quikchange ii xl site directed mutagenesis kit  (Stratagene)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Stratagene quikchange ii xl site directed mutagenesis kit
    Quikchange Ii Xl Site Directed Mutagenesis Kit, supplied by Stratagene, used in various techniques. Bioz Stars score: 99/100, based on 540 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quikchange ii xl site directed mutagenesis kit/product/Stratagene
    Average 99 stars, based on 540 article reviews
    Price from $9.99 to $1999.99
    quikchange ii xl site directed mutagenesis kit - by Bioz Stars, 2020-01
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: ESR1 ligand binding domain mutations in hormone-resistant breast cancer
    Article Snippet: Paragraph title: Cloning and Mutagenesis ... Point mutations were introduced into pEGFP-C1-ERα, pcDNA-HA-ERα and pSIN-TREtight-HA-ERα using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) as indicated in the manufacturer’s instructions.

    Article Title: A Hox regulatory network of hindbrain segmentation is conserved to the base of vertebrates
    Article Snippet: The 12kb intergenic region between lamprey Hox2 and Hox3 of the Pm1 cluster was cloned into HLC by homologous capture from lamprey BAC 218A09 (L6) following previously described recombineering methods and using the following homology arm sequences (homology arms indicated in bold): Arm 1 5’-GGGCCC GTACACGGACCTGTCGTCTCATCACCACCCGACTCAGGAAGT ACTAGT-3’ Arm 2 5’- ACACCCCCCCCCCTCCTCGCTCAGTGCTCCGTCAAGGCAG CCATGG-3’ Shorter fragments of this intergenic region were subsequently generated from the captured 12kb sequence by standard restriction enzyme-mediated cloning approaches. .. Site-directed mutagenesis was performed on the Hoxb3(zf) HLC construct using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) and the primers listed below.

    Article Title: Evaluation of Aminoglycoside and Non-Aminoglycoside Compounds for Stop-Codon Readthrough Therapy in Four Lysosomal Storage Diseases
    Article Snippet: .. Site-directed mutagenesis The nonsense mutations were introduced in the wild type full-length cDNA of the corresponding gene cloned in the pcDNA3.1 expression vector by PCR-based site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene Cloning Systems, La Jolla, CA, USA), according to the manufacturer’s instructions. .. All constructs were resequenced to ensure that no spurious mutations had been introduced.

    Article Title: Pathogenic LRRK2 negatively regulates microRNA-mediated translational repression
    Article Snippet: Paragraph title: DNA cloning, Transfection and Reporter Assays ... Introduction of desired point mutations was performed using QuikChange II XL Site-directed mutagenesis kit (Stratagene).

    Article Title: A tRNA-derived small RNA regulates ribosome biogenesis
    Article Snippet: The full-length RPS9, 14, 15, 28 protein sequences were cloned into the pcDNA3.3 plasmid. .. Site-directed mutagenesis was performed with the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) to generate point mutations or deletions in the recombinant RPS9, 14, 15, and 28 genes (primers in ).

    Article Title: Interactions among HCLS1, HAX1 and LEF-1 proteins are essential for G-CSF-triggered granulopoiesis
    Article Snippet: We cloned human genomic DNA encompassing upstream regions of LEF1 (3,600 bp) or HCLS1 (1,600 bp) into a promoter-less luciferase construct, pGL4 Basic (Promega). .. We introduced point mutations into LEF-1–binding sites of LEF1 , HCLS1 and CEBPA promoter constructs using the QuikChange II XL site-directed mutagenesis kit from Stratagene.

    Article Title: miR-34a Blocks Osteoporosis and Bone Metastasis by Inhibiting Osteoclastogenesis and Tgif2
    Article Snippet: To generate a CMV-Luc-3′UTR reporter, a ~300bp Tgif2 3′UTR region centering the miR-34a target sequence was cloned into the pMIR-REPORT™ vector (Life Technologies) downstream of the luciferase open reading frame. .. To generate a mutant reporter with miss-matched miR-34a binding site, the miR-34a target sequence was altered using QuikChange II XL site-directed mutagenesis kit (Stratagene).

    Luciferase:

    Article Title: LncRNA CAIF inhibits autophagy and attenuates myocardial infarction by blocking p53-mediated myocardin transcription
    Article Snippet: The myocardin promoter luciferase reporter plasmid pGL4.17-Mycd was constructed by ligating the myocardin promoter region into the pGL4.17 vector (Promega). .. Site-directed mutagenesis in the putative p53-binding site was performed using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene).

    Article Title: Interactions among HCLS1, HAX1 and LEF-1 proteins are essential for G-CSF-triggered granulopoiesis
    Article Snippet: Paragraph title: Promoter constructs and luciferase assays for LEF1 , HCLS1 , CEBPA and CCND1 gene promoter activity ... We introduced point mutations into LEF-1–binding sites of LEF1 , HCLS1 and CEBPA promoter constructs using the QuikChange II XL site-directed mutagenesis kit from Stratagene.

    Article Title: miR-34a Blocks Osteoporosis and Bone Metastasis by Inhibiting Osteoclastogenesis and Tgif2
    Article Snippet: To generate a CMV-Luc-3′UTR reporter, a ~300bp Tgif2 3′UTR region centering the miR-34a target sequence was cloned into the pMIR-REPORT™ vector (Life Technologies) downstream of the luciferase open reading frame. .. To generate a mutant reporter with miss-matched miR-34a binding site, the miR-34a target sequence was altered using QuikChange II XL site-directed mutagenesis kit (Stratagene).

    Reporter Assay:

    Article Title: miR-34a Blocks Osteoporosis and Bone Metastasis by Inhibiting Osteoclastogenesis and Tgif2
    Article Snippet: Fourth, we performed luciferase reporter assay to test if the 3′UTR of each tertiary target could directly suppress gene expression in response to miR-34a. .. To generate a mutant reporter with miss-matched miR-34a binding site, the miR-34a target sequence was altered using QuikChange II XL site-directed mutagenesis kit (Stratagene).

    Positive Control:

    Article Title: Stimulating the RIG-I pathway to kill cells in the latent HIV reservoir following viral reactivation
    Article Snippet: Using the Quikchange II XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla CA), we mutated a region of gag from amino acids 1404 to 1432 ( ). .. To confirm infectivity of GM-HIV, we first infected 0.5×106 TZM-bl cells with 1 ng of p24 supernatant from pGM-HIV plus gag expression vector, the same volume of supernatant from pGM-HIV plus empty vector, and 1 ng of p24 of HIV-1(NL-4-3) as a positive control.

    Synthesized:

    Article Title: TNF receptor 1 genetic risk mirrors outcome of anti-TNF therapy in multiple sclerosis
    Article Snippet: Site-directed mutagenesis was performed using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene). .. RNA was isolated from HEK 293T cells (ATCC) using the RNeasy Micro Kit (Qiagen) and cDNA was synthesized using the High Capacity RNA-to-cDNA Kit (Applied Biosystems), according to the manufacturer’s instructions.

    Construct:

    Article Title: A Hox regulatory network of hindbrain segmentation is conserved to the base of vertebrates
    Article Snippet: .. Site-directed mutagenesis was performed on the Hoxb3(zf) HLC construct using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) and the primers listed below. ..

    Article Title: Evaluation of Aminoglycoside and Non-Aminoglycoside Compounds for Stop-Codon Readthrough Therapy in Four Lysosomal Storage Diseases
    Article Snippet: Site-directed mutagenesis The nonsense mutations were introduced in the wild type full-length cDNA of the corresponding gene cloned in the pcDNA3.1 expression vector by PCR-based site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene Cloning Systems, La Jolla, CA, USA), according to the manufacturer’s instructions. .. All constructs were resequenced to ensure that no spurious mutations had been introduced.

    Article Title: Animal cryptochromes mediate magnetoreception by an unconventional photochemical mechanism
    Article Snippet: .. To generate the UAS-dpcry1 W328F and UAS-dpcry2 W345F transgenic lines, the tryptophan to phenylalanine mutations were introduced into the pUAST- dpcry1 and pUAST- dpcry2 constructs, respectively, using the Stratagene QuikChange II XL Site-Directed Mutagenesis kit. .. The mutated open reading frames were PCR amplified and subcloned into the KpnI and XbaI sites of new pUAST vectors to ensure that there were no vector mutations.

    Article Title: LncRNA CAIF inhibits autophagy and attenuates myocardial infarction by blocking p53-mediated myocardin transcription
    Article Snippet: The myocardin promoter luciferase reporter plasmid pGL4.17-Mycd was constructed by ligating the myocardin promoter region into the pGL4.17 vector (Promega). .. Site-directed mutagenesis in the putative p53-binding site was performed using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene).

    Article Title: A tRNA-derived small RNA regulates ribosome biogenesis
    Article Snippet: Paragraph title: Plasmid constructs ... Site-directed mutagenesis was performed with the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) to generate point mutations or deletions in the recombinant RPS9, 14, 15, and 28 genes (primers in ).

    Article Title: TNF receptor 1 genetic risk mirrors outcome of anti-TNF therapy in multiple sclerosis
    Article Snippet: Minigene assays TNFRSF1A minigene constructs were made using a ~1.5 kb genomic region comprising rs1800693 and spanning the region from introns 5 to 8. .. Site-directed mutagenesis was performed using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene).

    Article Title: Interactions among HCLS1, HAX1 and LEF-1 proteins are essential for G-CSF-triggered granulopoiesis
    Article Snippet: .. We introduced point mutations into LEF-1–binding sites of LEF1 , HCLS1 and CEBPA promoter constructs using the QuikChange II XL site-directed mutagenesis kit from Stratagene. .. Reporter plasmids along with pCMV-Renilla and expression plasmids containing cDNA or shRNA, as indicated in each experiment, were transfected into HEK293T cells using Lipofectamine or into CD34+ cells using Gene Pulser MXcell electroporation system and transfection reagent (Bio-Rad) according to the manufacturer's instructions.

    Article Title: Telomerase RNA biogenesis involves sequential binding by Sm and Lsm complexes
    Article Snippet: Paragraph title: Yeast strains and constructs ... Other ter1 mutants were generated in the context of plasmid pJW10 using the QuikChange II XL site-directed mutagenesis kit (Stratagene) and introduced into PP407, PP694 or PP695 as described .

    Incubation:

    Article Title: Interactions among HCLS1, HAX1 and LEF-1 proteins are essential for G-CSF-triggered granulopoiesis
    Article Snippet: We introduced point mutations into LEF-1–binding sites of LEF1 , HCLS1 and CEBPA promoter constructs using the QuikChange II XL site-directed mutagenesis kit from Stratagene. .. Transfected CD34+ cells were incubated with or without 10 ng/ml of rhG-CSF.

    Amplification:

    Article Title: Animal cryptochromes mediate magnetoreception by an unconventional photochemical mechanism
    Article Snippet: For generating UAS-dcryW342F transgenic lines, the dcry open reading frame containing a W342F mutation was PCR amplified from pAC5.1V5/His- dcry W342F and subcloned into the XhoI and XbaI sites of the pUAST vector. .. To generate the UAS-dpcry1 W328F and UAS-dpcry2 W345F transgenic lines, the tryptophan to phenylalanine mutations were introduced into the pUAST- dpcry1 and pUAST- dpcry2 constructs, respectively, using the Stratagene QuikChange II XL Site-Directed Mutagenesis kit.

    Article Title: LncRNA CAIF inhibits autophagy and attenuates myocardial infarction by blocking p53-mediated myocardin transcription
    Article Snippet: Construction of mouse myocardin promoter The myocardin promoter was amplified from mouse genomic DNA by PCR. .. Site-directed mutagenesis in the putative p53-binding site was performed using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene).

    Article Title: A tRNA-derived small RNA regulates ribosome biogenesis
    Article Snippet: The full-length RPS28 gene was amplified with primers (5′-ctctccgccagaccgccgc-3′ and 5′-tttttttttttttttttttttaacttgaaacacaaacgctt-3′). .. Site-directed mutagenesis was performed with the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) to generate point mutations or deletions in the recombinant RPS9, 14, 15, and 28 genes (primers in ).

    Article Title: TNF receptor 1 genetic risk mirrors outcome of anti-TNF therapy in multiple sclerosis
    Article Snippet: Site-directed mutagenesis was performed using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene). .. Minigene splicing was analyzed by PCR amplification of cDNA using primers specific to the SD and SA sites.

    Article Title: Pathogenic LRRK2 negatively regulates microRNA-mediated translational repression
    Article Snippet: For the generation of pre-miRNA transgenic flies, genomic DNA containing the precursor sequences were amplified and subcloned into the appropriate restrictions sites of pUAST . .. Mutations at nt82 of the 5′UTR and nt891 of the CDS (see for the mutations made) were introduced using QuikChange II XL Site-directed mutagenesis kit (Stratagene).

    Activity Assay:

    Article Title: Interactions among HCLS1, HAX1 and LEF-1 proteins are essential for G-CSF-triggered granulopoiesis
    Article Snippet: Paragraph title: Promoter constructs and luciferase assays for LEF1 , HCLS1 , CEBPA and CCND1 gene promoter activity ... We introduced point mutations into LEF-1–binding sites of LEF1 , HCLS1 and CEBPA promoter constructs using the QuikChange II XL site-directed mutagenesis kit from Stratagene.

    Article Title: miR-34a Blocks Osteoporosis and Bone Metastasis by Inhibiting Osteoclastogenesis and Tgif2
    Article Snippet: To generate a mutant reporter with miss-matched miR-34a binding site, the miR-34a target sequence was altered using QuikChange II XL site-directed mutagenesis kit (Stratagene). .. Luciferase activity was normalized by β-gal activity.

    Expressing:

    Article Title: Evaluation of Aminoglycoside and Non-Aminoglycoside Compounds for Stop-Codon Readthrough Therapy in Four Lysosomal Storage Diseases
    Article Snippet: .. Site-directed mutagenesis The nonsense mutations were introduced in the wild type full-length cDNA of the corresponding gene cloned in the pcDNA3.1 expression vector by PCR-based site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene Cloning Systems, La Jolla, CA, USA), according to the manufacturer’s instructions. .. All constructs were resequenced to ensure that no spurious mutations had been introduced.

    Article Title: Pathogenic LRRK2 negatively regulates microRNA-mediated translational repression
    Article Snippet: Introduction of desired point mutations was performed using QuikChange II XL Site-directed mutagenesis kit (Stratagene). .. To generate mammalian expression vectors encoding d4E-BP(WT), d4E-BP(TA), and d4E-BP(TE), the appropriate cDNA fragments were cleaved with Eco RI/ Xho I from the pUAST vectors used to generate the corresponding transgenic animals and subcloned into the same restriction sites into the pcDNA3-Nmyc vector.

    Article Title: Stimulating the RIG-I pathway to kill cells in the latent HIV reservoir following viral reactivation
    Article Snippet: Using the Quikchange II XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla CA), we mutated a region of gag from amino acids 1404 to 1432 ( ). .. To generate GM-HIV capable of only a single round of infection, we co-transfected 293T cells with the pGM-HIV clone and a plasmid expressing wild-type gag , only pGM-HIV plus gag expressing vector can produce p24 into supernatant ( ).

    Article Title: Interactions among HCLS1, HAX1 and LEF-1 proteins are essential for G-CSF-triggered granulopoiesis
    Article Snippet: We introduced point mutations into LEF-1–binding sites of LEF1 , HCLS1 and CEBPA promoter constructs using the QuikChange II XL site-directed mutagenesis kit from Stratagene. .. Reporter plasmids along with pCMV-Renilla and expression plasmids containing cDNA or shRNA, as indicated in each experiment, were transfected into HEK293T cells using Lipofectamine or into CD34+ cells using Gene Pulser MXcell electroporation system and transfection reagent (Bio-Rad) according to the manufacturer's instructions.

    Article Title: miR-34a Blocks Osteoporosis and Bone Metastasis by Inhibiting Osteoclastogenesis and Tgif2
    Article Snippet: Fourth, we performed luciferase reporter assay to test if the 3′UTR of each tertiary target could directly suppress gene expression in response to miR-34a. .. To generate a mutant reporter with miss-matched miR-34a binding site, the miR-34a target sequence was altered using QuikChange II XL site-directed mutagenesis kit (Stratagene).

    Article Title: Telomerase RNA biogenesis involves sequential binding by Sm and Lsm complexes
    Article Snippet: Strains expressing c-Myc-tagged Sm and Lsm proteins were constructed in strain PP138 as described . .. Other ter1 mutants were generated in the context of plasmid pJW10 using the QuikChange II XL site-directed mutagenesis kit (Stratagene) and introduced into PP407, PP694 or PP695 as described .

    Electroporation:

    Article Title: Interactions among HCLS1, HAX1 and LEF-1 proteins are essential for G-CSF-triggered granulopoiesis
    Article Snippet: We introduced point mutations into LEF-1–binding sites of LEF1 , HCLS1 and CEBPA promoter constructs using the QuikChange II XL site-directed mutagenesis kit from Stratagene. .. Reporter plasmids along with pCMV-Renilla and expression plasmids containing cDNA or shRNA, as indicated in each experiment, were transfected into HEK293T cells using Lipofectamine or into CD34+ cells using Gene Pulser MXcell electroporation system and transfection reagent (Bio-Rad) according to the manufacturer's instructions.

    Transfection:

    Article Title: Pathogenic LRRK2 negatively regulates microRNA-mediated translational repression
    Article Snippet: Paragraph title: DNA cloning, Transfection and Reporter Assays ... Introduction of desired point mutations was performed using QuikChange II XL Site-directed mutagenesis kit (Stratagene).

    Article Title: Interactions among HCLS1, HAX1 and LEF-1 proteins are essential for G-CSF-triggered granulopoiesis
    Article Snippet: We introduced point mutations into LEF-1–binding sites of LEF1 , HCLS1 and CEBPA promoter constructs using the QuikChange II XL site-directed mutagenesis kit from Stratagene. .. Reporter plasmids along with pCMV-Renilla and expression plasmids containing cDNA or shRNA, as indicated in each experiment, were transfected into HEK293T cells using Lipofectamine or into CD34+ cells using Gene Pulser MXcell electroporation system and transfection reagent (Bio-Rad) according to the manufacturer's instructions.

    Article Title: miR-34a Blocks Osteoporosis and Bone Metastasis by Inhibiting Osteoclastogenesis and Tgif2
    Article Snippet: To generate a mutant reporter with miss-matched miR-34a binding site, the miR-34a target sequence was altered using QuikChange II XL site-directed mutagenesis kit (Stratagene). .. The reporters were co-transfected with CMV-β-gal (as an internal transfection control), together with pre-miR-34a or pre-miR-control, anti-miR-34a or anti-miR-control using FuGENE HD reagent (Roche).

    Ligation:

    Article Title: Pathogenic LRRK2 negatively regulates microRNA-mediated translational repression
    Article Snippet: To generate Drosophila dp genomic transgenes, we performed a triple ligation of dp 5′UTR as a Hin dIII- Sac I fragment and dp CDS as a Sac I- Xho I fragment into the Hin dIII- Xho I sites of pcDNA3.1/myc-His . .. Mutations at nt82 of the 5′UTR and nt891 of the CDS (see for the mutations made) were introduced using QuikChange II XL Site-directed mutagenesis kit (Stratagene).

    Infection:

    Article Title: Stimulating the RIG-I pathway to kill cells in the latent HIV reservoir following viral reactivation
    Article Snippet: Paragraph title: Generation of GM-HIV for single-round HIV infection ... Using the Quikchange II XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla CA), we mutated a region of gag from amino acids 1404 to 1432 ( ).

    Generated:

    Article Title: Clonal evolution mechanisms in NT5C2 mutant relapsed acute lymphoblastic leukemia
    Article Snippet: .. We generated the NT5C2 p.R238W, p.K359Q, p.R367Q and p.D407A mutations in the pLOC-NT5C2 plasmid by site directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis kit (Stratagene) according to the manufacturer’s instructions. .. We transfected retroviral or lentiviral plasmids together with gag-pol (pCMV ΔR8.91) and V-SVG (pMD.G VSVG) expressing vectors into 293T cells using JetPEI transfection reagent (Polyplus).

    Article Title: A Hox regulatory network of hindbrain segmentation is conserved to the base of vertebrates
    Article Snippet: The 12kb intergenic region between lamprey Hox2 and Hox3 of the Pm1 cluster was cloned into HLC by homologous capture from lamprey BAC 218A09 (L6) following previously described recombineering methods and using the following homology arm sequences (homology arms indicated in bold): Arm 1 5’-GGGCCC GTACACGGACCTGTCGTCTCATCACCACCCGACTCAGGAAGT ACTAGT-3’ Arm 2 5’- ACACCCCCCCCCCTCCTCGCTCAGTGCTCCGTCAAGGCAG CCATGG-3’ Shorter fragments of this intergenic region were subsequently generated from the captured 12kb sequence by standard restriction enzyme-mediated cloning approaches. .. Site-directed mutagenesis was performed on the Hoxb3(zf) HLC construct using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) and the primers listed below.

    Article Title: Pathogenic LRRK2 negatively regulates microRNA-mediated translational repression
    Article Snippet: Introduction of desired point mutations was performed using QuikChange II XL Site-directed mutagenesis kit (Stratagene). .. Kinase-dead forms of dLRRK/LRRK2 (3KD) were generated by introduction of triple mutations (K1781M, D1882A and D1912A in dLRRK; K1906M, D1994A and D2017A in hLRRK2).

    Article Title: A tRNA-derived small RNA regulates ribosome biogenesis
    Article Snippet: C-terminal flag tagged containing RPS28 sequences were generated using site-directed mutagenesis. .. Site-directed mutagenesis was performed with the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) to generate point mutations or deletions in the recombinant RPS9, 14, 15, and 28 genes (primers in ).

    Article Title: Clonal evolution mechanisms in NT5C2 mutant relapsed acute lymphoblastic leukemia
    Article Snippet: .. We generated the NT5C2 p.R238W, p.K359Q, p.R367Q and p.D407A mutations in the pLOC-NT5C2 plasmid by site directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis kit (Stratagene) according to the manufacturer’s instructions. .. Retroviral and lentiviral infections We transfected retroviral or lentiviral plasmids together with gag-pol (pCMV ΔR8.91) and V-SVG (pMD.G VSVG) expressing vectors into 293T cells using JetPEI transfection reagent (Polyplus).

    Article Title: Telomerase RNA biogenesis involves sequential binding by Sm and Lsm complexes
    Article Snippet: .. Other ter1 mutants were generated in the context of plasmid pJW10 using the QuikChange II XL site-directed mutagenesis kit (Stratagene) and introduced into PP407, PP694 or PP695 as described . .. Yeast two-hybrid Yeast two-hybrid was conducted using the Matchmaker GAL4 Two Hybrid System 3 (Clontech).

    Sequencing:

    Article Title: A Hox regulatory network of hindbrain segmentation is conserved to the base of vertebrates
    Article Snippet: The 12kb intergenic region between lamprey Hox2 and Hox3 of the Pm1 cluster was cloned into HLC by homologous capture from lamprey BAC 218A09 (L6) following previously described recombineering methods and using the following homology arm sequences (homology arms indicated in bold): Arm 1 5’-GGGCCC GTACACGGACCTGTCGTCTCATCACCACCCGACTCAGGAAGT ACTAGT-3’ Arm 2 5’- ACACCCCCCCCCCTCCTCGCTCAGTGCTCCGTCAAGGCAG CCATGG-3’ Shorter fragments of this intergenic region were subsequently generated from the captured 12kb sequence by standard restriction enzyme-mediated cloning approaches. .. Site-directed mutagenesis was performed on the Hoxb3(zf) HLC construct using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) and the primers listed below.

    Article Title: Animal cryptochromes mediate magnetoreception by an unconventional photochemical mechanism
    Article Snippet: To generate the UAS-dpcry1 W328F and UAS-dpcry2 W345F transgenic lines, the tryptophan to phenylalanine mutations were introduced into the pUAST- dpcry1 and pUAST- dpcry2 constructs, respectively, using the Stratagene QuikChange II XL Site-Directed Mutagenesis kit. .. All constructs contain a full Kozak sequence.

    Article Title: Pathogenic LRRK2 negatively regulates microRNA-mediated translational repression
    Article Snippet: Human LRRK2 cDNA was purchased from Origene and FLAG-tag sequence was added at the C-terminus. dLRRK cDNA was also inserted into the pcDNA5/FRT vector. .. Introduction of desired point mutations was performed using QuikChange II XL Site-directed mutagenesis kit (Stratagene).

    Article Title: Stimulating the RIG-I pathway to kill cells in the latent HIV reservoir following viral reactivation
    Article Snippet: Using the Quikchange II XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla CA), we mutated a region of gag from amino acids 1404 to 1432 ( ). .. The sequence-verified mutated gag was re-cloned into pNL4-3 to make pGM-HIV.

    Article Title: miR-34a Blocks Osteoporosis and Bone Metastasis by Inhibiting Osteoclastogenesis and Tgif2
    Article Snippet: .. To generate a mutant reporter with miss-matched miR-34a binding site, the miR-34a target sequence was altered using QuikChange II XL site-directed mutagenesis kit (Stratagene). .. The reporters were co-transfected with CMV-β-gal (as an internal transfection control), together with pre-miR-34a or pre-miR-control, anti-miR-34a or anti-miR-control using FuGENE HD reagent (Roche).

    Injection:

    Article Title: Animal cryptochromes mediate magnetoreception by an unconventional photochemical mechanism
    Article Snippet: To generate the UAS-dpcry1 W328F and UAS-dpcry2 W345F transgenic lines, the tryptophan to phenylalanine mutations were introduced into the pUAST- dpcry1 and pUAST- dpcry2 constructs, respectively, using the Stratagene QuikChange II XL Site-Directed Mutagenesis kit. .. All constructs were sequenced prior to injection into w1118 embryos by Genetic Services.

    Recombinant:

    Article Title: A tRNA-derived small RNA regulates ribosome biogenesis
    Article Snippet: .. Site-directed mutagenesis was performed with the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) to generate point mutations or deletions in the recombinant RPS9, 14, 15, and 28 genes (primers in ). ..

    Mutagenesis:

    Article Title: ESR1 ligand binding domain mutations in hormone-resistant breast cancer
    Article Snippet: .. Point mutations were introduced into pEGFP-C1-ERα, pcDNA-HA-ERα and pSIN-TREtight-HA-ERα using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) as indicated in the manufacturer’s instructions. ..

    Article Title: Clonal evolution mechanisms in NT5C2 mutant relapsed acute lymphoblastic leukemia
    Article Snippet: .. We generated the NT5C2 p.R238W, p.K359Q, p.R367Q and p.D407A mutations in the pLOC-NT5C2 plasmid by site directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis kit (Stratagene) according to the manufacturer’s instructions. .. We transfected retroviral or lentiviral plasmids together with gag-pol (pCMV ΔR8.91) and V-SVG (pMD.G VSVG) expressing vectors into 293T cells using JetPEI transfection reagent (Polyplus).

    Article Title: A Hox regulatory network of hindbrain segmentation is conserved to the base of vertebrates
    Article Snippet: .. Site-directed mutagenesis was performed on the Hoxb3(zf) HLC construct using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) and the primers listed below. ..

    Article Title: Evaluation of Aminoglycoside and Non-Aminoglycoside Compounds for Stop-Codon Readthrough Therapy in Four Lysosomal Storage Diseases
    Article Snippet: .. Site-directed mutagenesis The nonsense mutations were introduced in the wild type full-length cDNA of the corresponding gene cloned in the pcDNA3.1 expression vector by PCR-based site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene Cloning Systems, La Jolla, CA, USA), according to the manufacturer’s instructions. .. All constructs were resequenced to ensure that no spurious mutations had been introduced.

    Article Title: Animal cryptochromes mediate magnetoreception by an unconventional photochemical mechanism
    Article Snippet: .. To generate the UAS-dpcry1 W328F and UAS-dpcry2 W345F transgenic lines, the tryptophan to phenylalanine mutations were introduced into the pUAST- dpcry1 and pUAST- dpcry2 constructs, respectively, using the Stratagene QuikChange II XL Site-Directed Mutagenesis kit. .. The mutated open reading frames were PCR amplified and subcloned into the KpnI and XbaI sites of new pUAST vectors to ensure that there were no vector mutations.

    Article Title: Pathogenic LRRK2 negatively regulates microRNA-mediated translational repression
    Article Snippet: .. Introduction of desired point mutations was performed using QuikChange II XL Site-directed mutagenesis kit (Stratagene). .. Kinase-dead forms of dLRRK/LRRK2 (3KD) were generated by introduction of triple mutations (K1781M, D1882A and D1912A in dLRRK; K1906M, D1994A and D2017A in hLRRK2).

    Article Title: LncRNA CAIF inhibits autophagy and attenuates myocardial infarction by blocking p53-mediated myocardin transcription
    Article Snippet: .. Site-directed mutagenesis in the putative p53-binding site was performed using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene). .. Luciferase activity assay Dual-Luciferase Reporter Assay System (Promega) was used to perform luciferase activity assay according to the manufacturer’s instructions.

    Article Title: A tRNA-derived small RNA regulates ribosome biogenesis
    Article Snippet: .. Site-directed mutagenesis was performed with the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) to generate point mutations or deletions in the recombinant RPS9, 14, 15, and 28 genes (primers in ). ..

    Article Title: Stimulating the RIG-I pathway to kill cells in the latent HIV reservoir following viral reactivation
    Article Snippet: .. Using the Quikchange II XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla CA), we mutated a region of gag from amino acids 1404 to 1432 ( ). .. The sequence-verified mutated gag was re-cloned into pNL4-3 to make pGM-HIV.

    Article Title: TNF receptor 1 genetic risk mirrors outcome of anti-TNF therapy in multiple sclerosis
    Article Snippet: .. Site-directed mutagenesis was performed using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene). .. RNA was isolated from HEK 293T cells (ATCC) using the RNeasy Micro Kit (Qiagen) and cDNA was synthesized using the High Capacity RNA-to-cDNA Kit (Applied Biosystems), according to the manufacturer’s instructions.

    Article Title: Pathogenic LRRK2 negatively regulates microRNA-mediated translational repression
    Article Snippet: .. Mutations at nt82 of the 5′UTR and nt891 of the CDS (see for the mutations made) were introduced using QuikChange II XL Site-directed mutagenesis kit (Stratagene). .. At the same time we amplified the previously cloned wild type and mutant dp 3′UTRs from pRL-TK-dp3 ′ UTRwt and pRL-TK-dp3 ′ UTR743 as Xho I- Xba I fragments (see for the mutations introduced into dp3 ′ UTR ).

    Article Title: Interactions among HCLS1, HAX1 and LEF-1 proteins are essential for G-CSF-triggered granulopoiesis
    Article Snippet: .. We introduced point mutations into LEF-1–binding sites of LEF1 , HCLS1 and CEBPA promoter constructs using the QuikChange II XL site-directed mutagenesis kit from Stratagene. .. Reporter plasmids along with pCMV-Renilla and expression plasmids containing cDNA or shRNA, as indicated in each experiment, were transfected into HEK293T cells using Lipofectamine or into CD34+ cells using Gene Pulser MXcell electroporation system and transfection reagent (Bio-Rad) according to the manufacturer's instructions.

    Article Title: Clonal evolution mechanisms in NT5C2 mutant relapsed acute lymphoblastic leukemia
    Article Snippet: .. We generated the NT5C2 p.R238W, p.K359Q, p.R367Q and p.D407A mutations in the pLOC-NT5C2 plasmid by site directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis kit (Stratagene) according to the manufacturer’s instructions. .. Retroviral and lentiviral infections We transfected retroviral or lentiviral plasmids together with gag-pol (pCMV ΔR8.91) and V-SVG (pMD.G VSVG) expressing vectors into 293T cells using JetPEI transfection reagent (Polyplus).

    Article Title: miR-34a Blocks Osteoporosis and Bone Metastasis by Inhibiting Osteoclastogenesis and Tgif2
    Article Snippet: .. To generate a mutant reporter with miss-matched miR-34a binding site, the miR-34a target sequence was altered using QuikChange II XL site-directed mutagenesis kit (Stratagene). .. The reporters were co-transfected with CMV-β-gal (as an internal transfection control), together with pre-miR-34a or pre-miR-control, anti-miR-34a or anti-miR-control using FuGENE HD reagent (Roche).

    Article Title: Telomerase RNA biogenesis involves sequential binding by Sm and Lsm complexes
    Article Snippet: .. Other ter1 mutants were generated in the context of plasmid pJW10 using the QuikChange II XL site-directed mutagenesis kit (Stratagene) and introduced into PP407, PP694 or PP695 as described . .. Yeast two-hybrid Yeast two-hybrid was conducted using the Matchmaker GAL4 Two Hybrid System 3 (Clontech).

    Isolation:

    Article Title: TNF receptor 1 genetic risk mirrors outcome of anti-TNF therapy in multiple sclerosis
    Article Snippet: Site-directed mutagenesis was performed using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene). .. RNA was isolated from HEK 293T cells (ATCC) using the RNeasy Micro Kit (Qiagen) and cDNA was synthesized using the High Capacity RNA-to-cDNA Kit (Applied Biosystems), according to the manufacturer’s instructions.

    Subcloning:

    Article Title: Stimulating the RIG-I pathway to kill cells in the latent HIV reservoir following viral reactivation
    Article Snippet: We excised the gag region from pNL4-3 (NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH, courtesy of Dr. Malcolm Martin) by restriction digest with BssHII (711) and SpeI (1507) subcloning this region into the pcDNA3.1 TOPO TA vector (Life Technologies, Grand Island, NY). .. Using the Quikchange II XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla CA), we mutated a region of gag from amino acids 1404 to 1432 ( ).

    Polymerase Chain Reaction:

    Article Title: ESR1 ligand binding domain mutations in hormone-resistant breast cancer
    Article Snippet: Cloning and Mutagenesis An HA tag was inserted onto the 5′ end of ERα by PCR-amplifying it from pEGFP-C1-ERα using primers as stated in . .. Point mutations were introduced into pEGFP-C1-ERα, pcDNA-HA-ERα and pSIN-TREtight-HA-ERα using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) as indicated in the manufacturer’s instructions.

    Article Title: A Hox regulatory network of hindbrain segmentation is conserved to the base of vertebrates
    Article Snippet: PCR-purified enhancer elements were cloned into HLC using either standard restriction enzyme-mediated methods or by first cloning PCR products into the pCR8/GW/TOPO TA vector (Invitrogen) followed by transfer into a Gateway-compatible variant of HLC (HLC-GW ) via in vitro recombination using the Gateway LR-Clonase II enzyme (Invitrogen). .. Site-directed mutagenesis was performed on the Hoxb3(zf) HLC construct using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) and the primers listed below.

    Article Title: Evaluation of Aminoglycoside and Non-Aminoglycoside Compounds for Stop-Codon Readthrough Therapy in Four Lysosomal Storage Diseases
    Article Snippet: .. Site-directed mutagenesis The nonsense mutations were introduced in the wild type full-length cDNA of the corresponding gene cloned in the pcDNA3.1 expression vector by PCR-based site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene Cloning Systems, La Jolla, CA, USA), according to the manufacturer’s instructions. .. All constructs were resequenced to ensure that no spurious mutations had been introduced.

    Article Title: Animal cryptochromes mediate magnetoreception by an unconventional photochemical mechanism
    Article Snippet: For generating UAS-dcryW342F transgenic lines, the dcry open reading frame containing a W342F mutation was PCR amplified from pAC5.1V5/His- dcry W342F and subcloned into the XhoI and XbaI sites of the pUAST vector. .. To generate the UAS-dpcry1 W328F and UAS-dpcry2 W345F transgenic lines, the tryptophan to phenylalanine mutations were introduced into the pUAST- dpcry1 and pUAST- dpcry2 constructs, respectively, using the Stratagene QuikChange II XL Site-Directed Mutagenesis kit.

    Article Title: LncRNA CAIF inhibits autophagy and attenuates myocardial infarction by blocking p53-mediated myocardin transcription
    Article Snippet: Construction of mouse myocardin promoter The myocardin promoter was amplified from mouse genomic DNA by PCR. .. Site-directed mutagenesis in the putative p53-binding site was performed using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene).

    Article Title: TNF receptor 1 genetic risk mirrors outcome of anti-TNF therapy in multiple sclerosis
    Article Snippet: Site-directed mutagenesis was performed using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene). .. Minigene splicing was analyzed by PCR amplification of cDNA using primers specific to the SD and SA sites.

    Article Title: Pathogenic LRRK2 negatively regulates microRNA-mediated translational repression
    Article Snippet: Subsequently, we used pRL-TKlet7A as template and amplified the existing two incomplete let-7 binding sites as Xba I- Not I and Not I- Xba I fragments, with restriction sites added to the PCR primers to facilitate cloning. .. Mutations at nt82 of the 5′UTR and nt891 of the CDS (see for the mutations made) were introduced using QuikChange II XL Site-directed mutagenesis kit (Stratagene).

    shRNA:

    Article Title: Clonal evolution mechanisms in NT5C2 mutant relapsed acute lymphoblastic leukemia
    Article Snippet: We obtained MigR1_Δ-E NOTCH1_GFP from R. Kopan (Cincinnati Children’s Hospital Medical Center, University of Cincinnati), sh-TURBOGFP and pLKO.1_IMPDH2_shRNA (clone ID: .1-360s1c1) from Sigma Aldrich’s Mission shRNA library, and FUW-mCherry-Puro-Luc from . .. We generated the NT5C2 p.R238W, p.K359Q, p.R367Q and p.D407A mutations in the pLOC-NT5C2 plasmid by site directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis kit (Stratagene) according to the manufacturer’s instructions.

    Article Title: Interactions among HCLS1, HAX1 and LEF-1 proteins are essential for G-CSF-triggered granulopoiesis
    Article Snippet: We introduced point mutations into LEF-1–binding sites of LEF1 , HCLS1 and CEBPA promoter constructs using the QuikChange II XL site-directed mutagenesis kit from Stratagene. .. Reporter plasmids along with pCMV-Renilla and expression plasmids containing cDNA or shRNA, as indicated in each experiment, were transfected into HEK293T cells using Lipofectamine or into CD34+ cells using Gene Pulser MXcell electroporation system and transfection reagent (Bio-Rad) according to the manufacturer's instructions.

    Article Title: Clonal evolution mechanisms in NT5C2 mutant relapsed acute lymphoblastic leukemia
    Article Snippet: Plasmid and vectors We obtained MigR1_Δ-E NOTCH1_GFP from R. Kopan (Cincinnati Children’s Hospital Medical Center, University of Cincinnati), sh-TURBOGFP and pLKO.1_IMPDH2_shRNA (clone ID: NM_000884.1-360s1c1) from Sigma Aldrich’s Mission shRNA library, and FUW-mCherry-Puro-Luc from . .. We generated the NT5C2 p.R238W, p.K359Q, p.R367Q and p.D407A mutations in the pLOC-NT5C2 plasmid by site directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis kit (Stratagene) according to the manufacturer’s instructions.

    Quantitative RT-PCR:

    Article Title: miR-34a Blocks Osteoporosis and Bone Metastasis by Inhibiting Osteoclastogenesis and Tgif2
    Article Snippet: Third, we performed RT-QPCR to select tertiary targets that can be inhibited by miR-34a during osteoclast differentiation. .. To generate a mutant reporter with miss-matched miR-34a binding site, the miR-34a target sequence was altered using QuikChange II XL site-directed mutagenesis kit (Stratagene).

    Plasmid Preparation:

    Article Title: Clonal evolution mechanisms in NT5C2 mutant relapsed acute lymphoblastic leukemia
    Article Snippet: .. We generated the NT5C2 p.R238W, p.K359Q, p.R367Q and p.D407A mutations in the pLOC-NT5C2 plasmid by site directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis kit (Stratagene) according to the manufacturer’s instructions. .. We transfected retroviral or lentiviral plasmids together with gag-pol (pCMV ΔR8.91) and V-SVG (pMD.G VSVG) expressing vectors into 293T cells using JetPEI transfection reagent (Polyplus).

    Article Title: A Hox regulatory network of hindbrain segmentation is conserved to the base of vertebrates
    Article Snippet: PCR-purified enhancer elements were cloned into HLC using either standard restriction enzyme-mediated methods or by first cloning PCR products into the pCR8/GW/TOPO TA vector (Invitrogen) followed by transfer into a Gateway-compatible variant of HLC (HLC-GW ) via in vitro recombination using the Gateway LR-Clonase II enzyme (Invitrogen). .. Site-directed mutagenesis was performed on the Hoxb3(zf) HLC construct using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) and the primers listed below.

    Article Title: Evaluation of Aminoglycoside and Non-Aminoglycoside Compounds for Stop-Codon Readthrough Therapy in Four Lysosomal Storage Diseases
    Article Snippet: .. Site-directed mutagenesis The nonsense mutations were introduced in the wild type full-length cDNA of the corresponding gene cloned in the pcDNA3.1 expression vector by PCR-based site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene Cloning Systems, La Jolla, CA, USA), according to the manufacturer’s instructions. .. All constructs were resequenced to ensure that no spurious mutations had been introduced.

    Article Title: Animal cryptochromes mediate magnetoreception by an unconventional photochemical mechanism
    Article Snippet: For generating UAS-dcryW342F transgenic lines, the dcry open reading frame containing a W342F mutation was PCR amplified from pAC5.1V5/His- dcry W342F and subcloned into the XhoI and XbaI sites of the pUAST vector. .. To generate the UAS-dpcry1 W328F and UAS-dpcry2 W345F transgenic lines, the tryptophan to phenylalanine mutations were introduced into the pUAST- dpcry1 and pUAST- dpcry2 constructs, respectively, using the Stratagene QuikChange II XL Site-Directed Mutagenesis kit.

    Article Title: Pathogenic LRRK2 negatively regulates microRNA-mediated translational repression
    Article Snippet: Human LRRK2 cDNA was purchased from Origene and FLAG-tag sequence was added at the C-terminus. dLRRK cDNA was also inserted into the pcDNA5/FRT vector. .. Introduction of desired point mutations was performed using QuikChange II XL Site-directed mutagenesis kit (Stratagene).

    Article Title: LncRNA CAIF inhibits autophagy and attenuates myocardial infarction by blocking p53-mediated myocardin transcription
    Article Snippet: The myocardin promoter luciferase reporter plasmid pGL4.17-Mycd was constructed by ligating the myocardin promoter region into the pGL4.17 vector (Promega). .. Site-directed mutagenesis in the putative p53-binding site was performed using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene).

    Article Title: A tRNA-derived small RNA regulates ribosome biogenesis
    Article Snippet: Paragraph title: Plasmid constructs ... Site-directed mutagenesis was performed with the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) to generate point mutations or deletions in the recombinant RPS9, 14, 15, and 28 genes (primers in ).

    Article Title: Stimulating the RIG-I pathway to kill cells in the latent HIV reservoir following viral reactivation
    Article Snippet: We excised the gag region from pNL4-3 (NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH, courtesy of Dr. Malcolm Martin) by restriction digest with BssHII (711) and SpeI (1507) subcloning this region into the pcDNA3.1 TOPO TA vector (Life Technologies, Grand Island, NY). .. Using the Quikchange II XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla CA), we mutated a region of gag from amino acids 1404 to 1432 ( ).

    Article Title: Interactions among HCLS1, HAX1 and LEF-1 proteins are essential for G-CSF-triggered granulopoiesis
    Article Snippet: The CEBPA promoter (5,400 bp) in the pGL3 vector was a gift from Q. Tong and the CCND1 promoter (1,748 bp) was a gift from O. Tetsu. .. We introduced point mutations into LEF-1–binding sites of LEF1 , HCLS1 and CEBPA promoter constructs using the QuikChange II XL site-directed mutagenesis kit from Stratagene.

    Article Title: Clonal evolution mechanisms in NT5C2 mutant relapsed acute lymphoblastic leukemia
    Article Snippet: .. We generated the NT5C2 p.R238W, p.K359Q, p.R367Q and p.D407A mutations in the pLOC-NT5C2 plasmid by site directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis kit (Stratagene) according to the manufacturer’s instructions. .. Retroviral and lentiviral infections We transfected retroviral or lentiviral plasmids together with gag-pol (pCMV ΔR8.91) and V-SVG (pMD.G VSVG) expressing vectors into 293T cells using JetPEI transfection reagent (Polyplus).

    Article Title: miR-34a Blocks Osteoporosis and Bone Metastasis by Inhibiting Osteoclastogenesis and Tgif2
    Article Snippet: To generate a CMV-Luc-3′UTR reporter, a ~300bp Tgif2 3′UTR region centering the miR-34a target sequence was cloned into the pMIR-REPORT™ vector (Life Technologies) downstream of the luciferase open reading frame. .. To generate a mutant reporter with miss-matched miR-34a binding site, the miR-34a target sequence was altered using QuikChange II XL site-directed mutagenesis kit (Stratagene).

    Article Title: Telomerase RNA biogenesis involves sequential binding by Sm and Lsm complexes
    Article Snippet: .. Other ter1 mutants were generated in the context of plasmid pJW10 using the QuikChange II XL site-directed mutagenesis kit (Stratagene) and introduced into PP407, PP694 or PP695 as described . .. Yeast two-hybrid Yeast two-hybrid was conducted using the Matchmaker GAL4 Two Hybrid System 3 (Clontech).

    Binding Assay:

    Article Title: Pathogenic LRRK2 negatively regulates microRNA-mediated translational repression
    Article Snippet: Subsequently, we used pRL-TKlet7A as template and amplified the existing two incomplete let-7 binding sites as Xba I- Not I and Not I- Xba I fragments, with restriction sites added to the PCR primers to facilitate cloning. .. Mutations at nt82 of the 5′UTR and nt891 of the CDS (see for the mutations made) were introduced using QuikChange II XL Site-directed mutagenesis kit (Stratagene).

    Article Title: miR-34a Blocks Osteoporosis and Bone Metastasis by Inhibiting Osteoclastogenesis and Tgif2
    Article Snippet: .. To generate a mutant reporter with miss-matched miR-34a binding site, the miR-34a target sequence was altered using QuikChange II XL site-directed mutagenesis kit (Stratagene). .. The reporters were co-transfected with CMV-β-gal (as an internal transfection control), together with pre-miR-34a or pre-miR-control, anti-miR-34a or anti-miR-control using FuGENE HD reagent (Roche).

    In Vitro:

    Article Title: A Hox regulatory network of hindbrain segmentation is conserved to the base of vertebrates
    Article Snippet: PCR-purified enhancer elements were cloned into HLC using either standard restriction enzyme-mediated methods or by first cloning PCR products into the pCR8/GW/TOPO TA vector (Invitrogen) followed by transfer into a Gateway-compatible variant of HLC (HLC-GW ) via in vitro recombination using the Gateway LR-Clonase II enzyme (Invitrogen). .. Site-directed mutagenesis was performed on the Hoxb3(zf) HLC construct using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) and the primers listed below.

    Transgenic Assay:

    Article Title: Animal cryptochromes mediate magnetoreception by an unconventional photochemical mechanism
    Article Snippet: .. To generate the UAS-dpcry1 W328F and UAS-dpcry2 W345F transgenic lines, the tryptophan to phenylalanine mutations were introduced into the pUAST- dpcry1 and pUAST- dpcry2 constructs, respectively, using the Stratagene QuikChange II XL Site-Directed Mutagenesis kit. .. The mutated open reading frames were PCR amplified and subcloned into the KpnI and XbaI sites of new pUAST vectors to ensure that there were no vector mutations.

    Article Title: Pathogenic LRRK2 negatively regulates microRNA-mediated translational repression
    Article Snippet: Introduction of desired point mutations was performed using QuikChange II XL Site-directed mutagenesis kit (Stratagene). .. To make UAS-d4E-BP(TE) transgenic lines, the T37/46/86E mutant form of d4E-BP generated by site-directed mutagenesis was subcloned into the pUAST vector.

    Article Title: Pathogenic LRRK2 negatively regulates microRNA-mediated translational repression
    Article Snippet: For the generation of pre-miRNA transgenic flies, genomic DNA containing the precursor sequences were amplified and subcloned into the appropriate restrictions sites of pUAST . .. Mutations at nt82 of the 5′UTR and nt891 of the CDS (see for the mutations made) were introduced using QuikChange II XL Site-directed mutagenesis kit (Stratagene).

    FLAG-tag:

    Article Title: Pathogenic LRRK2 negatively regulates microRNA-mediated translational repression
    Article Snippet: Human LRRK2 cDNA was purchased from Origene and FLAG-tag sequence was added at the C-terminus. dLRRK cDNA was also inserted into the pcDNA5/FRT vector. .. Introduction of desired point mutations was performed using QuikChange II XL Site-directed mutagenesis kit (Stratagene).

    BAC Assay:

    Article Title: A Hox regulatory network of hindbrain segmentation is conserved to the base of vertebrates
    Article Snippet: The 12kb intergenic region between lamprey Hox2 and Hox3 of the Pm1 cluster was cloned into HLC by homologous capture from lamprey BAC 218A09 (L6) following previously described recombineering methods and using the following homology arm sequences (homology arms indicated in bold): Arm 1 5’-GGGCCC GTACACGGACCTGTCGTCTCATCACCACCCGACTCAGGAAGT ACTAGT-3’ Arm 2 5’- ACACCCCCCCCCCTCCTCGCTCAGTGCTCCGTCAAGGCAG CCATGG-3’ Shorter fragments of this intergenic region were subsequently generated from the captured 12kb sequence by standard restriction enzyme-mediated cloning approaches. .. Site-directed mutagenesis was performed on the Hoxb3(zf) HLC construct using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) and the primers listed below.

    Variant Assay:

    Article Title: A Hox regulatory network of hindbrain segmentation is conserved to the base of vertebrates
    Article Snippet: PCR-purified enhancer elements were cloned into HLC using either standard restriction enzyme-mediated methods or by first cloning PCR products into the pCR8/GW/TOPO TA vector (Invitrogen) followed by transfer into a Gateway-compatible variant of HLC (HLC-GW ) via in vitro recombination using the Gateway LR-Clonase II enzyme (Invitrogen). .. Site-directed mutagenesis was performed on the Hoxb3(zf) HLC construct using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene) and the primers listed below.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Stratagene quikchange ii xl site directed mutagenesis kit
    Quikchange Ii Xl Site Directed Mutagenesis Kit, supplied by Stratagene, used in various techniques. Bioz Stars score: 99/100, based on 540 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quikchange ii xl site directed mutagenesis kit/product/Stratagene
    Average 99 stars, based on 540 article reviews
    Price from $9.99 to $1999.99
    quikchange ii xl site directed mutagenesis kit - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    Image Search Results