rlt buffer from rneasy mini kit qiagen  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    RLT Buffer
    Description:

    Catalog Number:
    RB68040
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Qiagen rlt buffer from rneasy mini kit qiagen

    https://www.bioz.com/result/rlt buffer from rneasy mini kit qiagen/product/Qiagen
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rlt buffer from rneasy mini kit qiagen - by Bioz Stars, 2019-10
    99/100 stars

    Related Products / Commonly Used Together

    rlt buffer from rneasy mini kit Qiagen

    Images

    Related Articles

    Clone Assay:

    Article Title: ARR22 overexpression can suppress plant Two-Component Regulatory Systems
    Article Snippet: ARR2-eGFP and ARR2 D80E -eGFP from two different vector clones (pUGT1 , pABindGFP ) were transfected separately and later pooled before FACS on a MoFLo XDP (Beckman Coulter). eGFP was expressed from plasmid pCF203 [ ]. .. 3 x 104 GFP positive cells were isolated by FACS (sample/sheath pressure around 30.5/30.0 psi) in Enrichment Mode (1 drop) sorted directly into 350 μL RLT-Lysis Buffer (Qiagen) containing 5 μL 14M β-Me, constantly kept on wet-ice (+4°C).

    Article Title: Exotic properties of a voltage-gated proton channel from the snail Helisoma trivolvis
    Article Snippet: Paragraph title: Gene cloning, mutagenesis, antibody synthesis, and Western blotting ... Total lysate was prepared from H. trivolvis brains that had been stored whole in Qiagen RLT buffer at −80°C for 12 mo.

    Centrifugation:

    Article Title: Loss of Hairless Confers Susceptibility to UVB-Induced Tumorigenesis via Disruption of NF-kappaB Signaling
    Article Snippet: Keratinocyte clumps were then filtered out using a 70 μM cell strainer (BD Biosciences, San Diego, CA) and the remaining single cell filtrate was pelleted by centrifugation. .. The cells were then resuspended in either RLT Buffer for RNA Extraction (Qiagen, Valencia, CA) or the Flag-Lysis Buffer (50 mM Tris-HCl pH 7.8, 137 mM NaCl, 10 mM NaF, 1 mM EDTA, 1% Triton X-100, 0.2% Sarkosyl, 1 mM DTT, 10 % glycerol and fresh proteinase inhibitors) for protein extraction.

    Amplification:

    Article Title: Establishment of a conditional TALEN system using the translational enhancer dMac3 and an inducible promoter activated by glucocorticoid treatment to increase the frequency of targeted mutagenesis in plants
    Article Snippet: Genomic DNA was prepared using a DNA preparation kit and QIAshredder with RLT lysis buffer (QIAGEN, Hilden, Germany). .. The 0.7-kb region in the Os01g0833500 gene that contained the target sites for the TALENs was PCR-amplified using the primers 5'–GCCCTGATTTACCATGATTC–3' and 5'–GTCAAGAGGGTGATCTAAG–3' .

    Mass Spectrometry:

    Article Title: The MS Risk Allele of CD40 Is Associated with Reduced Cell-Membrane Bound Expression in Antigen Presenting Cells: Implications for Gene Function
    Article Snippet: Immune cell subsets were purified from PBMCs isolated from MS patients and controls by either Ficoll (GE Healthcare) or Histopaque (Invitrogen) density gradient separation. .. Purified subsets were stored in RLT buffer (Qiagen) or Cells-to-signal Buffer (Ambion) for subsequent RNA extraction.

    Stable Transfection:

    Article Title: Loss of RNA-binding protein GRSF1 activates mTOR to elicit a proinflammatory transcriptional program
    Article Snippet: Briefly, HEK293 cells stably expressing shGRSF1 (or shCTRL) were cultured in media containing 4-thiouridine (4-SU, 100 μM, Sigma) and the nascent RNA was metabolically labeled for up to 2 h. Total RNA (50 μg) was biotinylated in a labeling reaction including 30 μl of Biotin-HPDP (Pierce) dissolved in 1 mg/mL dimethylformamide (DMF, Sigma) and 20 μl of 10 × biotinylation buffer (100 mM Tris–HCl, pH 7.4, 10 mM EDTA) at 25°C for 1.5 h. Biotinylated RNA was then purified using chloroform/isoamylalcohol (24:1) extraction, and the RNA pellet was resuspended in 100 μl of RNase-free water with 0.1 mM EDTA. .. Captured RNA was then eluted directly using 700 μl of RLT buffer (Qiagen) using 100 μl of dithiothreitol (DTT, 100 mM) twice.

    Quantitative RT-PCR:

    Article Title: IONIS-PKKRx a Novel Antisense Inhibitor of Prekallikrein and Bradykinin Production
    Article Snippet: Paragraph title: RNA isolation and RT-qPCR analysis ... HepaRG cells were directly lysed in RLT buffer (QIAGEN) containing 1% 2-mercaptoethanol.

    Article Title: Transient Reversal of Episome Silencing Precedes VP16-Dependent Transcription during Reactivation of Latent HSV-1 in Neurons
    Article Snippet: Paragraph title: Transcript analysis by quantitative reverse transcription PCR (qRT-PCR) ... After washing with PBS, neurons were lysed in 350 µl RLT Buffer (QRNeasy Mini Kit, QIAgen) and homogenized using QIAshredder (QIAgen).

    Real-time Polymerase Chain Reaction:

    Article Title: IONIS-PKKRx a Novel Antisense Inhibitor of Prekallikrein and Bradykinin Production
    Article Snippet: HepaRG cells were directly lysed in RLT buffer (QIAGEN) containing 1% 2-mercaptoethanol. .. Total mRNA was prepared using the PureLink™ Pro 96 RNA Total RNA Isolation Kit (Invitrogen, Life Technologies, Carlsbad, CA) according to the manufacturer's instructions.

    Article Title: Lymphocyte innateness defined by transcriptional states reflects a balance between proliferation and effector functions
    Article Snippet: Paragraph title: qPCR analysis ... For 47S rRNA quantification, cells were sorted directly into RLT buffer (Qiagen) before RNA extraction (Qiagen, RNeasy).

    Article Title: Dysregulation of Cortisol Metabolism in Equine Pituitary Pars Intermedia Dysfunction
    Article Snippet: The tissue was mechanically disrupted in either QIAzol (Qiagen) for adipose tissue or RLT buffer (Qiagen) for liver and pituitary tissue. .. The tissue was mechanically disrupted in either QIAzol (Qiagen) for adipose tissue or RLT buffer (Qiagen) for liver and pituitary tissue.

    Incubation:

    Article Title: Loss of RNA-binding protein GRSF1 activates mTOR to elicit a proinflammatory transcriptional program
    Article Snippet: The labeled RNA was then heated (65°C, 5 min), chilled on ice briefly, and incubated with 100 μl of streptavidin beads (Miltenyi Biotec) with rotation for 20 min. Beads were loaded onto the equilibrated μMacs columns (Miltenyi Biotec), and washed with washing buffer (100 mM Tris–HCl, pH7.5, 10 mM EDTA, 1 M NaCl and 0.1% Tween-20) three times each. .. Captured RNA was then eluted directly using 700 μl of RLT buffer (Qiagen) using 100 μl of dithiothreitol (DTT, 100 mM) twice.

    Article Title: FcRn Expression in Wildtype Mice, Transgenic Mice, and in Human Tissues
    Article Snippet: Tissues were homogenized in 600 µL of RLT buffer (Qiagen) containing 10% β-mercaptoethanol. .. Tissues were homogenized in 600 µL of RLT buffer (Qiagen) containing 10% β-mercaptoethanol.

    Article Title: Adult human pancreatic acinar cells dedifferentiate into an embryonic progenitor-like state in 3D suspension culture
    Article Snippet: Cells were washed with FBS buffer (PBS + 3% FBS) and incubated for 15 minutes at 4 °C with secondary antibody Alexa fluor 647 anti-mouse (Jackson Laboratory, Westgrove, PA, USA; 2 µl per million cells in 200 µl). .. After sort, cells were immediately collected in RLT buffer (Qiagen, Germantown, MD 20874, USA) and kept on ice.

    Article Title: Genetic effects on promoter usage are highly context-specific and contribute to complex traits
    Article Snippet: On day 6 of the macrophage differentiation, two wells of the six-well plate were exposed to 100 µg/ml human acLDL (Life Technologies) for 24 hr, whereas the other two wells were incubated in fresh RPMI 1640 medium without stimulation throughout this period. .. For RNA extraction, cells were washed once with PBS and lysed in 300 µl of RLT buffer (Qiagen) per well of a six-well plate.

    Article Title: Loss of Hairless Confers Susceptibility to UVB-Induced Tumorigenesis via Disruption of NF-kappaB Signaling
    Article Snippet: The epidermis was mechanically separated from the dermis by scraping and incubated in SMEM with 10% FBS, 1% PS (Invitrogen) at room temperature with shaking for 30 min to separate the keractinoyctes. .. The cells were then resuspended in either RLT Buffer for RNA Extraction (Qiagen, Valencia, CA) or the Flag-Lysis Buffer (50 mM Tris-HCl pH 7.8, 137 mM NaCl, 10 mM NaF, 1 mM EDTA, 1% Triton X-100, 0.2% Sarkosyl, 1 mM DTT, 10 % glycerol and fresh proteinase inhibitors) for protein extraction.

    Article Title: The MS Risk Allele of CD40 Is Associated with Reduced Cell-Membrane Bound Expression in Antigen Presenting Cells: Implications for Gene Function
    Article Snippet: DC1 and DC2s were generated in vitro from monocytes by sequential incubation with IL-4 and GMCSF, LPS and either IFNγ (DC1) or IFNβ (DC2) as previously described [ ]. .. Purified subsets were stored in RLT buffer (Qiagen) or Cells-to-signal Buffer (Ambion) for subsequent RNA extraction.

    Expressing:

    Article Title: Loss of RNA-binding protein GRSF1 activates mTOR to elicit a proinflammatory transcriptional program
    Article Snippet: Briefly, HEK293 cells stably expressing shGRSF1 (or shCTRL) were cultured in media containing 4-thiouridine (4-SU, 100 μM, Sigma) and the nascent RNA was metabolically labeled for up to 2 h. Total RNA (50 μg) was biotinylated in a labeling reaction including 30 μl of Biotin-HPDP (Pierce) dissolved in 1 mg/mL dimethylformamide (DMF, Sigma) and 20 μl of 10 × biotinylation buffer (100 mM Tris–HCl, pH 7.4, 10 mM EDTA) at 25°C for 1.5 h. Biotinylated RNA was then purified using chloroform/isoamylalcohol (24:1) extraction, and the RNA pellet was resuspended in 100 μl of RNase-free water with 0.1 mM EDTA. .. Captured RNA was then eluted directly using 700 μl of RLT buffer (Qiagen) using 100 μl of dithiothreitol (DTT, 100 mM) twice.

    Article Title: IONIS-PKKRx a Novel Antisense Inhibitor of Prekallikrein and Bradykinin Production
    Article Snippet: HepaRG cells were directly lysed in RLT buffer (QIAGEN) containing 1% 2-mercaptoethanol. .. The amount of specific mRNA was analyzed using a StepOne™ Real-Time PCR System (Applied Biosystems, Life Technologies, Carlsbad, CA).

    Article Title: Genetic effects on promoter usage are highly context-specific and contribute to complex traits
    Article Snippet: The final sample size was decided on the basis of similar gene expression and splicing QTL mapping studies performed previously ( ; ; ). .. For RNA extraction, cells were washed once with PBS and lysed in 300 µl of RLT buffer (Qiagen) per well of a six-well plate.

    Article Title: Exotic properties of a voltage-gated proton channel from the snail Helisoma trivolvis
    Article Snippet: This coding sequence was subcloned into eukaryotic expression vector pCA-IRES-eGFP. .. Total lysate was prepared from H. trivolvis brains that had been stored whole in Qiagen RLT buffer at −80°C for 12 mo.

    Article Title: Characterization of Human Mesenchymal Stem Cells from Different Tissues and Their Membrane Encasement for Prospective Transplantation Therapies
    Article Snippet: Cells and culture media were harvested after seven days of culture. .. Cells in wells and fibers were directly lysed with RLT-buffer (Qiagen, Valencia, CA) containing 1% beta-mercaptoethanol (Sigma-Aldrich) for subsequent extraction of nucleic acids and gene expression analyses. .. Cell culture media samples were centrifuged to remove any potential cells or debris, and supernatants were stored at -20C for further analyses of protein secretion and lactate dehydrogenase (LDH) activity.

    Genome Wide:

    Article Title: Hypoxia Impairs Initial Outgrowth of Endothelial Colony Forming Cells and Reduces Their Proliferative and Sprouting Potential
    Article Snippet: Paragraph title: RNA Isolation and Genome-Wide RNA-Sequencing ... The cell lysates were collected in 350 μL per 20 cm2 cells of solution containing RLT buffer (Qiagen) + 10 μL/mL β-mercaptanol.

    Western Blot:

    Article Title: Exotic properties of a voltage-gated proton channel from the snail Helisoma trivolvis
    Article Snippet: Paragraph title: Gene cloning, mutagenesis, antibody synthesis, and Western blotting ... Total lysate was prepared from H. trivolvis brains that had been stored whole in Qiagen RLT buffer at −80°C for 12 mo.

    Hybridization:

    Article Title: Rapid identification and phylogenetic classification of diverse bacterial pathogens in a multiplexed hybridization assay targeting ribosomal RNA
    Article Snippet: An aliquot was spun at 100 × g for 10 minutes to sediment RBCs and other large debris, then 100 uL of supernatant was added to 400 uL of RLT buffer (Qiagen) +1% BME. .. An aliquot was spun at 100 × g for 10 minutes to sediment RBCs and other large debris, then 100 uL of supernatant was added to 400 uL of RLT buffer (Qiagen) +1% BME.

    Transfection:

    Article Title: ARR22 overexpression can suppress plant Two-Component Regulatory Systems
    Article Snippet: ARR2-eGFP and ARR2 D80E -eGFP from two different vector clones (pUGT1 , pABindGFP ) were transfected separately and later pooled before FACS on a MoFLo XDP (Beckman Coulter). eGFP was expressed from plasmid pCF203 [ ]. .. 3 x 104 GFP positive cells were isolated by FACS (sample/sheath pressure around 30.5/30.0 psi) in Enrichment Mode (1 drop) sorted directly into 350 μL RLT-Lysis Buffer (Qiagen) containing 5 μL 14M β-Me, constantly kept on wet-ice (+4°C).

    Cell Culture:

    Article Title: Loss of RNA-binding protein GRSF1 activates mTOR to elicit a proinflammatory transcriptional program
    Article Snippet: Briefly, HEK293 cells stably expressing shGRSF1 (or shCTRL) were cultured in media containing 4-thiouridine (4-SU, 100 μM, Sigma) and the nascent RNA was metabolically labeled for up to 2 h. Total RNA (50 μg) was biotinylated in a labeling reaction including 30 μl of Biotin-HPDP (Pierce) dissolved in 1 mg/mL dimethylformamide (DMF, Sigma) and 20 μl of 10 × biotinylation buffer (100 mM Tris–HCl, pH 7.4, 10 mM EDTA) at 25°C for 1.5 h. Biotinylated RNA was then purified using chloroform/isoamylalcohol (24:1) extraction, and the RNA pellet was resuspended in 100 μl of RNase-free water with 0.1 mM EDTA. .. Captured RNA was then eluted directly using 700 μl of RLT buffer (Qiagen) using 100 μl of dithiothreitol (DTT, 100 mM) twice.

    Article Title: Characterization of Human Mesenchymal Stem Cells from Different Tissues and Their Membrane Encasement for Prospective Transplantation Therapies
    Article Snippet: Paragraph title: 2.4. Capillary Fiber Preparation and Cell Culture ... Cells in wells and fibers were directly lysed with RLT-buffer (Qiagen, Valencia, CA) containing 1% beta-mercaptoethanol (Sigma-Aldrich) for subsequent extraction of nucleic acids and gene expression analyses.

    Generated:

    Article Title: The MS Risk Allele of CD40 Is Associated with Reduced Cell-Membrane Bound Expression in Antigen Presenting Cells: Implications for Gene Function
    Article Snippet: DC1 and DC2s were generated in vitro from monocytes by sequential incubation with IL-4 and GMCSF, LPS and either IFNγ (DC1) or IFNβ (DC2) as previously described [ ]. .. Purified subsets were stored in RLT buffer (Qiagen) or Cells-to-signal Buffer (Ambion) for subsequent RNA extraction.

    Sequencing:

    Article Title: Hypoxia Impairs Initial Outgrowth of Endothelial Colony Forming Cells and Reduces Their Proliferative and Sprouting Potential
    Article Snippet: The cell lysates were collected in 350 μL per 20 cm2 cells of solution containing RLT buffer (Qiagen) + 10 μL/mL β-mercaptanol. .. Total RNA was isolated using RNeasyMinElute Cleanup Kit (Qiagen, Netherlands) and the RNA quality was tested with a Nanodrop 1,000 spectrophotometer.

    Article Title: STAT1 signaling shields T cells from NK cell-mediated cytotoxicity
    Article Snippet: In the post-transfer setting, WT or Stat1 −/− T cells (gated as CD45+ CD3ε+ CD4+ , Supplementary Fig. ) were FACS sorted from the spleen and lymph nodes of Rag1 −/− mice post transfer directly into RLT lysis buffer (Qiagen) and RNA extracted using the RNeasy Micro kit (Qiagen). .. As Stat1 −/− T cells showed reduced survival/expansion in vivo, it was not technically feasible to acquire sufficient cells for purity analysis by flow cytometry, hence purity was determined by confirming the downregulation of Stat1 in the Stat1 −/− T cells.

    Article Title: Exotic properties of a voltage-gated proton channel from the snail Helisoma trivolvis
    Article Snippet: Site-directed mutagenesis of HtHV 1 was performed and sequence verified commercially (Genewiz). .. Total lysate was prepared from H. trivolvis brains that had been stored whole in Qiagen RLT buffer at −80°C for 12 mo.

    Affinity Purification:

    Article Title: Exotic properties of a voltage-gated proton channel from the snail Helisoma trivolvis
    Article Snippet: Antibody was raised in rabbit to a synthetic peptide (RSPSDHGEGFEEPLC) based on the predicted HtHV 1 epitope and affinity purified (Genscript) with a final concentration of 0.904 mg/ml. .. Total lysate was prepared from H. trivolvis brains that had been stored whole in Qiagen RLT buffer at −80°C for 12 mo.

    DC Protein Assay:

    Article Title: Loss of Hairless Confers Susceptibility to UVB-Induced Tumorigenesis via Disruption of NF-kappaB Signaling
    Article Snippet: The cells were then resuspended in either RLT Buffer for RNA Extraction (Qiagen, Valencia, CA) or the Flag-Lysis Buffer (50 mM Tris-HCl pH 7.8, 137 mM NaCl, 10 mM NaF, 1 mM EDTA, 1% Triton X-100, 0.2% Sarkosyl, 1 mM DTT, 10 % glycerol and fresh proteinase inhibitors) for protein extraction. .. Protein was extracted from either epidermal extracts or whole tumors homogenized in Flag-Lysis buffer.

    FACS:

    Article Title: Adult human pancreatic acinar cells dedifferentiate into an embryonic progenitor-like state in 3D suspension culture
    Article Snippet: Paragraph title: Fluorescent activated cell sorting (FACS) ... After sort, cells were immediately collected in RLT buffer (Qiagen, Germantown, MD 20874, USA) and kept on ice.

    Article Title: ARR22 overexpression can suppress plant Two-Component Regulatory Systems
    Article Snippet: The MoFlo XDP was mounted with a 100 μm nozzle and standard PBS buffer as sheath. .. 3 x 104 GFP positive cells were isolated by FACS (sample/sheath pressure around 30.5/30.0 psi) in Enrichment Mode (1 drop) sorted directly into 350 μL RLT-Lysis Buffer (Qiagen) containing 5 μL 14M β-Me, constantly kept on wet-ice (+4°C). .. Cells were either mock treated (water) or treated with t -zeatin to a final concentration of 1 μM t -zeatin; cytokinin treated cells were therefore collected from time points 30 min to 50 min after stimulation.

    Article Title: STAT1 signaling shields T cells from NK cell-mediated cytotoxicity
    Article Snippet: All samples were acquired with a BD Canto II or LSRFortessa Flow Cytometer (BD Biosciences) and analyzed with FlowJo (FlowJo, LLC). .. In the post-transfer setting, WT or Stat1 −/− T cells (gated as CD45+ CD3ε+ CD4+ , Supplementary Fig. ) were FACS sorted from the spleen and lymph nodes of Rag1 −/− mice post transfer directly into RLT lysis buffer (Qiagen) and RNA extracted using the RNeasy Micro kit (Qiagen). .. As Stat1 −/− T cells showed reduced survival/expansion in vivo, it was not technically feasible to acquire sufficient cells for purity analysis by flow cytometry, hence purity was determined by confirming the downregulation of Stat1 in the Stat1 −/− T cells.

    RNA Sequencing Assay:

    Article Title: Hypoxia Impairs Initial Outgrowth of Endothelial Colony Forming Cells and Reduces Their Proliferative and Sprouting Potential
    Article Snippet: Paragraph title: RNA Isolation and Genome-Wide RNA-Sequencing ... The cell lysates were collected in 350 μL per 20 cm2 cells of solution containing RLT buffer (Qiagen) + 10 μL/mL β-mercaptanol.

    Article Title: STAT1 signaling shields T cells from NK cell-mediated cytotoxicity
    Article Snippet: Paragraph title: RNA sequencing ... In the post-transfer setting, WT or Stat1 −/− T cells (gated as CD45+ CD3ε+ CD4+ , Supplementary Fig. ) were FACS sorted from the spleen and lymph nodes of Rag1 −/− mice post transfer directly into RLT lysis buffer (Qiagen) and RNA extracted using the RNeasy Micro kit (Qiagen).

    Mutagenesis:

    Article Title: Establishment of a conditional TALEN system using the translational enhancer dMac3 and an inducible promoter activated by glucocorticoid treatment to increase the frequency of targeted mutagenesis in plants
    Article Snippet: Genomic DNA was prepared using a DNA preparation kit and QIAshredder with RLT lysis buffer (QIAGEN, Hilden, Germany). .. Genomic DNA was prepared using a DNA preparation kit and QIAshredder with RLT lysis buffer (QIAGEN, Hilden, Germany).

    Article Title: Exotic properties of a voltage-gated proton channel from the snail Helisoma trivolvis
    Article Snippet: Paragraph title: Gene cloning, mutagenesis, antibody synthesis, and Western blotting ... Total lysate was prepared from H. trivolvis brains that had been stored whole in Qiagen RLT buffer at −80°C for 12 mo.

    Article Title: Loss of Hairless Confers Susceptibility to UVB-Induced Tumorigenesis via Disruption of NF-kappaB Signaling
    Article Snippet: Dorsal skin was harvested from mutant and WT animals and divided into two parts; one portion was kept intact for histological analysis and RNA extraction (see below) and the other was used for epidermal isolation and subsequent RNA and protein extraction. .. The cells were then resuspended in either RLT Buffer for RNA Extraction (Qiagen, Valencia, CA) or the Flag-Lysis Buffer (50 mM Tris-HCl pH 7.8, 137 mM NaCl, 10 mM NaF, 1 mM EDTA, 1% Triton X-100, 0.2% Sarkosyl, 1 mM DTT, 10 % glycerol and fresh proteinase inhibitors) for protein extraction.

    Isolation:

    Article Title: Tolerogenic bone marrow-derived dendritic cells induce neuroprotective regulatory T cells in a model of Parkinson’s disease
    Article Snippet: Paragraph title: Isolation of RNA from midbrain for PCR array ... To isolate RNA, midbrains were homogenized in 350 μl β-mercaptoethanol-supplemented RLT buffer (Qiagen) for every 30 mg tissue.

    Article Title: IONIS-PKKRx a Novel Antisense Inhibitor of Prekallikrein and Bradykinin Production
    Article Snippet: Paragraph title: RNA isolation and RT-qPCR analysis ... HepaRG cells were directly lysed in RLT buffer (QIAGEN) containing 1% 2-mercaptoethanol.

    Article Title: FcRn Expression in Wildtype Mice, Transgenic Mice, and in Human Tissues
    Article Snippet: Paragraph title: 2.3. Total RNA Isolation ... Tissues were homogenized in 600 µL of RLT buffer (Qiagen) containing 10% β-mercaptoethanol.

    Article Title: Hypoxia Impairs Initial Outgrowth of Endothelial Colony Forming Cells and Reduces Their Proliferative and Sprouting Potential
    Article Snippet: Paragraph title: RNA Isolation and Genome-Wide RNA-Sequencing ... The cell lysates were collected in 350 μL per 20 cm2 cells of solution containing RLT buffer (Qiagen) + 10 μL/mL β-mercaptanol.

    Article Title: ARR22 overexpression can suppress plant Two-Component Regulatory Systems
    Article Snippet: The MoFlo XDP was mounted with a 100 μm nozzle and standard PBS buffer as sheath. .. 3 x 104 GFP positive cells were isolated by FACS (sample/sheath pressure around 30.5/30.0 psi) in Enrichment Mode (1 drop) sorted directly into 350 μL RLT-Lysis Buffer (Qiagen) containing 5 μL 14M β-Me, constantly kept on wet-ice (+4°C). .. Cells were either mock treated (water) or treated with t -zeatin to a final concentration of 1 μM t -zeatin; cytokinin treated cells were therefore collected from time points 30 min to 50 min after stimulation.

    Article Title: Local Gene Expression Changes after UV-Irradiation of Human Skin
    Article Snippet: Paragraph title: RNA Isolation ... Frozen skin biopsies were mechanically disrupted in RLT lysis buffer (Qiagen, Germany) supplemented with 1% 2-Mercaptoethanol using an Ultra-Turrax (Janke & Kunkel, IKA-Werk, Germany) tissue homogeniser.

    Article Title: Loss of Hairless Confers Susceptibility to UVB-Induced Tumorigenesis via Disruption of NF-kappaB Signaling
    Article Snippet: Dorsal skin was harvested from mutant and WT animals and divided into two parts; one portion was kept intact for histological analysis and RNA extraction (see below) and the other was used for epidermal isolation and subsequent RNA and protein extraction. .. The cells were then resuspended in either RLT Buffer for RNA Extraction (Qiagen, Valencia, CA) or the Flag-Lysis Buffer (50 mM Tris-HCl pH 7.8, 137 mM NaCl, 10 mM NaF, 1 mM EDTA, 1% Triton X-100, 0.2% Sarkosyl, 1 mM DTT, 10 % glycerol and fresh proteinase inhibitors) for protein extraction.

    Article Title: The MS Risk Allele of CD40 Is Associated with Reduced Cell-Membrane Bound Expression in Antigen Presenting Cells: Implications for Gene Function
    Article Snippet: Immune cell subsets were purified from PBMCs isolated from MS patients and controls by either Ficoll (GE Healthcare) or Histopaque (Invitrogen) density gradient separation. .. Purified subsets were stored in RLT buffer (Qiagen) or Cells-to-signal Buffer (Ambion) for subsequent RNA extraction.

    Detection Assay:

    Article Title: Rapid identification and phylogenetic classification of diverse bacterial pathogens in a multiplexed hybridization assay targeting ribosomal RNA
    Article Snippet: An aliquot was spun at 100 × g for 10 minutes to sediment RBCs and other large debris, then 100 uL of supernatant was added to 400 uL of RLT buffer (Qiagen) +1% BME. .. An aliquot was spun at 100 × g for 10 minutes to sediment RBCs and other large debris, then 100 uL of supernatant was added to 400 uL of RLT buffer (Qiagen) +1% BME.

    Size-exclusion Chromatography:

    Article Title: ARR22 overexpression can suppress plant Two-Component Regulatory Systems
    Article Snippet: 3 x 104 GFP positive cells were isolated by FACS (sample/sheath pressure around 30.5/30.0 psi) in Enrichment Mode (1 drop) sorted directly into 350 μL RLT-Lysis Buffer (Qiagen) containing 5 μL 14M β-Me, constantly kept on wet-ice (+4°C). .. Cells were either mock treated (water) or treated with t -zeatin to a final concentration of 1 μM t -zeatin; cytokinin treated cells were therefore collected from time points 30 min to 50 min after stimulation.

    Labeling:

    Article Title: Loss of RNA-binding protein GRSF1 activates mTOR to elicit a proinflammatory transcriptional program
    Article Snippet: The labeled RNA was then heated (65°C, 5 min), chilled on ice briefly, and incubated with 100 μl of streptavidin beads (Miltenyi Biotec) with rotation for 20 min. Beads were loaded onto the equilibrated μMacs columns (Miltenyi Biotec), and washed with washing buffer (100 mM Tris–HCl, pH7.5, 10 mM EDTA, 1 M NaCl and 0.1% Tween-20) three times each. .. Captured RNA was then eluted directly using 700 μl of RLT buffer (Qiagen) using 100 μl of dithiothreitol (DTT, 100 mM) twice.

    Mouse Assay:

    Article Title: Tolerogenic bone marrow-derived dendritic cells induce neuroprotective regulatory T cells in a model of Parkinson’s disease
    Article Snippet: Two days after MPTP intoxication, mice were sacrificed, brains quickly removed, hemisected, midbrain dissected, placed in RNAlater (Thermo Fisher), tissues weighed, and flash frozen at − 80 °C. .. To isolate RNA, midbrains were homogenized in 350 μl β-mercaptoethanol-supplemented RLT buffer (Qiagen) for every 30 mg tissue.

    Article Title: IONIS-PKKRx a Novel Antisense Inhibitor of Prekallikrein and Bradykinin Production
    Article Snippet: HepaRG cells were directly lysed in RLT buffer (QIAGEN) containing 1% 2-mercaptoethanol. .. HepaRG cells were directly lysed in RLT buffer (QIAGEN) containing 1% 2-mercaptoethanol.

    Article Title: FcRn Expression in Wildtype Mice, Transgenic Mice, and in Human Tissues
    Article Snippet: For fibrous tissues (muscle, heart, and skin) of Swiss Webster and transgenic mice, total RNA was isolated from 20 to 30 mg of tissue using the RNeasy Fibrous Tissue Mini Kit (Qiagen). .. Tissues were homogenized in 600 µL of RLT buffer (Qiagen) containing 10% β-mercaptoethanol.

    Article Title: STAT1 signaling shields T cells from NK cell-mediated cytotoxicity
    Article Snippet: All samples were acquired with a BD Canto II or LSRFortessa Flow Cytometer (BD Biosciences) and analyzed with FlowJo (FlowJo, LLC). .. In the post-transfer setting, WT or Stat1 −/− T cells (gated as CD45+ CD3ε+ CD4+ , Supplementary Fig. ) were FACS sorted from the spleen and lymph nodes of Rag1 −/− mice post transfer directly into RLT lysis buffer (Qiagen) and RNA extracted using the RNeasy Micro kit (Qiagen). .. As Stat1 −/− T cells showed reduced survival/expansion in vivo, it was not technically feasible to acquire sufficient cells for purity analysis by flow cytometry, hence purity was determined by confirming the downregulation of Stat1 in the Stat1 −/− T cells.

    Polymerase Chain Reaction:

    Article Title: Tolerogenic bone marrow-derived dendritic cells induce neuroprotective regulatory T cells in a model of Parkinson’s disease
    Article Snippet: Paragraph title: Isolation of RNA from midbrain for PCR array ... To isolate RNA, midbrains were homogenized in 350 μl β-mercaptoethanol-supplemented RLT buffer (Qiagen) for every 30 mg tissue.

    Article Title: Transient Reversal of Episome Silencing Precedes VP16-Dependent Transcription during Reactivation of Latent HSV-1 in Neurons
    Article Snippet: Paragraph title: Transcript analysis by quantitative reverse transcription PCR (qRT-PCR) ... After washing with PBS, neurons were lysed in 350 µl RLT Buffer (QRNeasy Mini Kit, QIAgen) and homogenized using QIAshredder (QIAgen).

    Protein Extraction:

    Article Title: Loss of Hairless Confers Susceptibility to UVB-Induced Tumorigenesis via Disruption of NF-kappaB Signaling
    Article Snippet: Keratinocyte clumps were then filtered out using a 70 μM cell strainer (BD Biosciences, San Diego, CA) and the remaining single cell filtrate was pelleted by centrifugation. .. The cells were then resuspended in either RLT Buffer for RNA Extraction (Qiagen, Valencia, CA) or the Flag-Lysis Buffer (50 mM Tris-HCl pH 7.8, 137 mM NaCl, 10 mM NaF, 1 mM EDTA, 1% Triton X-100, 0.2% Sarkosyl, 1 mM DTT, 10 % glycerol and fresh proteinase inhibitors) for protein extraction. .. A portion of the whole skin was also homogenized in RLT Buffer and RNA was isolated from either the epidermis or the whole skin using an RNeasy Mini Kit (Qiagen) followed by DNase treatment.

    Metabolic Labelling:

    Article Title: Loss of RNA-binding protein GRSF1 activates mTOR to elicit a proinflammatory transcriptional program
    Article Snippet: Briefly, HEK293 cells stably expressing shGRSF1 (or shCTRL) were cultured in media containing 4-thiouridine (4-SU, 100 μM, Sigma) and the nascent RNA was metabolically labeled for up to 2 h. Total RNA (50 μg) was biotinylated in a labeling reaction including 30 μl of Biotin-HPDP (Pierce) dissolved in 1 mg/mL dimethylformamide (DMF, Sigma) and 20 μl of 10 × biotinylation buffer (100 mM Tris–HCl, pH 7.4, 10 mM EDTA) at 25°C for 1.5 h. Biotinylated RNA was then purified using chloroform/isoamylalcohol (24:1) extraction, and the RNA pellet was resuspended in 100 μl of RNase-free water with 0.1 mM EDTA. .. Captured RNA was then eluted directly using 700 μl of RLT buffer (Qiagen) using 100 μl of dithiothreitol (DTT, 100 mM) twice.

    Construct:

    Article Title: Exotic properties of a voltage-gated proton channel from the snail Helisoma trivolvis
    Article Snippet: Brains were dissected from H. trivolvis , RNA was extracted from brain tissue using the RNeasy kit (Qiagen), and a cDNA pool was constructed using the SuperScript III kit (Life Technologies) according to the manufacturer's instructions. .. Total lysate was prepared from H. trivolvis brains that had been stored whole in Qiagen RLT buffer at −80°C for 12 mo.

    Article Title: Characterization of Human Mesenchymal Stem Cells from Different Tissues and Their Membrane Encasement for Prospective Transplantation Therapies
    Article Snippet: Cells in wells and fibers were directly lysed with RLT-buffer (Qiagen, Valencia, CA) containing 1% beta-mercaptoethanol (Sigma-Aldrich) for subsequent extraction of nucleic acids and gene expression analyses. .. Cells in wells and fibers were directly lysed with RLT-buffer (Qiagen, Valencia, CA) containing 1% beta-mercaptoethanol (Sigma-Aldrich) for subsequent extraction of nucleic acids and gene expression analyses.

    Lysis:

    Article Title: Establishment of a conditional TALEN system using the translational enhancer dMac3 and an inducible promoter activated by glucocorticoid treatment to increase the frequency of targeted mutagenesis in plants
    Article Snippet: Then, they were placed onto N6D plates supplemented with 50 mg L−1 hygromycin B and 60 μM glucocorticoid to select transgenic lines for five days. .. Genomic DNA was prepared using a DNA preparation kit and QIAshredder with RLT lysis buffer (QIAGEN, Hilden, Germany). .. The 0.7-kb region in the Os01g0833500 gene that contained the target sites for the TALENs was PCR-amplified using the primers 5'–GCCCTGATTTACCATGATTC–3' and 5'–GTCAAGAGGGTGATCTAAG–3' .

    Article Title: STAT1 signaling shields T cells from NK cell-mediated cytotoxicity
    Article Snippet: All samples were acquired with a BD Canto II or LSRFortessa Flow Cytometer (BD Biosciences) and analyzed with FlowJo (FlowJo, LLC). .. In the post-transfer setting, WT or Stat1 −/− T cells (gated as CD45+ CD3ε+ CD4+ , Supplementary Fig. ) were FACS sorted from the spleen and lymph nodes of Rag1 −/− mice post transfer directly into RLT lysis buffer (Qiagen) and RNA extracted using the RNeasy Micro kit (Qiagen). .. As Stat1 −/− T cells showed reduced survival/expansion in vivo, it was not technically feasible to acquire sufficient cells for purity analysis by flow cytometry, hence purity was determined by confirming the downregulation of Stat1 in the Stat1 −/− T cells.

    Article Title: Local Gene Expression Changes after UV-Irradiation of Human Skin
    Article Snippet: Biopsies were stored at −80°C until mRNA PCR analysis. .. Frozen skin biopsies were mechanically disrupted in RLT lysis buffer (Qiagen, Germany) supplemented with 1% 2-Mercaptoethanol using an Ultra-Turrax (Janke & Kunkel, IKA-Werk, Germany) tissue homogeniser. .. RNA isolation was performed with RNeasy® Mini Kit and a silica-membrane binding capacity of 100 µg RNA (Qiagen, Germany).

    Purification:

    Article Title: Loss of RNA-binding protein GRSF1 activates mTOR to elicit a proinflammatory transcriptional program
    Article Snippet: Briefly, HEK293 cells stably expressing shGRSF1 (or shCTRL) were cultured in media containing 4-thiouridine (4-SU, 100 μM, Sigma) and the nascent RNA was metabolically labeled for up to 2 h. Total RNA (50 μg) was biotinylated in a labeling reaction including 30 μl of Biotin-HPDP (Pierce) dissolved in 1 mg/mL dimethylformamide (DMF, Sigma) and 20 μl of 10 × biotinylation buffer (100 mM Tris–HCl, pH 7.4, 10 mM EDTA) at 25°C for 1.5 h. Biotinylated RNA was then purified using chloroform/isoamylalcohol (24:1) extraction, and the RNA pellet was resuspended in 100 μl of RNase-free water with 0.1 mM EDTA. .. Captured RNA was then eluted directly using 700 μl of RLT buffer (Qiagen) using 100 μl of dithiothreitol (DTT, 100 mM) twice.

    Article Title: Local Gene Expression Changes after UV-Irradiation of Human Skin
    Article Snippet: Frozen skin biopsies were mechanically disrupted in RLT lysis buffer (Qiagen, Germany) supplemented with 1% 2-Mercaptoethanol using an Ultra-Turrax (Janke & Kunkel, IKA-Werk, Germany) tissue homogeniser. .. RNA isolation was performed with RNeasy® Mini Kit and a silica-membrane binding capacity of 100 µg RNA (Qiagen, Germany).

    Article Title: The MS Risk Allele of CD40 Is Associated with Reduced Cell-Membrane Bound Expression in Antigen Presenting Cells: Implications for Gene Function
    Article Snippet: DC1 and DC2s were generated in vitro from monocytes by sequential incubation with IL-4 and GMCSF, LPS and either IFNγ (DC1) or IFNβ (DC2) as previously described [ ]. .. Purified subsets were stored in RLT buffer (Qiagen) or Cells-to-signal Buffer (Ambion) for subsequent RNA extraction. .. Purity of the cellular subsets was determined by flow cytometry.

    Plasmid Preparation:

    Article Title: ARR22 overexpression can suppress plant Two-Component Regulatory Systems
    Article Snippet: ARR2-eGFP and ARR2 D80E -eGFP from two different vector clones (pUGT1 , pABindGFP ) were transfected separately and later pooled before FACS on a MoFLo XDP (Beckman Coulter). eGFP was expressed from plasmid pCF203 [ ]. .. 3 x 104 GFP positive cells were isolated by FACS (sample/sheath pressure around 30.5/30.0 psi) in Enrichment Mode (1 drop) sorted directly into 350 μL RLT-Lysis Buffer (Qiagen) containing 5 μL 14M β-Me, constantly kept on wet-ice (+4°C).

    Article Title: Exotic properties of a voltage-gated proton channel from the snail Helisoma trivolvis
    Article Snippet: This coding sequence was subcloned into eukaryotic expression vector pCA-IRES-eGFP. .. Total lysate was prepared from H. trivolvis brains that had been stored whole in Qiagen RLT buffer at −80°C for 12 mo.

    RNA Extraction:

    Article Title: Genetic effects on promoter usage are highly context-specific and contribute to complex traits
    Article Snippet: On day 6 of the macrophage differentiation, two wells of the six-well plate were exposed to 100 µg/ml human acLDL (Life Technologies) for 24 hr, whereas the other two wells were incubated in fresh RPMI 1640 medium without stimulation throughout this period. .. For RNA extraction, cells were washed once with PBS and lysed in 300 µl of RLT buffer (Qiagen) per well of a six-well plate. .. RNA was extracted using a RNA Mini Kit (Qiagen) following the manufacturer’s instructions and eluted in 35 µl nuclease-free water.

    Article Title: Lymphocyte innateness defined by transcriptional states reflects a balance between proliferation and effector functions
    Article Snippet: For validation studies, MAIT cells were identified as Vα7.2+ CD161+ T cells. .. For 47S rRNA quantification, cells were sorted directly into RLT buffer (Qiagen) before RNA extraction (Qiagen, RNeasy). .. Primers were designed to span the first rRNA-processing site using the following sequences: forward: GTCAGGCGTTCTCGTCTC, reverse: GCACGACGTCACCACAT.

    Article Title: ARR22 overexpression can suppress plant Two-Component Regulatory Systems
    Article Snippet: 3 x 104 GFP positive cells were isolated by FACS (sample/sheath pressure around 30.5/30.0 psi) in Enrichment Mode (1 drop) sorted directly into 350 μL RLT-Lysis Buffer (Qiagen) containing 5 μL 14M β-Me, constantly kept on wet-ice (+4°C). .. Cells were either mock treated (water) or treated with t -zeatin to a final concentration of 1 μM t -zeatin; cytokinin treated cells were therefore collected from time points 30 min to 50 min after stimulation.

    Article Title: Loss of Hairless Confers Susceptibility to UVB-Induced Tumorigenesis via Disruption of NF-kappaB Signaling
    Article Snippet: Keratinocyte clumps were then filtered out using a 70 μM cell strainer (BD Biosciences, San Diego, CA) and the remaining single cell filtrate was pelleted by centrifugation. .. The cells were then resuspended in either RLT Buffer for RNA Extraction (Qiagen, Valencia, CA) or the Flag-Lysis Buffer (50 mM Tris-HCl pH 7.8, 137 mM NaCl, 10 mM NaF, 1 mM EDTA, 1% Triton X-100, 0.2% Sarkosyl, 1 mM DTT, 10 % glycerol and fresh proteinase inhibitors) for protein extraction. .. A portion of the whole skin was also homogenized in RLT Buffer and RNA was isolated from either the epidermis or the whole skin using an RNeasy Mini Kit (Qiagen) followed by DNase treatment.

    Article Title: The MS Risk Allele of CD40 Is Associated with Reduced Cell-Membrane Bound Expression in Antigen Presenting Cells: Implications for Gene Function
    Article Snippet: DC1 and DC2s were generated in vitro from monocytes by sequential incubation with IL-4 and GMCSF, LPS and either IFNγ (DC1) or IFNβ (DC2) as previously described [ ]. .. Purified subsets were stored in RLT buffer (Qiagen) or Cells-to-signal Buffer (Ambion) for subsequent RNA extraction. .. Purity of the cellular subsets was determined by flow cytometry.

    Sample Prep:

    Article Title: Rapid identification and phylogenetic classification of diverse bacterial pathogens in a multiplexed hybridization assay targeting ribosomal RNA
    Article Snippet: Paragraph title: Clinical sample preparation ... An aliquot was spun at 100 × g for 10 minutes to sediment RBCs and other large debris, then 100 uL of supernatant was added to 400 uL of RLT buffer (Qiagen) +1% BME.

    In Vitro:

    Article Title: The MS Risk Allele of CD40 Is Associated with Reduced Cell-Membrane Bound Expression in Antigen Presenting Cells: Implications for Gene Function
    Article Snippet: DC1 and DC2s were generated in vitro from monocytes by sequential incubation with IL-4 and GMCSF, LPS and either IFNγ (DC1) or IFNβ (DC2) as previously described [ ]. .. Purified subsets were stored in RLT buffer (Qiagen) or Cells-to-signal Buffer (Ambion) for subsequent RNA extraction.

    Transgenic Assay:

    Article Title: FcRn Expression in Wildtype Mice, Transgenic Mice, and in Human Tissues
    Article Snippet: For fibrous tissues (muscle, heart, and skin) of Swiss Webster and transgenic mice, total RNA was isolated from 20 to 30 mg of tissue using the RNeasy Fibrous Tissue Mini Kit (Qiagen). .. Tissues were homogenized in 600 µL of RLT buffer (Qiagen) containing 10% β-mercaptoethanol.

    Quantitation Assay:

    Article Title: Dysregulation of Cortisol Metabolism in Equine Pituitary Pars Intermedia Dysfunction
    Article Snippet: Paragraph title: mRNA quantitation ... The tissue was mechanically disrupted in either QIAzol (Qiagen) for adipose tissue or RLT buffer (Qiagen) for liver and pituitary tissue.

    Spectrophotometry:

    Article Title: Hypoxia Impairs Initial Outgrowth of Endothelial Colony Forming Cells and Reduces Their Proliferative and Sprouting Potential
    Article Snippet: The cell lysates were collected in 350 μL per 20 cm2 cells of solution containing RLT buffer (Qiagen) + 10 μL/mL β-mercaptanol. .. The cell lysates were collected in 350 μL per 20 cm2 cells of solution containing RLT buffer (Qiagen) + 10 μL/mL β-mercaptanol.

    Concentration Assay:

    Article Title: Genetic effects on promoter usage are highly context-specific and contribute to complex traits
    Article Snippet: For RNA extraction, cells were washed once with PBS and lysed in 300 µl of RLT buffer (Qiagen) per well of a six-well plate. .. For RNA extraction, cells were washed once with PBS and lysed in 300 µl of RLT buffer (Qiagen) per well of a six-well plate.

    Article Title: Exotic properties of a voltage-gated proton channel from the snail Helisoma trivolvis
    Article Snippet: Antibody was raised in rabbit to a synthetic peptide (RSPSDHGEGFEEPLC) based on the predicted HtHV 1 epitope and affinity purified (Genscript) with a final concentration of 0.904 mg/ml. .. Total lysate was prepared from H. trivolvis brains that had been stored whole in Qiagen RLT buffer at −80°C for 12 mo.

    Staining:

    Article Title: Establishing Magnetic Resonance Imaging as an Accurate and Reliable Tool to Diagnose and Monitor Esophageal Cancer in a Rat Model
    Article Snippet: Histological Processing and Pathological Evaluation Biopsy specimens obtained for histological purposes and to evaluate molecular correlates were snap frozen in OCT compound (Tissue-Tek) and in RLT buffer (Qiagen), respectively. .. Histological Processing and Pathological Evaluation Biopsy specimens obtained for histological purposes and to evaluate molecular correlates were snap frozen in OCT compound (Tissue-Tek) and in RLT buffer (Qiagen), respectively.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen rlt buffer from rneasy mini kit qiagen
    Rlt Buffer From Rneasy Mini Kit Qiagen, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rlt buffer from rneasy mini kit qiagen/product/Qiagen
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rlt buffer from rneasy mini kit qiagen - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    99
    Qiagen cell lysis buffer
    Cell Lysis Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 51 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cell lysis buffer/product/Qiagen
    Average 99 stars, based on 51 article reviews
    Price from $9.99 to $1999.99
    cell lysis buffer - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    99
    Qiagen lysis buffer
    Lysis Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lysis buffer/product/Qiagen
    Average 99 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    lysis buffer - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results