revertaidtm h m mulv first strand cdna synthesis kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    First Strand cDNA Synthesis Kit
    Description:
    Thermo Scientific First Strand cDNA Synthesis kit utilizes the recombinant M MuLV Reverse Transcriptase which exhibits lower RNase H activity than AMV reverse transcriptase Due to this feature full length cDNA can be synthesized from RNA templates up to 9 kb The recombinant RiboLock RNase Inhibitor supplied with the kit effectively protects RNA template from degradation The first strand of cDNA can be directly used as a template in PCR or in second strand cDNA synthesis Highlights• Efficient synthesis of first strand cDNA up to 9 kb• Reaction temperature 37°C• Supplied with the recombinant RiboLock RNase Inhibitor• Complete oligo dT 18 and random hexamer primers included with the kitApplications• First strand cDNA synthesis for RT PCR and real time RT PCR• Construction of cDNA libraries• Generation of probes for hybridization• aRNA synthesisThe kit is supplied with both oligo dT 18 and random hexamer primers The oligo dT 18 anneals selectively on the poly A tail of mRNA Random hexamer primers do not require the presence of poly A Therefore they can be used for transcription of the 5 end regions of mRNA or cDNA synthesis using RNA without poly A tail e g micro RNAs Gene specific primers may also be used with the kits
    Catalog Number:
    k1612
    Price:
    None
    Applications:
    Cloning|cDNA Libraries & Library Construction
    Category:
    Kits and Assays
    Buy from Supplier


    Structured Review

    Thermo Fisher revertaidtm h m mulv first strand cdna synthesis kit
    Thermo Scientific First Strand cDNA Synthesis kit utilizes the recombinant M MuLV Reverse Transcriptase which exhibits lower RNase H activity than AMV reverse transcriptase Due to this feature full length cDNA can be synthesized from RNA templates up to 9 kb The recombinant RiboLock RNase Inhibitor supplied with the kit effectively protects RNA template from degradation The first strand of cDNA can be directly used as a template in PCR or in second strand cDNA synthesis Highlights• Efficient synthesis of first strand cDNA up to 9 kb• Reaction temperature 37°C• Supplied with the recombinant RiboLock RNase Inhibitor• Complete oligo dT 18 and random hexamer primers included with the kitApplications• First strand cDNA synthesis for RT PCR and real time RT PCR• Construction of cDNA libraries• Generation of probes for hybridization• aRNA synthesisThe kit is supplied with both oligo dT 18 and random hexamer primers The oligo dT 18 anneals selectively on the poly A tail of mRNA Random hexamer primers do not require the presence of poly A Therefore they can be used for transcription of the 5 end regions of mRNA or cDNA synthesis using RNA without poly A tail e g micro RNAs Gene specific primers may also be used with the kits
    https://www.bioz.com/result/revertaidtm h m mulv first strand cdna synthesis kit/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    revertaidtm h m mulv first strand cdna synthesis kit - by Bioz Stars, 2020-07
    99/100 stars

    Images

    Related Articles

    SYBR Green Assay:

    Article Title: A cell-autonomous requirement for neutral sphingomyelinase 2 in bone mineralization
    Article Snippet: .. The first-strand cDNA synthesis and qRT-PCR were performed using a high-capacity cDNA reverse transcription kit (Applied Biosystems) and SYBR green quantitative PCR master mix (Maxima; Fermentas), respectively. .. The following primer pairs were used: 5′-AGAAACCCGGTCCTCGTACT-3′ and 5′-CCTGACCAGTGCCATTCTTT-3′ for Smpd3 expression and 5′-AAGCAGGAGGGCAATAAGGT-3′ and 5′-CAAGCAGGGTTAAGCTCACA-3′ for Bglap1 expression.

    Article Title: LRIG1 is a pleiotropic androgen receptor-regulated feedback tumor suppressor in prostate cancer
    Article Snippet: .. For qRT-PCR, first-strand cDNA synthesis from total RNA was carried out using SuperScript® III Frist-Strand synthesis kit (Life Technology), and the resulting cDNA was then incubated with iTaq Universal SYBR Green Supermix (BIO-RAD) and the respective mRNA levels were analyzed by qRT-PCR in ABI Prism 7900HT Real-Time PCR detection system by normalizing to human GAPDH or mouse Gapdh. qRT-PCR primers were listed in Supplementary Table . .. Western blotting and quantitative Wes immunoassays Whole cell lysates (WCL) from cells or tumor tissues were prepared in complete RIPA buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.5% Triton X-100) containing protease inhibitor mixture, and the protein concentrations were measured via MicroBCA kit (Pierce).

    Synthesized:

    Article Title: miR-99a-5p acts as tumor suppressor via targeting to mTOR and enhances RAD001-induced apoptosis in human urinary bladder urothelial carcinoma cells
    Article Snippet: .. First-strand cDNA was synthesized from total RNA (2.5 μg) using First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) and oligo dT primers. ..

    Article Title: TLR9 Signaling Is Required for Generation of the Adaptive Immune Protection in Cryptococcus neoformans-Infected Lungs
    Article Snippet: .. Total RNA was prepared using RNeasy Plus Mini Kit (Qiagen, Valencia, CA) and first-strand cDNA was synthesized using SuperScriptIII (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. .. Cytokine mRNA was quantified with SYBR Green-based detection using an MX 3000P system (Stratagene, La Jolla, CA) according to the manufacturer’s protocols.

    Isolation:

    Article Title: AMF1 (GPS2) Modulates p53 Transactivation
    Article Snippet: .. U2OS/AMF1 and U2OS/β-Gal cells were cultured in 60-mm-diameter dishes and treated with etoposide for 0, 4, 8, or 24 h. Total RNA was isolated using TRIZOL reagent (GIBCO/BRL), and 5 μg of total RNA was reverse transcribed with oligo(dT) by using the Thermoscript RT-PCR system for first-strand cDNA synthesis (GIBCO/BRL). .. Five percent of the cDNA product was subjected to PCR with two different pairs of primers: p21 oligonucleotides, 5′-CTCTCATGCTCCAGGTGGCTC-3′ and 5′-CCATAGCCTCTACTGCCACCATCT-3′; GAPDH oligonucleotides, 5′-ACCACAGTCCATGCCATCAC-3′ and 5′-TCCACCACCCTGTTGCTGTA-3′.

    Article Title: First Insights in NK—DC Cross-Talk and the Importance of Soluble Factors During Infection With Aspergillus fumigatus
    Article Snippet: .. Therefore, RNA was isolated from mock silenced and Dectin-1 silenced DCs by RNeasy Mini kit (Qiagen) before cDNA synthesis (First Strand cDNA Synthesis Kit, K1612, Thermo Fisher Scientific) was performed. .. RT-PCR was performed by using iQ™ SYBR® Green Supermix (Biorad) and either Dectin-1 specific primers (forward: CTGGTGATAGCTGTGGTCCTG; reverse primer: AAGAACCCCTGTGGTTTTGACA) or human ALAS specific primers (forward primer: GGCAGCACAGATGAATCAGA; reverse primer: CCTCCATCGGTTTTCACACT).

    Cell Culture:

    Article Title: AMF1 (GPS2) Modulates p53 Transactivation
    Article Snippet: .. U2OS/AMF1 and U2OS/β-Gal cells were cultured in 60-mm-diameter dishes and treated with etoposide for 0, 4, 8, or 24 h. Total RNA was isolated using TRIZOL reagent (GIBCO/BRL), and 5 μg of total RNA was reverse transcribed with oligo(dT) by using the Thermoscript RT-PCR system for first-strand cDNA synthesis (GIBCO/BRL). .. Five percent of the cDNA product was subjected to PCR with two different pairs of primers: p21 oligonucleotides, 5′-CTCTCATGCTCCAGGTGGCTC-3′ and 5′-CCATAGCCTCTACTGCCACCATCT-3′; GAPDH oligonucleotides, 5′-ACCACAGTCCATGCCATCAC-3′ and 5′-TCCACCACCCTGTTGCTGTA-3′.

    Real-time Polymerase Chain Reaction:

    Article Title: A cell-autonomous requirement for neutral sphingomyelinase 2 in bone mineralization
    Article Snippet: .. The first-strand cDNA synthesis and qRT-PCR were performed using a high-capacity cDNA reverse transcription kit (Applied Biosystems) and SYBR green quantitative PCR master mix (Maxima; Fermentas), respectively. .. The following primer pairs were used: 5′-AGAAACCCGGTCCTCGTACT-3′ and 5′-CCTGACCAGTGCCATTCTTT-3′ for Smpd3 expression and 5′-AAGCAGGAGGGCAATAAGGT-3′ and 5′-CAAGCAGGGTTAAGCTCACA-3′ for Bglap1 expression.

    Article Title: LRIG1 is a pleiotropic androgen receptor-regulated feedback tumor suppressor in prostate cancer
    Article Snippet: .. For qRT-PCR, first-strand cDNA synthesis from total RNA was carried out using SuperScript® III Frist-Strand synthesis kit (Life Technology), and the resulting cDNA was then incubated with iTaq Universal SYBR Green Supermix (BIO-RAD) and the respective mRNA levels were analyzed by qRT-PCR in ABI Prism 7900HT Real-Time PCR detection system by normalizing to human GAPDH or mouse Gapdh. qRT-PCR primers were listed in Supplementary Table . .. Western blotting and quantitative Wes immunoassays Whole cell lysates (WCL) from cells or tumor tissues were prepared in complete RIPA buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.5% Triton X-100) containing protease inhibitor mixture, and the protein concentrations were measured via MicroBCA kit (Pierce).

    Article Title: Long Noncoding RNA MEG3 Is an Epigenetic Determinant of Oncogenic Signaling in Functional Pancreatic Neuroendocrine Tumor Cells
    Article Snippet: .. RNA was also converted to cDNA using either the first-strand cDNA synthesis kit (Invitrogen) or the iScript kit (Bio-Rad, Hercules, CA), followed by qPCR for transcript analyses with the SYBR Q-PCR kit (Agilent, Santa Clara, CA). ..

    Incubation:

    Article Title: LRIG1 is a pleiotropic androgen receptor-regulated feedback tumor suppressor in prostate cancer
    Article Snippet: .. For qRT-PCR, first-strand cDNA synthesis from total RNA was carried out using SuperScript® III Frist-Strand synthesis kit (Life Technology), and the resulting cDNA was then incubated with iTaq Universal SYBR Green Supermix (BIO-RAD) and the respective mRNA levels were analyzed by qRT-PCR in ABI Prism 7900HT Real-Time PCR detection system by normalizing to human GAPDH or mouse Gapdh. qRT-PCR primers were listed in Supplementary Table . .. Western blotting and quantitative Wes immunoassays Whole cell lysates (WCL) from cells or tumor tissues were prepared in complete RIPA buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.5% Triton X-100) containing protease inhibitor mixture, and the protein concentrations were measured via MicroBCA kit (Pierce).

    Quantitative RT-PCR:

    Article Title: A cell-autonomous requirement for neutral sphingomyelinase 2 in bone mineralization
    Article Snippet: .. The first-strand cDNA synthesis and qRT-PCR were performed using a high-capacity cDNA reverse transcription kit (Applied Biosystems) and SYBR green quantitative PCR master mix (Maxima; Fermentas), respectively. .. The following primer pairs were used: 5′-AGAAACCCGGTCCTCGTACT-3′ and 5′-CCTGACCAGTGCCATTCTTT-3′ for Smpd3 expression and 5′-AAGCAGGAGGGCAATAAGGT-3′ and 5′-CAAGCAGGGTTAAGCTCACA-3′ for Bglap1 expression.

    Article Title: LRIG1 is a pleiotropic androgen receptor-regulated feedback tumor suppressor in prostate cancer
    Article Snippet: .. For qRT-PCR, first-strand cDNA synthesis from total RNA was carried out using SuperScript® III Frist-Strand synthesis kit (Life Technology), and the resulting cDNA was then incubated with iTaq Universal SYBR Green Supermix (BIO-RAD) and the respective mRNA levels were analyzed by qRT-PCR in ABI Prism 7900HT Real-Time PCR detection system by normalizing to human GAPDH or mouse Gapdh. qRT-PCR primers were listed in Supplementary Table . .. Western blotting and quantitative Wes immunoassays Whole cell lysates (WCL) from cells or tumor tissues were prepared in complete RIPA buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.5% Triton X-100) containing protease inhibitor mixture, and the protein concentrations were measured via MicroBCA kit (Pierce).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: The FlgT Protein Is Involved in Aeromonas hydrophila Polar Flagella Stability and Not Affects Anchorage of Lateral Flagella
    Article Snippet: .. First-strand cDNA synthesis was carried out using the Thermoscript RT-PCR system (Invitrogen) and random primers on 5 μg of total RNA DNase-digested, according to the manufacturer’s instructions. .. PCR without reverse transcriptase was also performed to confirm the absence of contaminating DNA in the RNA sample.

    Article Title: AMF1 (GPS2) Modulates p53 Transactivation
    Article Snippet: .. U2OS/AMF1 and U2OS/β-Gal cells were cultured in 60-mm-diameter dishes and treated with etoposide for 0, 4, 8, or 24 h. Total RNA was isolated using TRIZOL reagent (GIBCO/BRL), and 5 μg of total RNA was reverse transcribed with oligo(dT) by using the Thermoscript RT-PCR system for first-strand cDNA synthesis (GIBCO/BRL). .. Five percent of the cDNA product was subjected to PCR with two different pairs of primers: p21 oligonucleotides, 5′-CTCTCATGCTCCAGGTGGCTC-3′ and 5′-CCATAGCCTCTACTGCCACCATCT-3′; GAPDH oligonucleotides, 5′-ACCACAGTCCATGCCATCAC-3′ and 5′-TCCACCACCCTGTTGCTGTA-3′.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher revertaid h minus m mulv reverse transcriptase first strand cdna synthesis kit
    Revertaid H Minus M Mulv Reverse Transcriptase First Strand Cdna Synthesis Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/revertaid h minus m mulv reverse transcriptase first strand cdna synthesis kit/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    revertaid h minus m mulv reverse transcriptase first strand cdna synthesis kit - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher revertaidtm h m mulv first strand cdna synthesis kit
    Revertaidtm H M Mulv First Strand Cdna Synthesis Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/revertaidtm h m mulv first strand cdna synthesis kit/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    revertaidtm h m mulv first strand cdna synthesis kit - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results