Structured Review

TaKaRa ribonucleic acid rna extraction
Ribonucleic Acid Rna Extraction, supplied by TaKaRa, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ribonucleic acid rna extraction/product/TaKaRa
Average 91 stars, based on 2 article reviews
Price from $9.99 to $1999.99
ribonucleic acid rna extraction - by Bioz Stars, 2020-04
91/100 stars

Images

Related Articles

Real-time Polymerase Chain Reaction:

Article Title: Circulating long non‐coding HOX transcript antisense intergenic ribonucleic acid in plasma as a potential biomarker for diagnosis of breast cancer
Article Snippet: .. Ribonucleic acid ( RNA ) extraction and quantitative real‐time polymerase chain reaction Total RNA from tissues (50 mg) was isolated by Trizol Reagent (TaKaRa, Tokyo, Japan) and plasma samples (200 μL) were isolated using the Blood Total RNA Rapid Extraction Kit (BioTeke, China). .. Total RNAs were then reverse transcribed using a PrimeScriptRT Reagent Kit with gDNA Eraser (TaKaRa) following the manufacturer's protocol.

RNA Extraction:

Article Title: Circulating long non‐coding HOX transcript antisense intergenic ribonucleic acid in plasma as a potential biomarker for diagnosis of breast cancer
Article Snippet: .. Ribonucleic acid ( RNA ) extraction and quantitative real‐time polymerase chain reaction Total RNA from tissues (50 mg) was isolated by Trizol Reagent (TaKaRa, Tokyo, Japan) and plasma samples (200 μL) were isolated using the Blood Total RNA Rapid Extraction Kit (BioTeke, China). .. Total RNAs were then reverse transcribed using a PrimeScriptRT Reagent Kit with gDNA Eraser (TaKaRa) following the manufacturer's protocol.

Article Title: Lipoxin A4 regulates PM2.5-induced severe allergic asthma in mice via the Th1/Th2 balance of group 2 innate lymphoid cells
Article Snippet: .. Ribonucleic acid (RNA) extraction (Trizol method), and reverse transcription (Takara, Japan) were followed by the instructions. .. SYBR Green I was purchased from Life Technologies (AB & Invitrogen).

Synthesized:

Article Title: Circulating long non‐coding HOX transcript antisense intergenic ribonucleic acid in plasma as a potential biomarker for diagnosis of breast cancer
Article Snippet: Ribonucleic acid ( RNA ) extraction and quantitative real‐time polymerase chain reaction Total RNA from tissues (50 mg) was isolated by Trizol Reagent (TaKaRa, Tokyo, Japan) and plasma samples (200 μL) were isolated using the Blood Total RNA Rapid Extraction Kit (BioTeke, China). .. Primers were designed with Primer 5, synthesized by Sangon Biotech (Shanghai, China), and sequenced as follows: 5′‐GGTAGAAAAAGCAACCACGAAGC‐3′(forward) and 5′‐GCACGAAGGCTCA TCATTCA‐3′ (reverse) for HOTAIR;5′‐TCCTCTCCCAAGCCACACA‐3′ (forward) and 5′‐GCACGAAGGCTCATCATTCA‐3′ (reverse) for β‐actin.

Article Title: Lipoxin A4 regulates PM2.5-induced severe allergic asthma in mice via the Th1/Th2 balance of group 2 innate lymphoid cells
Article Snippet: Ribonucleic acid (RNA) extraction (Trizol method), and reverse transcription (Takara, Japan) were followed by the instructions. .. All primers were synthesized by Sangon (Shanghai, China) and shown in .

Isolation:

Article Title: Circulating long non‐coding HOX transcript antisense intergenic ribonucleic acid in plasma as a potential biomarker for diagnosis of breast cancer
Article Snippet: .. Ribonucleic acid ( RNA ) extraction and quantitative real‐time polymerase chain reaction Total RNA from tissues (50 mg) was isolated by Trizol Reagent (TaKaRa, Tokyo, Japan) and plasma samples (200 μL) were isolated using the Blood Total RNA Rapid Extraction Kit (BioTeke, China). .. Total RNAs were then reverse transcribed using a PrimeScriptRT Reagent Kit with gDNA Eraser (TaKaRa) following the manufacturer's protocol.

Quantitative RT-PCR:

Article Title: Lipoxin A4 regulates PM2.5-induced severe allergic asthma in mice via the Th1/Th2 balance of group 2 innate lymphoid cells
Article Snippet: Paragraph title: Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) of PBMC ... Ribonucleic acid (RNA) extraction (Trizol method), and reverse transcription (Takara, Japan) were followed by the instructions.

SYBR Green Assay:

Article Title: Circulating long non‐coding HOX transcript antisense intergenic ribonucleic acid in plasma as a potential biomarker for diagnosis of breast cancer
Article Snippet: Ribonucleic acid ( RNA ) extraction and quantitative real‐time polymerase chain reaction Total RNA from tissues (50 mg) was isolated by Trizol Reagent (TaKaRa, Tokyo, Japan) and plasma samples (200 μL) were isolated using the Blood Total RNA Rapid Extraction Kit (BioTeke, China). .. HOTAIR expression was measured by real time‐polymerase chain reaction (RT‐PCR) using SYBR Green assays (Takara) in a 7500 Fast Real‐Time PCR System (Applied Biosystems, Foster City, CA, USA). β‐actin was used to normalize the relative levels of lncRNA.

Article Title: Lipoxin A4 regulates PM2.5-induced severe allergic asthma in mice via the Th1/Th2 balance of group 2 innate lymphoid cells
Article Snippet: Ribonucleic acid (RNA) extraction (Trizol method), and reverse transcription (Takara, Japan) were followed by the instructions. .. Ribonucleic acid (RNA) extraction (Trizol method), and reverse transcription (Takara, Japan) were followed by the instructions.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Circulating long non‐coding HOX transcript antisense intergenic ribonucleic acid in plasma as a potential biomarker for diagnosis of breast cancer
Article Snippet: Ribonucleic acid ( RNA ) extraction and quantitative real‐time polymerase chain reaction Total RNA from tissues (50 mg) was isolated by Trizol Reagent (TaKaRa, Tokyo, Japan) and plasma samples (200 μL) were isolated using the Blood Total RNA Rapid Extraction Kit (BioTeke, China). .. HOTAIR expression was measured by real time‐polymerase chain reaction (RT‐PCR) using SYBR Green assays (Takara) in a 7500 Fast Real‐Time PCR System (Applied Biosystems, Foster City, CA, USA). β‐actin was used to normalize the relative levels of lncRNA.

Expressing:

Article Title: Circulating long non‐coding HOX transcript antisense intergenic ribonucleic acid in plasma as a potential biomarker for diagnosis of breast cancer
Article Snippet: Ribonucleic acid ( RNA ) extraction and quantitative real‐time polymerase chain reaction Total RNA from tissues (50 mg) was isolated by Trizol Reagent (TaKaRa, Tokyo, Japan) and plasma samples (200 μL) were isolated using the Blood Total RNA Rapid Extraction Kit (BioTeke, China). .. HOTAIR expression was measured by real time‐polymerase chain reaction (RT‐PCR) using SYBR Green assays (Takara) in a 7500 Fast Real‐Time PCR System (Applied Biosystems, Foster City, CA, USA). β‐actin was used to normalize the relative levels of lncRNA.

Article Title: Lipoxin A4 regulates PM2.5-induced severe allergic asthma in mice via the Th1/Th2 balance of group 2 innate lymphoid cells
Article Snippet: Relative expression levels were calculated by the 2-△△Ct method of using the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as an endogenous control for normalization. .. Ribonucleic acid (RNA) extraction (Trizol method), and reverse transcription (Takara, Japan) were followed by the instructions.

Polymerase Chain Reaction:

Article Title: Lipoxin A4 regulates PM2.5-induced severe allergic asthma in mice via the Th1/Th2 balance of group 2 innate lymphoid cells
Article Snippet: Paragraph title: Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) of PBMC ... Ribonucleic acid (RNA) extraction (Trizol method), and reverse transcription (Takara, Japan) were followed by the instructions.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    TaKaRa minibest universal rna extractin kit
    Minibest Universal Rna Extractin Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/minibest universal rna extractin kit/product/TaKaRa
    Average 94 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    minibest universal rna extractin kit - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    94
    TaKaRa total rna extractor
    Total Rna Extractor, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/total rna extractor/product/TaKaRa
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    total rna extractor - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    92
    TaKaRa rnaiso blood extractor reagent
    Rnaiso Blood Extractor Reagent, supplied by TaKaRa, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnaiso blood extractor reagent/product/TaKaRa
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rnaiso blood extractor reagent - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    Image Search Results