

    Techniques: RNA Sequencing Assay, Reverse Transcription Polymerase Chain Reaction, Sequencing, Expressing, Negative Control

    DBA discovery of recurrent rearrangements of CLTC and VMP1 across diverse cancer types. ( A ) Heatmap depicting focal deletions between CLTC and VMP1 in the breast cancer cell lines BT-549 and HCC1954. ( B ) Discovery of the recurrent CLTC/VMP1 rearrangement in BT-549 ( left panel) and HCC1954 ( right panel) by paired-end RNA-seq. ( C ) RT-PCR verification of CLTC/VMP1 fusion in BT-549 and HCC1954. ( D ) Heatmap depicting focal deletions disrupting CLTC , PTRH2 and/or VMP1 in various cancer types (see legend). ( E ) A renal cell carcinoma line, RXF393, was also profiled by exon microarray where an expression breakpoint was evident within CLTC . *** P

    Journal: PLoS Genetics

    Article Title: Breakpoint Analysis of Transcriptional and Genomic Profiles Uncovers Novel Gene Fusions Spanning Multiple Human Cancer Types

    doi: 10.1371/journal.pgen.1003464

    Figure Lengend Snippet: DBA discovery of recurrent rearrangements of CLTC and VMP1 across diverse cancer types. ( A ) Heatmap depicting focal deletions between CLTC and VMP1 in the breast cancer cell lines BT-549 and HCC1954. ( B ) Discovery of the recurrent CLTC/VMP1 rearrangement in BT-549 ( left panel) and HCC1954 ( right panel) by paired-end RNA-seq. ( C ) RT-PCR verification of CLTC/VMP1 fusion in BT-549 and HCC1954. ( D ) Heatmap depicting focal deletions disrupting CLTC , PTRH2 and/or VMP1 in various cancer types (see legend). ( E ) A renal cell carcinoma line, RXF393, was also profiled by exon microarray where an expression breakpoint was evident within CLTC . *** P

    Article Snippet: For validation of the EGFRvIII gene product , RT-PCR was performed using 200 ng of total RNA and the One-Step RT-PCR kit (Qiagen).

    Techniques: RNA Sequencing Assay, Reverse Transcription Polymerase Chain Reaction, Microarray, Expressing

    Discovery of new cell line models for the known rearrangements, EGFRvIII and FIP1L1/PDGFRA . ( A ) Heatmap depicting genomic breakpoints within EGFR in the glioblastoma cell lines, CAS-1 and DKMG. ( B ) Identification of EGFRvIII in DKMG cells by paired-end RNA-seq. Paired-end reads supporting the rearrangement are depicted. ( C ) Verification of EGFRvIII expression by RT-PCR (top panel) and Western blotting (bottom panel) in DKMG. RT-PCR was done using primers flanking the exon 1/exon 8 junction of EGFRvIII , and Western blotting was done using an antibody specific to the EGFRvIII isoform. Control samples include U87 glioblastoma cells without EGFR rearrangement, U87-vIII cells engineered to express exogenous EGFRvIII , and A431 epidermoid carcinoma cells with EGFR amplification. ( D ) RBA identification of expression-level breakpoint within PDGFRA in SUPT13 T-ALL cells. *** P

    Journal: PLoS Genetics

    Article Title: Breakpoint Analysis of Transcriptional and Genomic Profiles Uncovers Novel Gene Fusions Spanning Multiple Human Cancer Types

    doi: 10.1371/journal.pgen.1003464

    Figure Lengend Snippet: Discovery of new cell line models for the known rearrangements, EGFRvIII and FIP1L1/PDGFRA . ( A ) Heatmap depicting genomic breakpoints within EGFR in the glioblastoma cell lines, CAS-1 and DKMG. ( B ) Identification of EGFRvIII in DKMG cells by paired-end RNA-seq. Paired-end reads supporting the rearrangement are depicted. ( C ) Verification of EGFRvIII expression by RT-PCR (top panel) and Western blotting (bottom panel) in DKMG. RT-PCR was done using primers flanking the exon 1/exon 8 junction of EGFRvIII , and Western blotting was done using an antibody specific to the EGFRvIII isoform. Control samples include U87 glioblastoma cells without EGFR rearrangement, U87-vIII cells engineered to express exogenous EGFRvIII , and A431 epidermoid carcinoma cells with EGFR amplification. ( D ) RBA identification of expression-level breakpoint within PDGFRA in SUPT13 T-ALL cells. *** P

    Article Snippet: For validation of the EGFRvIII gene product , RT-PCR was performed using 200 ng of total RNA and the One-Step RT-PCR kit (Qiagen).

    Techniques: RNA Sequencing Assay, Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot, Amplification

    Discovery of APIP/SLC1A2 in colon cancer. ( A ) Array CGH heatmap displaying genomic breakpoints disrupting SLC1A2 in the SNU-C1 colon cancer cell line and the SNU-16 gastric cancer cell line. SNU-16 is known to harbor CD44/SLC1A2 and its array CGH profile is depicted for comparison. Unsmoothed log 2 ratios are displayed. ( B ) Paired-end RNA seq uncovers APIP/SLC1A2 in SNU-C1. A subset of paired-end reads mapping to APIP/SLC1A2 as well as the gene fusion structure are displayed (left panel). The structure of the known gastric cancer gene fusion CD44/SLC1A2 is depicted for comparison (right panel). An internal start codon within exon 2 of SLC1A2 is predicted to initiate translation in both rearrangements. Inset : experimental validation of APIP/SLC1A2 by RT-PCR with primers flanking the gene fusion junction. ( C , D ) Gene expression profiling depicts high-level expression of APIP in normal colon ( C ) and overexpression of SLC1A2 in SNU-C1 ( D ). Mean-centered gene expression ratios are depicted by a log 2 pseudocolor scale and ranked in descending order from left to right.

    Journal: PLoS Genetics

    Article Title: Breakpoint Analysis of Transcriptional and Genomic Profiles Uncovers Novel Gene Fusions Spanning Multiple Human Cancer Types

    doi: 10.1371/journal.pgen.1003464

    Figure Lengend Snippet: Discovery of APIP/SLC1A2 in colon cancer. ( A ) Array CGH heatmap displaying genomic breakpoints disrupting SLC1A2 in the SNU-C1 colon cancer cell line and the SNU-16 gastric cancer cell line. SNU-16 is known to harbor CD44/SLC1A2 and its array CGH profile is depicted for comparison. Unsmoothed log 2 ratios are displayed. ( B ) Paired-end RNA seq uncovers APIP/SLC1A2 in SNU-C1. A subset of paired-end reads mapping to APIP/SLC1A2 as well as the gene fusion structure are displayed (left panel). The structure of the known gastric cancer gene fusion CD44/SLC1A2 is depicted for comparison (right panel). An internal start codon within exon 2 of SLC1A2 is predicted to initiate translation in both rearrangements. Inset : experimental validation of APIP/SLC1A2 by RT-PCR with primers flanking the gene fusion junction. ( C , D ) Gene expression profiling depicts high-level expression of APIP in normal colon ( C ) and overexpression of SLC1A2 in SNU-C1 ( D ). Mean-centered gene expression ratios are depicted by a log 2 pseudocolor scale and ranked in descending order from left to right.

    Article Snippet: For validation of the EGFRvIII gene product , RT-PCR was performed using 200 ng of total RNA and the One-Step RT-PCR kit (Qiagen).

    Techniques: RNA Sequencing Assay, Reverse Transcription Polymerase Chain Reaction, Expressing, Over Expression

    Discovery and characterization of EWSR1/CREM in melanoma. ( A ) Array CGH heatmap displaying intragenic EWSR1 breakpoints identified in the SH-4 and CHL-1 melanoma cell lines. ( B ) Paired-end RNA-seq identification of EWSR1/CREM in CHL-1. Paired-end reads supporting the rearrangement are depicted along with the predicted gene fusion structure. CREM contributes a basic leucine zipper motif (ZIP), while EWSR1 contributes the EWS Activation Domain (EAD). ( C ) RT-PCR verification of EWSR1/CREM in CHL-1. ( D ) Quantitative RT-PCR using primers flanking the gene fusion junction verifies EWSR1/CREM knockdown following transfection of an siRNA pool targeting the 3′ end of CREM . ( E , F , G ) Transfection of CHL-1 with CREM -targeting siRNA pool results in ( E ) decreased cell proliferation, ( F ) decreased invasion, and ( G ) a higher fraction of senescent cells, compared to non-targeting control (NTC). ** P

    Journal: PLoS Genetics

    Article Title: Breakpoint Analysis of Transcriptional and Genomic Profiles Uncovers Novel Gene Fusions Spanning Multiple Human Cancer Types

    doi: 10.1371/journal.pgen.1003464

    Figure Lengend Snippet: Discovery and characterization of EWSR1/CREM in melanoma. ( A ) Array CGH heatmap displaying intragenic EWSR1 breakpoints identified in the SH-4 and CHL-1 melanoma cell lines. ( B ) Paired-end RNA-seq identification of EWSR1/CREM in CHL-1. Paired-end reads supporting the rearrangement are depicted along with the predicted gene fusion structure. CREM contributes a basic leucine zipper motif (ZIP), while EWSR1 contributes the EWS Activation Domain (EAD). ( C ) RT-PCR verification of EWSR1/CREM in CHL-1. ( D ) Quantitative RT-PCR using primers flanking the gene fusion junction verifies EWSR1/CREM knockdown following transfection of an siRNA pool targeting the 3′ end of CREM . ( E , F , G ) Transfection of CHL-1 with CREM -targeting siRNA pool results in ( E ) decreased cell proliferation, ( F ) decreased invasion, and ( G ) a higher fraction of senescent cells, compared to non-targeting control (NTC). ** P

    Article Snippet: For validation of the EGFRvIII gene product , RT-PCR was performed using 200 ng of total RNA and the One-Step RT-PCR kit (Qiagen).

    Techniques: RNA Sequencing Assay, Activation Assay, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Transfection

    Identification and characterization of novel RAF1 gene fusions in pancreatic cancer and anaplastic astrocytoma. ( A ) Array CGH heatmaps displaying intragenic RAF1 genomic breakpoints identified in the PL5 pancreatic cancer cell line ( left panel ) and the D-538MG anaplastic astrocytoma cell line ( right panel ). Unsmoothed log 2 ratios are displayed. ( B ) Identification of ATG7/RAF1 (left) and BCL6/RAF1 (right) in PL5 and D-538MG cells, respectively, by paired-end RNA-seq. A subset of the paired-end reads supporting each gene fusion is displayed. Both gene fusions are in-frame and the RAF1 serine threonine kinase domain (STK) is retained in both fusions. ( C ) Experimental validation of gene fusions by RT-PCR, using primers flanking the respective gene fusion junction. ( D ) Western blotting verifies knockdown of ATG7/RAF1 in PL5 following transfection of a RAF1 -targeting siRNA pool. ATG7/RAF1 protein levels were monitored using an anti- RAF1 antibody, with anti- GAPDH providing a loading control. ( E ) Decreased cell proliferation and ( F ) invasion rates of PL5 following transfection of a RAF1 -targeting siRNA pool, compared to transfection of a non-targeting control (NTC) siRNA pool. ** P

    Journal: PLoS Genetics

    Article Title: Breakpoint Analysis of Transcriptional and Genomic Profiles Uncovers Novel Gene Fusions Spanning Multiple Human Cancer Types

    doi: 10.1371/journal.pgen.1003464

    Figure Lengend Snippet: Identification and characterization of novel RAF1 gene fusions in pancreatic cancer and anaplastic astrocytoma. ( A ) Array CGH heatmaps displaying intragenic RAF1 genomic breakpoints identified in the PL5 pancreatic cancer cell line ( left panel ) and the D-538MG anaplastic astrocytoma cell line ( right panel ). Unsmoothed log 2 ratios are displayed. ( B ) Identification of ATG7/RAF1 (left) and BCL6/RAF1 (right) in PL5 and D-538MG cells, respectively, by paired-end RNA-seq. A subset of the paired-end reads supporting each gene fusion is displayed. Both gene fusions are in-frame and the RAF1 serine threonine kinase domain (STK) is retained in both fusions. ( C ) Experimental validation of gene fusions by RT-PCR, using primers flanking the respective gene fusion junction. ( D ) Western blotting verifies knockdown of ATG7/RAF1 in PL5 following transfection of a RAF1 -targeting siRNA pool. ATG7/RAF1 protein levels were monitored using an anti- RAF1 antibody, with anti- GAPDH providing a loading control. ( E ) Decreased cell proliferation and ( F ) invasion rates of PL5 following transfection of a RAF1 -targeting siRNA pool, compared to transfection of a non-targeting control (NTC) siRNA pool. ** P

    Article Snippet: For validation of the EGFRvIII gene product , RT-PCR was performed using 200 ng of total RNA and the One-Step RT-PCR kit (Qiagen).

    Techniques: RNA Sequencing Assay, Reverse Transcription Polymerase Chain Reaction, Western Blot, Transfection

    MicroRNA expression analysis of matched fresh and FFPE RNA from MCF10A cells using different RNA extraction methods. The upper panel displays a graphic representation of quantitative RT-PCR (Taqman® miRNA assays). Measurements obtain for miR-10a, miR-196b, miR-135b, miR-32a and miR-21 using matched fresh and FFPE RNA from MCF10A cells. MiRNAs were quantified using FFPE RNA extracted with TRIzol (TRI), Qiagen AllPrep DNA/RNA FFPE (QDR), AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB) kits and compared to control RNA extracted from fresh cells with TRIzol (TRI-Fr). Results are represented as ΔδC t (δC t target miRNA - δC t miR-10a (least expressed miRNA)). The lower panels show the comparison of global miRNA quantification obtained between fresh and FFPE RNA samples using the Illumina miRNA platform. Comparisons were performed between triplicate RNA extractions obtained from matched fresh (TRI-Fr1, TRI-Fr2, TRI-Fr3) and FFPE (TRI1-3, QDR1-3, and AMB1-3) cells. The correlation coefficient (r) between matched fresh and FFPE RNAs is displayed in each graph.

    Journal: PLoS ONE

    Article Title: Effective DNA/RNA Co-Extraction for Analysis of MicroRNAs, mRNAs, and Genomic DNA from Formalin-Fixed Paraffin-Embedded Specimens

    doi: 10.1371/journal.pone.0034683

    Figure Lengend Snippet: MicroRNA expression analysis of matched fresh and FFPE RNA from MCF10A cells using different RNA extraction methods. The upper panel displays a graphic representation of quantitative RT-PCR (Taqman® miRNA assays). Measurements obtain for miR-10a, miR-196b, miR-135b, miR-32a and miR-21 using matched fresh and FFPE RNA from MCF10A cells. MiRNAs were quantified using FFPE RNA extracted with TRIzol (TRI), Qiagen AllPrep DNA/RNA FFPE (QDR), AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB) kits and compared to control RNA extracted from fresh cells with TRIzol (TRI-Fr). Results are represented as ΔδC t (δC t target miRNA - δC t miR-10a (least expressed miRNA)). The lower panels show the comparison of global miRNA quantification obtained between fresh and FFPE RNA samples using the Illumina miRNA platform. Comparisons were performed between triplicate RNA extractions obtained from matched fresh (TRI-Fr1, TRI-Fr2, TRI-Fr3) and FFPE (TRI1-3, QDR1-3, and AMB1-3) cells. The correlation coefficient (r) between matched fresh and FFPE RNAs is displayed in each graph.

    Article Snippet: For co-extraction of FFPE-DNA and -RNA we used the Qiagen AllPrep DNA/RNA FFPE kit following manufacturer's instructions.

    Techniques: Expressing, Formalin-fixed Paraffin-Embedded, RNA Extraction, Quantitative RT-PCR, Isolation

    Summary of sequential recovery of DNA and RNA from MCF10A Fresh and FFPE samples using different extraction methods. (A) Schematic representation of cell culture and DNA/RNA extraction methods used with matched fresh and 1 month-old formalin-fixed paraffin-embedded (FFPE) human mammary epithelial MCF10A cells. FFPE DNA and RNA extractions (QD, TRI, QDR, AMB) were performed in triplicate using three 10 µm sections for each replicate. (B) Analysis of RNA extracted from matched fresh and FFPE MCF10A cells. Total RNA extracted from fresh cells using TRIzol (TRI-Fr; Lane 2), and total RNA extracted from FFPE cells using TRIzol (TRI; lane 3), Qiagen QIAamp DNA/RNA extraction kit (QDR; lane 4), and AMBion RecoverAll™ Total Nucleic Acid Isolation kit (AMB; lane 5) was analyzed and quantified using an Agilent 2100 Bioanalyzer 6000 Nanochip (size ladder in lane 1). The bar graph placed above the Bioanalyzer image displays total amounts of RNA recovered from three consecutive 10 µm sections, in triplicate experiments, using the three different methods (TRI, QDR, AMB). (C) Analysis of genomic DNA extracted from matched fresh and FFPE MCF10A cells. DNA was extracted from fresh cells using a phenol/chloroform based method (PC-Fr; lane 2), and TRIzol (TRI-Fr lane 3); and from FFPE cells using Qiagen QIAamp DNA FFPE kit (QD; lane 4), TRIzol DNA/RNA extraction method (TRI; lane 5), Qiagen AllPrep DNA/RNA FFPE kit (QDR; lane 6), and AMBion RecoverAll™ Total Nucleic Acid Isolation kit (AMB; lane 7) was analyzed on a 1% agarose gel (size ladder in lane 1). The bar graph placed above the agarose gel displays total amounts of DNA recovered alone (QD), simultaneously with RNA (TRI, QDR), or separately from RNA (AMB), using three consecutive 10 µm sections, in triplicate experiments for each method.

    Journal: PLoS ONE

    Article Title: Effective DNA/RNA Co-Extraction for Analysis of MicroRNAs, mRNAs, and Genomic DNA from Formalin-Fixed Paraffin-Embedded Specimens

    doi: 10.1371/journal.pone.0034683

    Figure Lengend Snippet: Summary of sequential recovery of DNA and RNA from MCF10A Fresh and FFPE samples using different extraction methods. (A) Schematic representation of cell culture and DNA/RNA extraction methods used with matched fresh and 1 month-old formalin-fixed paraffin-embedded (FFPE) human mammary epithelial MCF10A cells. FFPE DNA and RNA extractions (QD, TRI, QDR, AMB) were performed in triplicate using three 10 µm sections for each replicate. (B) Analysis of RNA extracted from matched fresh and FFPE MCF10A cells. Total RNA extracted from fresh cells using TRIzol (TRI-Fr; Lane 2), and total RNA extracted from FFPE cells using TRIzol (TRI; lane 3), Qiagen QIAamp DNA/RNA extraction kit (QDR; lane 4), and AMBion RecoverAll™ Total Nucleic Acid Isolation kit (AMB; lane 5) was analyzed and quantified using an Agilent 2100 Bioanalyzer 6000 Nanochip (size ladder in lane 1). The bar graph placed above the Bioanalyzer image displays total amounts of RNA recovered from three consecutive 10 µm sections, in triplicate experiments, using the three different methods (TRI, QDR, AMB). (C) Analysis of genomic DNA extracted from matched fresh and FFPE MCF10A cells. DNA was extracted from fresh cells using a phenol/chloroform based method (PC-Fr; lane 2), and TRIzol (TRI-Fr lane 3); and from FFPE cells using Qiagen QIAamp DNA FFPE kit (QD; lane 4), TRIzol DNA/RNA extraction method (TRI; lane 5), Qiagen AllPrep DNA/RNA FFPE kit (QDR; lane 6), and AMBion RecoverAll™ Total Nucleic Acid Isolation kit (AMB; lane 7) was analyzed on a 1% agarose gel (size ladder in lane 1). The bar graph placed above the agarose gel displays total amounts of DNA recovered alone (QD), simultaneously with RNA (TRI, QDR), or separately from RNA (AMB), using three consecutive 10 µm sections, in triplicate experiments for each method.

    Article Snippet: For co-extraction of FFPE-DNA and -RNA we used the Qiagen AllPrep DNA/RNA FFPE kit following manufacturer's instructions.

    Techniques: Formalin-fixed Paraffin-Embedded, Cell Culture, RNA Extraction, Isolation, Agarose Gel Electrophoresis

    DNA/RNA extractions using archived human specimens. Four different methods were tested on seven different archived tissues: (A) Qiagen QIAamp DNA FFPE kit for DNA (QD), (B) TRIzol DNA/RNA extraction method for DNA and RNA (TRI), (C) Qiagen AllPrep DNA/RNA FFPE kit for DNA and RNA (QDR), and (D) Ambion RecoverAll™ Total Nucleic Acid Isolation (AMB) for DNA and for RNA. Each nucleic acid extraction was done in triplicate to determine technical reproducibility.

    Journal: PLoS ONE

    Article Title: Effective DNA/RNA Co-Extraction for Analysis of MicroRNAs, mRNAs, and Genomic DNA from Formalin-Fixed Paraffin-Embedded Specimens

    doi: 10.1371/journal.pone.0034683

    Figure Lengend Snippet: DNA/RNA extractions using archived human specimens. Four different methods were tested on seven different archived tissues: (A) Qiagen QIAamp DNA FFPE kit for DNA (QD), (B) TRIzol DNA/RNA extraction method for DNA and RNA (TRI), (C) Qiagen AllPrep DNA/RNA FFPE kit for DNA and RNA (QDR), and (D) Ambion RecoverAll™ Total Nucleic Acid Isolation (AMB) for DNA and for RNA. Each nucleic acid extraction was done in triplicate to determine technical reproducibility.

    Article Snippet: For co-extraction of FFPE-DNA and -RNA we used the Qiagen AllPrep DNA/RNA FFPE kit following manufacturer's instructions.

    Techniques: Formalin-fixed Paraffin-Embedded, RNA Extraction, Isolation

    Methylation analysis of CpG regions in genes of interest using matched fresh and FFPE genomic DNA obtained by different extraction methods. Representative 2% agarose gel electrophoresis images of PCR products for (A) ESR1 and (B) CCND2 genes. Graphs depict methylation values as a percentage for CpG dinucleotide rich regions in (C) ESR1, (D) CCND2, (E) GHSR, and (F) ARID3A as assayed via the MassARRAY system (Sequenom). Data were analyzed and confirmed using the MassArray R script statistical package. Methylation values for fresh MCF10A DNA isolated with control methods (DNA from fresh cells recovered by phenol/chloroform (PC-Fr) and from FFPE cells using the Qiagen QIAamp DNA FFPE kit (QD)) are compared against methods used for matched FFPE DNA (TRIzol extraction (TRI), Qiagen AllPrep DNA/RNA FFPE (QDR), and AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB)). The bar graphs display the correlation between DNA methylation measurements obtained from fresh genomic DNA and each FFPE genomic DNA recovered by the different extraction methods.

    Journal: PLoS ONE

    Article Title: Effective DNA/RNA Co-Extraction for Analysis of MicroRNAs, mRNAs, and Genomic DNA from Formalin-Fixed Paraffin-Embedded Specimens

    doi: 10.1371/journal.pone.0034683

    Figure Lengend Snippet: Methylation analysis of CpG regions in genes of interest using matched fresh and FFPE genomic DNA obtained by different extraction methods. Representative 2% agarose gel electrophoresis images of PCR products for (A) ESR1 and (B) CCND2 genes. Graphs depict methylation values as a percentage for CpG dinucleotide rich regions in (C) ESR1, (D) CCND2, (E) GHSR, and (F) ARID3A as assayed via the MassARRAY system (Sequenom). Data were analyzed and confirmed using the MassArray R script statistical package. Methylation values for fresh MCF10A DNA isolated with control methods (DNA from fresh cells recovered by phenol/chloroform (PC-Fr) and from FFPE cells using the Qiagen QIAamp DNA FFPE kit (QD)) are compared against methods used for matched FFPE DNA (TRIzol extraction (TRI), Qiagen AllPrep DNA/RNA FFPE (QDR), and AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB)). The bar graphs display the correlation between DNA methylation measurements obtained from fresh genomic DNA and each FFPE genomic DNA recovered by the different extraction methods.

    Article Snippet: For co-extraction of FFPE-DNA and -RNA we used the Qiagen AllPrep DNA/RNA FFPE kit following manufacturer's instructions.

    Techniques: Methylation, Formalin-fixed Paraffin-Embedded, Agarose Gel Electrophoresis, Electrophoresis, Polymerase Chain Reaction, Isolation, DNA Methylation Assay

    Optimized TRIzol extraction of DNA from archived specimens. (A) Schematic representation of DNA recovery from the lower phase of TRIzol (upper phase yields RNA). In step 1 (yellow bullet), tissue digestion is performed following the procedure described in Loudig et al. 2007. In step 2 (yellow bullet), using TRIzol RNA and DNA are separated into the upper and lower phases, respectively. The DNA is recovered from the lower phase, using our optimized approach described in the materials and methods . The four steps describing optimization of DNA recovery from the lower phase of TRIzol include: a. Precipitate DNA; b. Process DNA pellet (using reagents from Qiagen DNA FFPE kit for steps b to d); c. Purify DNA; d. Bind, wash, and elute DNA. (B) Analysis of DNA from FFPE tissue recovered from the lower phase of TRIzol. The upper panel shows the histogram of DNA recovery. The lower panel shows a 1.5% agarose gel electrophoresis image of fresh DNA recovered from a TRIzol treatment lower phase (lane 1), FFPE DNA recovered from a TRIzol lower phase (lanes 2–6), and the size ladder (lane 7). For DNA, precipitation was tested for 600 µl (lane 2 and lane 4), 1000 µl (lane 3 and lane 5), and 1200 µl of Ethanol (lane 6). Proteinase K (PK) treatment was performed for 24 (lanes 2–3) or 48 hours (lanes 4–6). Electrophoresis reveals integrity of the extracted DNA samples. The histogram and agarose gel show that precipitation with a combination of 1200 µl ethanol and 48 hours of PK treatment gives the best quality and quantity of DNA. 500 ng of DNA was loaded per well of the gel.

    Journal: PLoS ONE

    Article Title: Effective DNA/RNA Co-Extraction for Analysis of MicroRNAs, mRNAs, and Genomic DNA from Formalin-Fixed Paraffin-Embedded Specimens

    doi: 10.1371/journal.pone.0034683

    Figure Lengend Snippet: Optimized TRIzol extraction of DNA from archived specimens. (A) Schematic representation of DNA recovery from the lower phase of TRIzol (upper phase yields RNA). In step 1 (yellow bullet), tissue digestion is performed following the procedure described in Loudig et al. 2007. In step 2 (yellow bullet), using TRIzol RNA and DNA are separated into the upper and lower phases, respectively. The DNA is recovered from the lower phase, using our optimized approach described in the materials and methods . The four steps describing optimization of DNA recovery from the lower phase of TRIzol include: a. Precipitate DNA; b. Process DNA pellet (using reagents from Qiagen DNA FFPE kit for steps b to d); c. Purify DNA; d. Bind, wash, and elute DNA. (B) Analysis of DNA from FFPE tissue recovered from the lower phase of TRIzol. The upper panel shows the histogram of DNA recovery. The lower panel shows a 1.5% agarose gel electrophoresis image of fresh DNA recovered from a TRIzol treatment lower phase (lane 1), FFPE DNA recovered from a TRIzol lower phase (lanes 2–6), and the size ladder (lane 7). For DNA, precipitation was tested for 600 µl (lane 2 and lane 4), 1000 µl (lane 3 and lane 5), and 1200 µl of Ethanol (lane 6). Proteinase K (PK) treatment was performed for 24 (lanes 2–3) or 48 hours (lanes 4–6). Electrophoresis reveals integrity of the extracted DNA samples. The histogram and agarose gel show that precipitation with a combination of 1200 µl ethanol and 48 hours of PK treatment gives the best quality and quantity of DNA. 500 ng of DNA was loaded per well of the gel.

    Article Snippet: For co-extraction of FFPE-DNA and -RNA we used the Qiagen AllPrep DNA/RNA FFPE kit following manufacturer's instructions.

    Techniques: Formalin-fixed Paraffin-Embedded, Agarose Gel Electrophoresis, Electrophoresis

    Messenger RNA expression analysis of matched fresh and FFPE RNA using different RNA extraction methods. The upper panel displays a graphic representation of quantitative RT-PCR (Taqman® mRNA assays) Measurements obtained for ESR1, CCND2 and KRT14 genes using matched fresh and FFPE RNA from MCF10A cells. The three genes were quantified using matched fresh RNA recovered with TRIzol (TRI-Fr), and FFPE RNA recovered with TRIzol (TRI), with Qiagen AllPrep DNA/RNA FFPE (QDR), with AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB) and with the Roche RNA FFPE (Roche) kits. The results are represented as fold changes. The lower panels show the comparison of global mRNA quantifications obtained between fresh and FFPE RNA samples using the Illumina whole-Genome DASL platform. The different panels display comparison between triplicate RNA extractions from matched fresh (TRI-Fr1, TRI-Fr2, TRI-Fr3 (bottom to top panel)) and FFPE (TRI1-3, QDR1-3, AMB1-3 and Roche1-3 (from left to right panel)) cells. The correlation coefficient (r) between matched fresh and FFPE RNAs is displayed in each graph.

    Journal: PLoS ONE

    Article Title: Effective DNA/RNA Co-Extraction for Analysis of MicroRNAs, mRNAs, and Genomic DNA from Formalin-Fixed Paraffin-Embedded Specimens

    doi: 10.1371/journal.pone.0034683

    Figure Lengend Snippet: Messenger RNA expression analysis of matched fresh and FFPE RNA using different RNA extraction methods. The upper panel displays a graphic representation of quantitative RT-PCR (Taqman® mRNA assays) Measurements obtained for ESR1, CCND2 and KRT14 genes using matched fresh and FFPE RNA from MCF10A cells. The three genes were quantified using matched fresh RNA recovered with TRIzol (TRI-Fr), and FFPE RNA recovered with TRIzol (TRI), with Qiagen AllPrep DNA/RNA FFPE (QDR), with AMBion RecoverAll™ Total Nucleic Acid Isolation (AMB) and with the Roche RNA FFPE (Roche) kits. The results are represented as fold changes. The lower panels show the comparison of global mRNA quantifications obtained between fresh and FFPE RNA samples using the Illumina whole-Genome DASL platform. The different panels display comparison between triplicate RNA extractions from matched fresh (TRI-Fr1, TRI-Fr2, TRI-Fr3 (bottom to top panel)) and FFPE (TRI1-3, QDR1-3, AMB1-3 and Roche1-3 (from left to right panel)) cells. The correlation coefficient (r) between matched fresh and FFPE RNAs is displayed in each graph.

    Article Snippet: For co-extraction of FFPE-DNA and -RNA we used the Qiagen AllPrep DNA/RNA FFPE kit following manufacturer's instructions.

    Techniques: RNA Expression, Formalin-fixed Paraffin-Embedded, RNA Extraction, Quantitative RT-PCR, Isolation