quantitative real time polymerase chain reaction pcr  (Roche)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Roche quantitative real time polymerase chain reaction pcr
    Inhibition of core dimerization and of virus production by SL209-biotin and evidence for direct binding to core protein. In an AlphaScreen assay, glutathione-coated donor beads and anti-flag antibody coated acceptor beads (20 µg/ml each) were used to monitor the dimerization of GST- and Flag- tagged core106 proteins. GST-core106 (GC106) and Flag-core106 (FC106) were used at 150 nM each and core106 was used at 1 µM as a reference inhibitor. A: Structures of SL201, SL209, SL231, and SL209-biotin. SL201, is a 513 Da small molecule inhibitor originally identified to inhibit HCV core dimerization and virus production. SL209, is a SAR analogue of SL201. SL231, is a dimer of SL209. SL209-biotin is a biotinlyated derivative of SL209. “*” indicates that structures of SL201, SL209, and SL231 have been previously published in Wei et al 2009 [24] , Strosberg et al 2010 [15] , and Ni et al 2011 [23] . B: Levels of inhibition. Core106 inhibited 91% and small compounds inhibitors: SL201, SL209, SL231 and SL209-biotin used at 15 µM inhibited respectively 66%, 74%, 83%, and 75% of core dimerization. C: Direct binding to GST-core106 (GC106) or Flag-core106 (FC106). In a novel AlphaScreen format GC106/SL209-biotin and FC106/SL209-biotin were mixed in 1∶1000 ratio and incubated. Streptavidin donor beads and glutathione coated acceptor beads at 20 µg/ml were used in the detection of the binding. Free SL209 at 50 µM inhibited 83% of SL209-biotin binding to GC106 and 77% of SL209-biotin binding to FC106. D: Dose response analyses. Inhibition levels were analyzed in a dose response format. The compounds were dosed from 160 µM to 150 pM. The IC 50 values for SL209 (right panel) and SL209-biotin (left panel) were calculated as 3.7 µM and 2.8 µM using GraphPad Prism. E: Inhibition of HCV production. Inhibition of HCV production in Huh-7.5 cells by SL209 and SL209-biotin was analyzed by adding serially diluted the compounds (individually) and virus onto naïve Huh-7.5 cells. The supernatants of the cells after 3 days of culture were removed from the initial culture and added to naïve cells cultured for another 3 days. <t>RNA</t> was purified from lysed cells and analyzed by Real-Time <t>RT-PCR.</t> EC 50 values were calculated to be 3.2 µM and 4.8 µM for SL209 (right panel) and SL209-biotin (left panel), respectively. EC 90 values were calculated to be 33.9 µM and 47.3 µM for SL209 (right panel) and SL209-biotin (left panel), respectively.
    Quantitative Real Time Polymerase Chain Reaction Pcr, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time polymerase chain reaction pcr/product/Roche
    Average 94 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    quantitative real time polymerase chain reaction pcr - by Bioz Stars, 2020-04
    94/100 stars

    Images

    1) Product Images from "Direct Binding of a Hepatitis C Virus Inhibitor to the Viral Capsid Protein"

    Article Title: Direct Binding of a Hepatitis C Virus Inhibitor to the Viral Capsid Protein

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0032207

    Inhibition of core dimerization and of virus production by SL209-biotin and evidence for direct binding to core protein. In an AlphaScreen assay, glutathione-coated donor beads and anti-flag antibody coated acceptor beads (20 µg/ml each) were used to monitor the dimerization of GST- and Flag- tagged core106 proteins. GST-core106 (GC106) and Flag-core106 (FC106) were used at 150 nM each and core106 was used at 1 µM as a reference inhibitor. A: Structures of SL201, SL209, SL231, and SL209-biotin. SL201, is a 513 Da small molecule inhibitor originally identified to inhibit HCV core dimerization and virus production. SL209, is a SAR analogue of SL201. SL231, is a dimer of SL209. SL209-biotin is a biotinlyated derivative of SL209. “*” indicates that structures of SL201, SL209, and SL231 have been previously published in Wei et al 2009 [24] , Strosberg et al 2010 [15] , and Ni et al 2011 [23] . B: Levels of inhibition. Core106 inhibited 91% and small compounds inhibitors: SL201, SL209, SL231 and SL209-biotin used at 15 µM inhibited respectively 66%, 74%, 83%, and 75% of core dimerization. C: Direct binding to GST-core106 (GC106) or Flag-core106 (FC106). In a novel AlphaScreen format GC106/SL209-biotin and FC106/SL209-biotin were mixed in 1∶1000 ratio and incubated. Streptavidin donor beads and glutathione coated acceptor beads at 20 µg/ml were used in the detection of the binding. Free SL209 at 50 µM inhibited 83% of SL209-biotin binding to GC106 and 77% of SL209-biotin binding to FC106. D: Dose response analyses. Inhibition levels were analyzed in a dose response format. The compounds were dosed from 160 µM to 150 pM. The IC 50 values for SL209 (right panel) and SL209-biotin (left panel) were calculated as 3.7 µM and 2.8 µM using GraphPad Prism. E: Inhibition of HCV production. Inhibition of HCV production in Huh-7.5 cells by SL209 and SL209-biotin was analyzed by adding serially diluted the compounds (individually) and virus onto naïve Huh-7.5 cells. The supernatants of the cells after 3 days of culture were removed from the initial culture and added to naïve cells cultured for another 3 days. RNA was purified from lysed cells and analyzed by Real-Time RT-PCR. EC 50 values were calculated to be 3.2 µM and 4.8 µM for SL209 (right panel) and SL209-biotin (left panel), respectively. EC 90 values were calculated to be 33.9 µM and 47.3 µM for SL209 (right panel) and SL209-biotin (left panel), respectively.
    Figure Legend Snippet: Inhibition of core dimerization and of virus production by SL209-biotin and evidence for direct binding to core protein. In an AlphaScreen assay, glutathione-coated donor beads and anti-flag antibody coated acceptor beads (20 µg/ml each) were used to monitor the dimerization of GST- and Flag- tagged core106 proteins. GST-core106 (GC106) and Flag-core106 (FC106) were used at 150 nM each and core106 was used at 1 µM as a reference inhibitor. A: Structures of SL201, SL209, SL231, and SL209-biotin. SL201, is a 513 Da small molecule inhibitor originally identified to inhibit HCV core dimerization and virus production. SL209, is a SAR analogue of SL201. SL231, is a dimer of SL209. SL209-biotin is a biotinlyated derivative of SL209. “*” indicates that structures of SL201, SL209, and SL231 have been previously published in Wei et al 2009 [24] , Strosberg et al 2010 [15] , and Ni et al 2011 [23] . B: Levels of inhibition. Core106 inhibited 91% and small compounds inhibitors: SL201, SL209, SL231 and SL209-biotin used at 15 µM inhibited respectively 66%, 74%, 83%, and 75% of core dimerization. C: Direct binding to GST-core106 (GC106) or Flag-core106 (FC106). In a novel AlphaScreen format GC106/SL209-biotin and FC106/SL209-biotin were mixed in 1∶1000 ratio and incubated. Streptavidin donor beads and glutathione coated acceptor beads at 20 µg/ml were used in the detection of the binding. Free SL209 at 50 µM inhibited 83% of SL209-biotin binding to GC106 and 77% of SL209-biotin binding to FC106. D: Dose response analyses. Inhibition levels were analyzed in a dose response format. The compounds were dosed from 160 µM to 150 pM. The IC 50 values for SL209 (right panel) and SL209-biotin (left panel) were calculated as 3.7 µM and 2.8 µM using GraphPad Prism. E: Inhibition of HCV production. Inhibition of HCV production in Huh-7.5 cells by SL209 and SL209-biotin was analyzed by adding serially diluted the compounds (individually) and virus onto naïve Huh-7.5 cells. The supernatants of the cells after 3 days of culture were removed from the initial culture and added to naïve cells cultured for another 3 days. RNA was purified from lysed cells and analyzed by Real-Time RT-PCR. EC 50 values were calculated to be 3.2 µM and 4.8 µM for SL209 (right panel) and SL209-biotin (left panel), respectively. EC 90 values were calculated to be 33.9 µM and 47.3 µM for SL209 (right panel) and SL209-biotin (left panel), respectively.

    Techniques Used: Inhibition, Binding Assay, Amplified Luminescent Proximity Homogenous Assay, Incubation, Cell Culture, Purification, Quantitative RT-PCR

    2) Product Images from "GLUT1 Expression Is Increased in Hepatocellular Carcinoma and Promotes Tumorigenesis"

    Article Title: GLUT1 Expression Is Increased in Hepatocellular Carcinoma and Promotes Tumorigenesis

    Journal: The American Journal of Pathology

    doi: 10.2353/ajpath.2009.080596

    GLUT1 expression in HCC. GLUT1 mRNA ( A ) and protein ( B) expression in PHHs and three different HCC cell lines (HepG2, PLC, and Hep3B) analyzed by quantitative real-time PCR ( A ) and Western blotting ( B ). Data are given as mean ± SEM (* P
    Figure Legend Snippet: GLUT1 expression in HCC. GLUT1 mRNA ( A ) and protein ( B) expression in PHHs and three different HCC cell lines (HepG2, PLC, and Hep3B) analyzed by quantitative real-time PCR ( A ) and Western blotting ( B ). Data are given as mean ± SEM (* P

    Techniques Used: Expressing, Planar Chromatography, Real-time Polymerase Chain Reaction, Western Blot

    Related Articles

    Centrifugation:

    Article Title: Enteric Glial-Mediated Enhancement of Intestinal Barrier Integrity is Compromised by Morphine
    Article Snippet: Total cellular RNA was extracted using TRIzol (Invitrogen) and isolated utilizing chloroform and centrifugation with isopropyl alcohol. cDNA was synthesized with the M-MLV reverse transcription kit from Promega. .. Quantitative real-time polymerase chain reaction (PCR) was performed utilizing Roche lightcycler 480 PCR detection system on all samples in triplicate.

    Amplification:

    Article Title: Direct Binding of a Hepatitis C Virus Inhibitor to the Viral Capsid Protein
    Article Snippet: .. Quantitative Real-Time polymerase chain reaction (PCR) was performed in triplicate using LightCycler RNA Amplification Kit HybProbe master mix (Roche) with Taqman MGB Probe 6FAM- TATGAGTGTCGTGCAGCCTC -MGBNFQ on a model LightCycler480 Real-Time PCR system (Roche). ..

    Article Title: Cryptococcus neoformans Infection in Mice Lacking Type I Interferon Signaling Leads to Increased Fungal Clearance and IL-4-Dependent Mucin Production in the Lungs
    Article Snippet: Quantitative real-time polymerase chain reaction (PCR) was performed in a volume of 20 μl using gene-specific primers and FastStart Essential DNA Green Master (Roche Applied Science, Branford, CT, USA) in a LightCycler® Nano System (Roche Applied Science). .. The primer sequences for amplification are shown in .

    Article Title: Eotaxin-2 increased toll-like receptor 4 expression in endothelial cells in vitro and exacerbates high-cholesterol diet-induced atherogenesis in vivo
    Article Snippet: Quantitative real time polymerase chain reaction (PCR) was performed using a FastStart DNA Master SYBR Green I kit and LightCycler (Roche, CA, USA). .. The level of TLR4 mRNA expression was determined in arbitrary units by comparison with an external DNA standard that was amplified by the TLR4 primers.

    Article Title: OCLI-023, a Novel Pyrimidine Compound, Suppresses Osteoclastogenesis In Vitro and Alveolar Bone Resorption In Vivo
    Article Snippet: Quantitative real-time polymerase chain reaction (PCR) was performed in a LightCycler 1.5 real-time PCR system (Roche Diagnostics, Rotkreuz, Switzerland) using TOPreal qPCR 2× PreMIX with SYBR green (Enzynomics, Daejeon, Korea). .. The amplification conditions consisted of an initial denaturation step at 95°C for 10 min, followed by 45 cycles of denaturation for 10 s at 95°C, annealing for 15 s at 60°C, and extension for 10 s at 72°C.

    Article Title:
    Article Snippet: Quantitative real-time polymerase chain reaction (PCR) was then performed with LightCycler 1.5 (Roche Diagnostics, Mannheim, Germany) using QPCR SYBR Green Capillary Mix (ABgene, Surrey, UK) at 95°C for 15 minutes, followed by 40 cycles of 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds. .. The primer sequences used for amplification of the target genes are listed in .

    DNA Synthesis:

    Article Title: Cardioprotective Potential of an SGLT2 Inhibitor Against Doxorubicin-Induced Heart Failure
    Article Snippet: For complementary DNA synthesis, total RNA (1µg) was reverse transcribed with the Qiagen Quantitect Reverse Transcription Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocols. .. Quantitative real-time polymerase chain reaction (PCR) was performed using a FastStart Essential DNA Green Master kit (Roche Life Sciences, Indianapolis, IN, USA).

    Synthesized:

    Article Title: Enteric Glial-Mediated Enhancement of Intestinal Barrier Integrity is Compromised by Morphine
    Article Snippet: Total cellular RNA was extracted using TRIzol (Invitrogen) and isolated utilizing chloroform and centrifugation with isopropyl alcohol. cDNA was synthesized with the M-MLV reverse transcription kit from Promega. .. Quantitative real-time polymerase chain reaction (PCR) was performed utilizing Roche lightcycler 480 PCR detection system on all samples in triplicate.

    Article Title: Cryptococcus neoformans Infection in Mice Lacking Type I Interferon Signaling Leads to Increased Fungal Clearance and IL-4-Dependent Mucin Production in the Lungs
    Article Snippet: Extraction of RNA and quantitative real-time RT-PCR Total RNA was extracted from the infected lungs using Isogen (Wako Pure Chemical, Osaka, Japan) and the first-strand cDNA was synthesized using PrimeScript® 1st strand cDNA Synthesis Kit (Takara Bio Inc., Otsu, Japan), according to the manufacturer’s instructions. .. Quantitative real-time polymerase chain reaction (PCR) was performed in a volume of 20 μl using gene-specific primers and FastStart Essential DNA Green Master (Roche Applied Science, Branford, CT, USA) in a LightCycler® Nano System (Roche Applied Science).

    Article Title: Eotaxin-2 increased toll-like receptor 4 expression in endothelial cells in vitro and exacerbates high-cholesterol diet-induced atherogenesis in vivo
    Article Snippet: Total RNA was isolated using a TRIZOL reagent kit (Invitrogen, CA, USA). cDNA was synthesized from total RNA using Superscript® II reverse transcriptase. .. Quantitative real time polymerase chain reaction (PCR) was performed using a FastStart DNA Master SYBR Green I kit and LightCycler (Roche, CA, USA).

    Quantitative RT-PCR:

    Article Title: Direct Binding of a Hepatitis C Virus Inhibitor to the Viral Capsid Protein
    Article Snippet: Paragraph title: Quantitative Real Time RT-PCR analysis of HCV RNA ... Quantitative Real-Time polymerase chain reaction (PCR) was performed in triplicate using LightCycler RNA Amplification Kit HybProbe master mix (Roche) with Taqman MGB Probe 6FAM- TATGAGTGTCGTGCAGCCTC -MGBNFQ on a model LightCycler480 Real-Time PCR system (Roche).

    Article Title: Cryptococcus neoformans Infection in Mice Lacking Type I Interferon Signaling Leads to Increased Fungal Clearance and IL-4-Dependent Mucin Production in the Lungs
    Article Snippet: Paragraph title: Extraction of RNA and quantitative real-time RT-PCR ... Quantitative real-time polymerase chain reaction (PCR) was performed in a volume of 20 μl using gene-specific primers and FastStart Essential DNA Green Master (Roche Applied Science, Branford, CT, USA) in a LightCycler® Nano System (Roche Applied Science).

    Real-time Polymerase Chain Reaction:

    Article Title: Ascorbic acid is a dose-dependent inhibitor of adipocyte differentiation, probably by reducing cAMP pool
    Article Snippet: .. Thereafter, quantitative real time-polymerase chain reaction (PCR) was performed using Light Cycler 480 Real-Time PCR System (Roche), using UPL probes. .. Expression levels of target genes were normalized using β-actin (ACTB) as internal standard.

    Article Title: Direct Binding of a Hepatitis C Virus Inhibitor to the Viral Capsid Protein
    Article Snippet: .. Quantitative Real-Time polymerase chain reaction (PCR) was performed in triplicate using LightCycler RNA Amplification Kit HybProbe master mix (Roche) with Taqman MGB Probe 6FAM- TATGAGTGTCGTGCAGCCTC -MGBNFQ on a model LightCycler480 Real-Time PCR system (Roche). ..

    Article Title: Cardioprotective Potential of an SGLT2 Inhibitor Against Doxorubicin-Induced Heart Failure
    Article Snippet: .. Quantitative real-time polymerase chain reaction (PCR) was performed using a FastStart Essential DNA Green Master kit (Roche Life Sciences, Indianapolis, IN, USA). ..

    Article Title: Do Helper T Cell Subtypes in Lymphocytic Thyroiditis Play a Role in the Antitumor Effect?
    Article Snippet: .. Quantitative real-time polymerase chain reaction (PCR) was performed according to the manual of LightCycler 480 Real-Time PCR System (Roche Applied Science, Manheim, Germany). ..

    Article Title: Enteric Glial-Mediated Enhancement of Intestinal Barrier Integrity is Compromised by Morphine
    Article Snippet: .. Quantitative real-time polymerase chain reaction (PCR) was performed utilizing Roche lightcycler 480 PCR detection system on all samples in triplicate. .. 18S RNA was used to normalize mRNA expression levels. mRNA analysis was performed by culturing IECs to confluence and treating them for 24 hours with 1 μM morphine. qPCR analysis was performed using primers for Glial-Derived Neurotrophic Factor (GDNF).

    Article Title: Cryptococcus neoformans Infection in Mice Lacking Type I Interferon Signaling Leads to Increased Fungal Clearance and IL-4-Dependent Mucin Production in the Lungs
    Article Snippet: .. Quantitative real-time polymerase chain reaction (PCR) was performed in a volume of 20 μl using gene-specific primers and FastStart Essential DNA Green Master (Roche Applied Science, Branford, CT, USA) in a LightCycler® Nano System (Roche Applied Science). .. The primer sequences for amplification are shown in .

    Article Title: Eotaxin-2 increased toll-like receptor 4 expression in endothelial cells in vitro and exacerbates high-cholesterol diet-induced atherogenesis in vivo
    Article Snippet: .. Quantitative real time polymerase chain reaction (PCR) was performed using a FastStart DNA Master SYBR Green I kit and LightCycler (Roche, CA, USA). .. FastStart Taq DNA polymerase was activated by incubation at 95°C for 2 min before 40 cycles of 95°C for 1 s, 60°C for 5 s, and 72°C for 7 s. Fluorescence was measured at 86°C after the 72°C extension step.

    Article Title: OCLI-023, a Novel Pyrimidine Compound, Suppresses Osteoclastogenesis In Vitro and Alveolar Bone Resorption In Vivo
    Article Snippet: .. Quantitative real-time polymerase chain reaction (PCR) was performed in a LightCycler 1.5 real-time PCR system (Roche Diagnostics, Rotkreuz, Switzerland) using TOPreal qPCR 2× PreMIX with SYBR green (Enzynomics, Daejeon, Korea). .. The amplification conditions consisted of an initial denaturation step at 95°C for 10 min, followed by 45 cycles of denaturation for 10 s at 95°C, annealing for 15 s at 60°C, and extension for 10 s at 72°C.

    Article Title: Assessment of the Frequency of Autoantibodies in Chronic Viral Hepatitis
    Article Snippet: .. ELISA (Vitros ECiO, Ortho Clinical Diagnostics) was used to examine hepatitis markers (HBs Ag, Anti HCV, HBe Ag, Anti HBe Ag); and quantitative Real Time Polymerase Chain Reaction (PCR) was used to detect HCV-RNA (Cobas Taqman48, Roche) at the ELISA and Molecular Microbiology Unit, Microbiology Laboratory, Medical Faculty of Afyon Kocatepe University. .. IFA method was utilized for the detection and pattern examination of ANA (ANA profile 3, Euroimmun) using fixed HEp-2 cells as substrate.

    Article Title: GLUT1 Expression Is Increased in Hepatocellular Carcinoma and Promotes Tumorigenesis
    Article Snippet: .. Quantitative real-time polymerase chain reaction (PCR) was performed with primers specific for GLUT1 (forward: 5′-AACTCTTCAGCCAGGGTCCAC; reverse: 5′-CACAGTGAAGATGATGAAGAC) using LightCycler technology (Roche, Mannheim, Germany). .. Expression of MAZ was analyzed applying the QuantiTect primer assay according to the manufacturer’s instructions (Qiagen, Hilden, Germany).

    Article Title: Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics. Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics
    Article Snippet: .. Quantitative real‐time polymerase chain reaction (PCR) for ChIP samples: quantitative PCR (qPCR) for ChIP samples was conducted using SYBR green reagents as per manufacturer's instructions (Roche) using the following primers to normalize transfection efficiencies from input DNA (LucChIP forward; CTTGCAGTTCTTCATGCCCG, LucChIP reverse; CTCACGAATACGACGGTGGG) and to assess immunoprecipitation of human ECR1T or ECR1C allelic variants following immunoprecipitation (hECR1 forward; TTAATGGCAGCTACATCCCC, hECR1 reverse; TCATGGCAGGAAAACTGCTC). ..

    Article Title:
    Article Snippet: .. Quantitative real-time polymerase chain reaction (PCR) was then performed with LightCycler 1.5 (Roche Diagnostics, Mannheim, Germany) using QPCR SYBR Green Capillary Mix (ABgene, Surrey, UK) at 95°C for 15 minutes, followed by 40 cycles of 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds. .. The primer sequences used for amplification of the target genes are listed in .

    Incubation:

    Article Title: Eotaxin-2 increased toll-like receptor 4 expression in endothelial cells in vitro and exacerbates high-cholesterol diet-induced atherogenesis in vivo
    Article Snippet: Quantitative real time polymerase chain reaction (PCR) was performed using a FastStart DNA Master SYBR Green I kit and LightCycler (Roche, CA, USA). .. FastStart Taq DNA polymerase was activated by incubation at 95°C for 2 min before 40 cycles of 95°C for 1 s, 60°C for 5 s, and 72°C for 7 s. Fluorescence was measured at 86°C after the 72°C extension step.

    Article Title: Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics. Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics
    Article Snippet: Briefly, following cross linking with formaldehyde hippocampal chromatin was extracted and fragmented by restriction digestion (NcoI/BglII and MluI/AseI) or sonication as previously described (Carey, Peterson, & Smale, ) and incubated in the presence of a mouse immunoglobulin G antibody (Upstate), anti‐CTCF (Abcam) or anti‐Jun antibody (Sigma). .. Quantitative real‐time polymerase chain reaction (PCR) for ChIP samples: quantitative PCR (qPCR) for ChIP samples was conducted using SYBR green reagents as per manufacturer's instructions (Roche) using the following primers to normalize transfection efficiencies from input DNA (LucChIP forward; CTTGCAGTTCTTCATGCCCG, LucChIP reverse; CTCACGAATACGACGGTGGG) and to assess immunoprecipitation of human ECR1T or ECR1C allelic variants following immunoprecipitation (hECR1 forward; TTAATGGCAGCTACATCCCC, hECR1 reverse; TCATGGCAGGAAAACTGCTC).

    Luciferase:

    Article Title: Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics. Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics
    Article Snippet: Paragraph title: Luciferase reporter assays ... Quantitative real‐time polymerase chain reaction (PCR) for ChIP samples: quantitative PCR (qPCR) for ChIP samples was conducted using SYBR green reagents as per manufacturer's instructions (Roche) using the following primers to normalize transfection efficiencies from input DNA (LucChIP forward; CTTGCAGTTCTTCATGCCCG, LucChIP reverse; CTCACGAATACGACGGTGGG) and to assess immunoprecipitation of human ECR1T or ECR1C allelic variants following immunoprecipitation (hECR1 forward; TTAATGGCAGCTACATCCCC, hECR1 reverse; TCATGGCAGGAAAACTGCTC).

    Infection:

    Article Title: Cryptococcus neoformans Infection in Mice Lacking Type I Interferon Signaling Leads to Increased Fungal Clearance and IL-4-Dependent Mucin Production in the Lungs
    Article Snippet: Extraction of RNA and quantitative real-time RT-PCR Total RNA was extracted from the infected lungs using Isogen (Wako Pure Chemical, Osaka, Japan) and the first-strand cDNA was synthesized using PrimeScript® 1st strand cDNA Synthesis Kit (Takara Bio Inc., Otsu, Japan), according to the manufacturer’s instructions. .. Quantitative real-time polymerase chain reaction (PCR) was performed in a volume of 20 μl using gene-specific primers and FastStart Essential DNA Green Master (Roche Applied Science, Branford, CT, USA) in a LightCycler® Nano System (Roche Applied Science).

    Expressing:

    Article Title: Ascorbic acid is a dose-dependent inhibitor of adipocyte differentiation, probably by reducing cAMP pool
    Article Snippet: Paragraph title: Gene expression assays ... Thereafter, quantitative real time-polymerase chain reaction (PCR) was performed using Light Cycler 480 Real-Time PCR System (Roche), using UPL probes.

    Article Title: Do Helper T Cell Subtypes in Lymphocytic Thyroiditis Play a Role in the Antitumor Effect?
    Article Snippet: Paragraph title: Measurement of cytokine expression levels in the thyroid tissue ... Quantitative real-time polymerase chain reaction (PCR) was performed according to the manual of LightCycler 480 Real-Time PCR System (Roche Applied Science, Manheim, Germany).

    Article Title: Enteric Glial-Mediated Enhancement of Intestinal Barrier Integrity is Compromised by Morphine
    Article Snippet: Quantitative real-time polymerase chain reaction (PCR) was performed utilizing Roche lightcycler 480 PCR detection system on all samples in triplicate. .. 18S RNA was used to normalize mRNA expression levels. mRNA analysis was performed by culturing IECs to confluence and treating them for 24 hours with 1 μM morphine. qPCR analysis was performed using primers for Glial-Derived Neurotrophic Factor (GDNF).

    Article Title: Cryptococcus neoformans Infection in Mice Lacking Type I Interferon Signaling Leads to Increased Fungal Clearance and IL-4-Dependent Mucin Production in the Lungs
    Article Snippet: Quantitative real-time polymerase chain reaction (PCR) was performed in a volume of 20 μl using gene-specific primers and FastStart Essential DNA Green Master (Roche Applied Science, Branford, CT, USA) in a LightCycler® Nano System (Roche Applied Science). .. Target gene expression levels and that of hypoxanthine-guanine phosphoribosyltransferase (HPRT) as a reference gene were calculated for each sample using the reaction efficiency.

    Article Title: Eotaxin-2 increased toll-like receptor 4 expression in endothelial cells in vitro and exacerbates high-cholesterol diet-induced atherogenesis in vivo
    Article Snippet: Quantitative real time polymerase chain reaction (PCR) was performed using a FastStart DNA Master SYBR Green I kit and LightCycler (Roche, CA, USA). .. The level of TLR4 mRNA expression was determined in arbitrary units by comparison with an external DNA standard that was amplified by the TLR4 primers.

    Article Title: OCLI-023, a Novel Pyrimidine Compound, Suppresses Osteoclastogenesis In Vitro and Alveolar Bone Resorption In Vivo
    Article Snippet: Paragraph title: Analysis of gene expression ... Quantitative real-time polymerase chain reaction (PCR) was performed in a LightCycler 1.5 real-time PCR system (Roche Diagnostics, Rotkreuz, Switzerland) using TOPreal qPCR 2× PreMIX with SYBR green (Enzynomics, Daejeon, Korea).

    Article Title: GLUT1 Expression Is Increased in Hepatocellular Carcinoma and Promotes Tumorigenesis
    Article Snippet: Paragraph title: Expression Analysis ... Quantitative real-time polymerase chain reaction (PCR) was performed with primers specific for GLUT1 (forward: 5′-AACTCTTCAGCCAGGGTCCAC; reverse: 5′-CACAGTGAAGATGATGAAGAC) using LightCycler technology (Roche, Mannheim, Germany).

    Article Title: Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics. Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics
    Article Snippet: Luciferase expression was quantified using Dual Luciferase Reporter assay system and a GloMax 96 microplate luminometer (Promega). .. Quantitative real‐time polymerase chain reaction (PCR) for ChIP samples: quantitative PCR (qPCR) for ChIP samples was conducted using SYBR green reagents as per manufacturer's instructions (Roche) using the following primers to normalize transfection efficiencies from input DNA (LucChIP forward; CTTGCAGTTCTTCATGCCCG, LucChIP reverse; CTCACGAATACGACGGTGGG) and to assess immunoprecipitation of human ECR1T or ECR1C allelic variants following immunoprecipitation (hECR1 forward; TTAATGGCAGCTACATCCCC, hECR1 reverse; TCATGGCAGGAAAACTGCTC).

    Reporter Assay:

    Article Title: Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics. Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics
    Article Snippet: Luciferase expression was quantified using Dual Luciferase Reporter assay system and a GloMax 96 microplate luminometer (Promega). .. Quantitative real‐time polymerase chain reaction (PCR) for ChIP samples: quantitative PCR (qPCR) for ChIP samples was conducted using SYBR green reagents as per manufacturer's instructions (Roche) using the following primers to normalize transfection efficiencies from input DNA (LucChIP forward; CTTGCAGTTCTTCATGCCCG, LucChIP reverse; CTCACGAATACGACGGTGGG) and to assess immunoprecipitation of human ECR1T or ECR1C allelic variants following immunoprecipitation (hECR1 forward; TTAATGGCAGCTACATCCCC, hECR1 reverse; TCATGGCAGGAAAACTGCTC).

    Derivative Assay:

    Article Title: Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics. Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics
    Article Snippet: Chromatin immunoprecipitation (ChIP) was performed on chromatin derived from primary hippocampal neurons transfected with either the ECR1(C) or ECR1(T) reporter constructs (1.2 µg/5 × 106 cells in 10 cm plates), as described above, and incubated for 48 hr. .. Quantitative real‐time polymerase chain reaction (PCR) for ChIP samples: quantitative PCR (qPCR) for ChIP samples was conducted using SYBR green reagents as per manufacturer's instructions (Roche) using the following primers to normalize transfection efficiencies from input DNA (LucChIP forward; CTTGCAGTTCTTCATGCCCG, LucChIP reverse; CTCACGAATACGACGGTGGG) and to assess immunoprecipitation of human ECR1T or ECR1C allelic variants following immunoprecipitation (hECR1 forward; TTAATGGCAGCTACATCCCC, hECR1 reverse; TCATGGCAGGAAAACTGCTC).

    Transfection:

    Article Title: Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics. Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics
    Article Snippet: .. Quantitative real‐time polymerase chain reaction (PCR) for ChIP samples: quantitative PCR (qPCR) for ChIP samples was conducted using SYBR green reagents as per manufacturer's instructions (Roche) using the following primers to normalize transfection efficiencies from input DNA (LucChIP forward; CTTGCAGTTCTTCATGCCCG, LucChIP reverse; CTCACGAATACGACGGTGGG) and to assess immunoprecipitation of human ECR1T or ECR1C allelic variants following immunoprecipitation (hECR1 forward; TTAATGGCAGCTACATCCCC, hECR1 reverse; TCATGGCAGGAAAACTGCTC). ..

    Concentration Assay:

    Article Title: Do Helper T Cell Subtypes in Lymphocytic Thyroiditis Play a Role in the Antitumor Effect?
    Article Snippet: Quantitative real-time polymerase chain reaction (PCR) was performed according to the manual of LightCycler 480 Real-Time PCR System (Roche Applied Science, Manheim, Germany). .. Using the concept of relative quantification, the cytokine values were corrected for differences in quality and quantity by dividing the concentration of a target RNA by the concentration of a reference RNA in the same sample (relative ratio=concentration of target/concentration of reference).

    Cell Culture:

    Article Title: GLUT1 Expression Is Increased in Hepatocellular Carcinoma and Promotes Tumorigenesis
    Article Snippet: Isolation of total cellular RNA from cultured cells and tissues and reverse transcription were performed as described previously. .. Quantitative real-time polymerase chain reaction (PCR) was performed with primers specific for GLUT1 (forward: 5′-AACTCTTCAGCCAGGGTCCAC; reverse: 5′-CACAGTGAAGATGATGAAGAC) using LightCycler technology (Roche, Mannheim, Germany).

    Generated:

    Article Title: Direct Binding of a Hepatitis C Virus Inhibitor to the Viral Capsid Protein
    Article Snippet: DNA was generated using the Taqman reverse transcription kit (Applied Biosystems, Foster City, CA). .. Quantitative Real-Time polymerase chain reaction (PCR) was performed in triplicate using LightCycler RNA Amplification Kit HybProbe master mix (Roche) with Taqman MGB Probe 6FAM- TATGAGTGTCGTGCAGCCTC -MGBNFQ on a model LightCycler480 Real-Time PCR system (Roche).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Cardioprotective Potential of an SGLT2 Inhibitor Against Doxorubicin-Induced Heart Failure
    Article Snippet: Paragraph title: RNA isolation and quantitative real-time reverse transcription polymerase chain reaction ... Quantitative real-time polymerase chain reaction (PCR) was performed using a FastStart Essential DNA Green Master kit (Roche Life Sciences, Indianapolis, IN, USA).

    Sonication:

    Article Title: Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics. Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics
    Article Snippet: Briefly, following cross linking with formaldehyde hippocampal chromatin was extracted and fragmented by restriction digestion (NcoI/BglII and MluI/AseI) or sonication as previously described (Carey, Peterson, & Smale, ) and incubated in the presence of a mouse immunoglobulin G antibody (Upstate), anti‐CTCF (Abcam) or anti‐Jun antibody (Sigma). .. Quantitative real‐time polymerase chain reaction (PCR) for ChIP samples: quantitative PCR (qPCR) for ChIP samples was conducted using SYBR green reagents as per manufacturer's instructions (Roche) using the following primers to normalize transfection efficiencies from input DNA (LucChIP forward; CTTGCAGTTCTTCATGCCCG, LucChIP reverse; CTCACGAATACGACGGTGGG) and to assess immunoprecipitation of human ECR1T or ECR1C allelic variants following immunoprecipitation (hECR1 forward; TTAATGGCAGCTACATCCCC, hECR1 reverse; TCATGGCAGGAAAACTGCTC).

    Immunofluorescence:

    Article Title: Assessment of the Frequency of Autoantibodies in Chronic Viral Hepatitis
    Article Snippet: ELISA (Vitros ECiO, Ortho Clinical Diagnostics) was used to examine hepatitis markers (HBs Ag, Anti HCV, HBe Ag, Anti HBe Ag); and quantitative Real Time Polymerase Chain Reaction (PCR) was used to detect HCV-RNA (Cobas Taqman48, Roche) at the ELISA and Molecular Microbiology Unit, Microbiology Laboratory, Medical Faculty of Afyon Kocatepe University. .. IFA method was utilized for the detection and pattern examination of ANA (ANA profile 3, Euroimmun) using fixed HEp-2 cells as substrate.

    Fluorescence:

    Article Title: Eotaxin-2 increased toll-like receptor 4 expression in endothelial cells in vitro and exacerbates high-cholesterol diet-induced atherogenesis in vivo
    Article Snippet: Quantitative real time polymerase chain reaction (PCR) was performed using a FastStart DNA Master SYBR Green I kit and LightCycler (Roche, CA, USA). .. FastStart Taq DNA polymerase was activated by incubation at 95°C for 2 min before 40 cycles of 95°C for 1 s, 60°C for 5 s, and 72°C for 7 s. Fluorescence was measured at 86°C after the 72°C extension step.

    Isolation:

    Article Title: Direct Binding of a Hepatitis C Virus Inhibitor to the Viral Capsid Protein
    Article Snippet: Quantitative Real Time RT-PCR analysis of HCV RNA Cells were lysed and RNA was isolated using the RNeasy kit (QIAGEN, Valencia, CA). .. Quantitative Real-Time polymerase chain reaction (PCR) was performed in triplicate using LightCycler RNA Amplification Kit HybProbe master mix (Roche) with Taqman MGB Probe 6FAM- TATGAGTGTCGTGCAGCCTC -MGBNFQ on a model LightCycler480 Real-Time PCR system (Roche).

    Article Title: Cardioprotective Potential of an SGLT2 Inhibitor Against Doxorubicin-Induced Heart Failure
    Article Snippet: Paragraph title: RNA isolation and quantitative real-time reverse transcription polymerase chain reaction ... Quantitative real-time polymerase chain reaction (PCR) was performed using a FastStart Essential DNA Green Master kit (Roche Life Sciences, Indianapolis, IN, USA).

    Article Title: Enteric Glial-Mediated Enhancement of Intestinal Barrier Integrity is Compromised by Morphine
    Article Snippet: Total cellular RNA was extracted using TRIzol (Invitrogen) and isolated utilizing chloroform and centrifugation with isopropyl alcohol. cDNA was synthesized with the M-MLV reverse transcription kit from Promega. .. Quantitative real-time polymerase chain reaction (PCR) was performed utilizing Roche lightcycler 480 PCR detection system on all samples in triplicate.

    Article Title: Eotaxin-2 increased toll-like receptor 4 expression in endothelial cells in vitro and exacerbates high-cholesterol diet-induced atherogenesis in vivo
    Article Snippet: Total RNA was isolated using a TRIZOL reagent kit (Invitrogen, CA, USA). cDNA was synthesized from total RNA using Superscript® II reverse transcriptase. .. Quantitative real time polymerase chain reaction (PCR) was performed using a FastStart DNA Master SYBR Green I kit and LightCycler (Roche, CA, USA).

    Article Title: OCLI-023, a Novel Pyrimidine Compound, Suppresses Osteoclastogenesis In Vitro and Alveolar Bone Resorption In Vivo
    Article Snippet: Analysis of gene expression Total RNA was isolated from cells using the TRI-solution (Bioscience, Seoul, Korea), and 1 μg of total RNA was reverse-transcribed using SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA). .. Quantitative real-time polymerase chain reaction (PCR) was performed in a LightCycler 1.5 real-time PCR system (Roche Diagnostics, Rotkreuz, Switzerland) using TOPreal qPCR 2× PreMIX with SYBR green (Enzynomics, Daejeon, Korea).

    Article Title: GLUT1 Expression Is Increased in Hepatocellular Carcinoma and Promotes Tumorigenesis
    Article Snippet: Isolation of total cellular RNA from cultured cells and tissues and reverse transcription were performed as described previously. .. Quantitative real-time polymerase chain reaction (PCR) was performed with primers specific for GLUT1 (forward: 5′-AACTCTTCAGCCAGGGTCCAC; reverse: 5′-CACAGTGAAGATGATGAAGAC) using LightCycler technology (Roche, Mannheim, Germany).

    Article Title:
    Article Snippet: Paragraph title: Total RNA Isolation, Reverse Transcription, and Quantitative Polymerase Chain Reaction. ... Quantitative real-time polymerase chain reaction (PCR) was then performed with LightCycler 1.5 (Roche Diagnostics, Mannheim, Germany) using QPCR SYBR Green Capillary Mix (ABgene, Surrey, UK) at 95°C for 15 minutes, followed by 40 cycles of 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds.

    Purification:

    Article Title: Ascorbic acid is a dose-dependent inhibitor of adipocyte differentiation, probably by reducing cAMP pool
    Article Snippet: Purified total RNA from adipocytes was reverse transcribed using Superscript II reverse transcriptase (Invitrogen™) to produce cDNA. .. Thereafter, quantitative real time-polymerase chain reaction (PCR) was performed using Light Cycler 480 Real-Time PCR System (Roche), using UPL probes.

    Polymerase Chain Reaction:

    Article Title: Ascorbic acid is a dose-dependent inhibitor of adipocyte differentiation, probably by reducing cAMP pool
    Article Snippet: .. Thereafter, quantitative real time-polymerase chain reaction (PCR) was performed using Light Cycler 480 Real-Time PCR System (Roche), using UPL probes. .. Expression levels of target genes were normalized using β-actin (ACTB) as internal standard.

    Article Title: Direct Binding of a Hepatitis C Virus Inhibitor to the Viral Capsid Protein
    Article Snippet: .. Quantitative Real-Time polymerase chain reaction (PCR) was performed in triplicate using LightCycler RNA Amplification Kit HybProbe master mix (Roche) with Taqman MGB Probe 6FAM- TATGAGTGTCGTGCAGCCTC -MGBNFQ on a model LightCycler480 Real-Time PCR system (Roche). ..

    Article Title: Cardioprotective Potential of an SGLT2 Inhibitor Against Doxorubicin-Induced Heart Failure
    Article Snippet: .. Quantitative real-time polymerase chain reaction (PCR) was performed using a FastStart Essential DNA Green Master kit (Roche Life Sciences, Indianapolis, IN, USA). ..

    Article Title: Do Helper T Cell Subtypes in Lymphocytic Thyroiditis Play a Role in the Antitumor Effect?
    Article Snippet: .. Quantitative real-time polymerase chain reaction (PCR) was performed according to the manual of LightCycler 480 Real-Time PCR System (Roche Applied Science, Manheim, Germany). ..

    Article Title: Enteric Glial-Mediated Enhancement of Intestinal Barrier Integrity is Compromised by Morphine
    Article Snippet: .. Quantitative real-time polymerase chain reaction (PCR) was performed utilizing Roche lightcycler 480 PCR detection system on all samples in triplicate. .. 18S RNA was used to normalize mRNA expression levels. mRNA analysis was performed by culturing IECs to confluence and treating them for 24 hours with 1 μM morphine. qPCR analysis was performed using primers for Glial-Derived Neurotrophic Factor (GDNF).

    Article Title: Cryptococcus neoformans Infection in Mice Lacking Type I Interferon Signaling Leads to Increased Fungal Clearance and IL-4-Dependent Mucin Production in the Lungs
    Article Snippet: .. Quantitative real-time polymerase chain reaction (PCR) was performed in a volume of 20 μl using gene-specific primers and FastStart Essential DNA Green Master (Roche Applied Science, Branford, CT, USA) in a LightCycler® Nano System (Roche Applied Science). .. The primer sequences for amplification are shown in .

    Article Title: Eotaxin-2 increased toll-like receptor 4 expression in endothelial cells in vitro and exacerbates high-cholesterol diet-induced atherogenesis in vivo
    Article Snippet: .. Quantitative real time polymerase chain reaction (PCR) was performed using a FastStart DNA Master SYBR Green I kit and LightCycler (Roche, CA, USA). .. FastStart Taq DNA polymerase was activated by incubation at 95°C for 2 min before 40 cycles of 95°C for 1 s, 60°C for 5 s, and 72°C for 7 s. Fluorescence was measured at 86°C after the 72°C extension step.

    Article Title: OCLI-023, a Novel Pyrimidine Compound, Suppresses Osteoclastogenesis In Vitro and Alveolar Bone Resorption In Vivo
    Article Snippet: .. Quantitative real-time polymerase chain reaction (PCR) was performed in a LightCycler 1.5 real-time PCR system (Roche Diagnostics, Rotkreuz, Switzerland) using TOPreal qPCR 2× PreMIX with SYBR green (Enzynomics, Daejeon, Korea). .. The amplification conditions consisted of an initial denaturation step at 95°C for 10 min, followed by 45 cycles of denaturation for 10 s at 95°C, annealing for 15 s at 60°C, and extension for 10 s at 72°C.

    Article Title: Assessment of the Frequency of Autoantibodies in Chronic Viral Hepatitis
    Article Snippet: .. ELISA (Vitros ECiO, Ortho Clinical Diagnostics) was used to examine hepatitis markers (HBs Ag, Anti HCV, HBe Ag, Anti HBe Ag); and quantitative Real Time Polymerase Chain Reaction (PCR) was used to detect HCV-RNA (Cobas Taqman48, Roche) at the ELISA and Molecular Microbiology Unit, Microbiology Laboratory, Medical Faculty of Afyon Kocatepe University. .. IFA method was utilized for the detection and pattern examination of ANA (ANA profile 3, Euroimmun) using fixed HEp-2 cells as substrate.

    Article Title: GLUT1 Expression Is Increased in Hepatocellular Carcinoma and Promotes Tumorigenesis
    Article Snippet: .. Quantitative real-time polymerase chain reaction (PCR) was performed with primers specific for GLUT1 (forward: 5′-AACTCTTCAGCCAGGGTCCAC; reverse: 5′-CACAGTGAAGATGATGAAGAC) using LightCycler technology (Roche, Mannheim, Germany). .. Expression of MAZ was analyzed applying the QuantiTect primer assay according to the manufacturer’s instructions (Qiagen, Hilden, Germany).

    Article Title: Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics. Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics
    Article Snippet: .. Quantitative real‐time polymerase chain reaction (PCR) for ChIP samples: quantitative PCR (qPCR) for ChIP samples was conducted using SYBR green reagents as per manufacturer's instructions (Roche) using the following primers to normalize transfection efficiencies from input DNA (LucChIP forward; CTTGCAGTTCTTCATGCCCG, LucChIP reverse; CTCACGAATACGACGGTGGG) and to assess immunoprecipitation of human ECR1T or ECR1C allelic variants following immunoprecipitation (hECR1 forward; TTAATGGCAGCTACATCCCC, hECR1 reverse; TCATGGCAGGAAAACTGCTC). ..

    Article Title:
    Article Snippet: .. Quantitative real-time polymerase chain reaction (PCR) was then performed with LightCycler 1.5 (Roche Diagnostics, Mannheim, Germany) using QPCR SYBR Green Capillary Mix (ABgene, Surrey, UK) at 95°C for 15 minutes, followed by 40 cycles of 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds. .. The primer sequences used for amplification of the target genes are listed in .

    Construct:

    Article Title: Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics. Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics
    Article Snippet: Chromatin immunoprecipitation (ChIP) was performed on chromatin derived from primary hippocampal neurons transfected with either the ECR1(C) or ECR1(T) reporter constructs (1.2 µg/5 × 106 cells in 10 cm plates), as described above, and incubated for 48 hr. .. Quantitative real‐time polymerase chain reaction (PCR) for ChIP samples: quantitative PCR (qPCR) for ChIP samples was conducted using SYBR green reagents as per manufacturer's instructions (Roche) using the following primers to normalize transfection efficiencies from input DNA (LucChIP forward; CTTGCAGTTCTTCATGCCCG, LucChIP reverse; CTCACGAATACGACGGTGGG) and to assess immunoprecipitation of human ECR1T or ECR1C allelic variants following immunoprecipitation (hECR1 forward; TTAATGGCAGCTACATCCCC, hECR1 reverse; TCATGGCAGGAAAACTGCTC).

    Chromatin Immunoprecipitation:

    Article Title: Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics. Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics
    Article Snippet: .. Quantitative real‐time polymerase chain reaction (PCR) for ChIP samples: quantitative PCR (qPCR) for ChIP samples was conducted using SYBR green reagents as per manufacturer's instructions (Roche) using the following primers to normalize transfection efficiencies from input DNA (LucChIP forward; CTTGCAGTTCTTCATGCCCG, LucChIP reverse; CTCACGAATACGACGGTGGG) and to assess immunoprecipitation of human ECR1T or ECR1C allelic variants following immunoprecipitation (hECR1 forward; TTAATGGCAGCTACATCCCC, hECR1 reverse; TCATGGCAGGAAAACTGCTC). ..

    SYBR Green Assay:

    Article Title: Eotaxin-2 increased toll-like receptor 4 expression in endothelial cells in vitro and exacerbates high-cholesterol diet-induced atherogenesis in vivo
    Article Snippet: .. Quantitative real time polymerase chain reaction (PCR) was performed using a FastStart DNA Master SYBR Green I kit and LightCycler (Roche, CA, USA). .. FastStart Taq DNA polymerase was activated by incubation at 95°C for 2 min before 40 cycles of 95°C for 1 s, 60°C for 5 s, and 72°C for 7 s. Fluorescence was measured at 86°C after the 72°C extension step.

    Article Title: OCLI-023, a Novel Pyrimidine Compound, Suppresses Osteoclastogenesis In Vitro and Alveolar Bone Resorption In Vivo
    Article Snippet: .. Quantitative real-time polymerase chain reaction (PCR) was performed in a LightCycler 1.5 real-time PCR system (Roche Diagnostics, Rotkreuz, Switzerland) using TOPreal qPCR 2× PreMIX with SYBR green (Enzynomics, Daejeon, Korea). .. The amplification conditions consisted of an initial denaturation step at 95°C for 10 min, followed by 45 cycles of denaturation for 10 s at 95°C, annealing for 15 s at 60°C, and extension for 10 s at 72°C.

    Article Title: Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics. Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics
    Article Snippet: .. Quantitative real‐time polymerase chain reaction (PCR) for ChIP samples: quantitative PCR (qPCR) for ChIP samples was conducted using SYBR green reagents as per manufacturer's instructions (Roche) using the following primers to normalize transfection efficiencies from input DNA (LucChIP forward; CTTGCAGTTCTTCATGCCCG, LucChIP reverse; CTCACGAATACGACGGTGGG) and to assess immunoprecipitation of human ECR1T or ECR1C allelic variants following immunoprecipitation (hECR1 forward; TTAATGGCAGCTACATCCCC, hECR1 reverse; TCATGGCAGGAAAACTGCTC). ..

    Article Title:
    Article Snippet: .. Quantitative real-time polymerase chain reaction (PCR) was then performed with LightCycler 1.5 (Roche Diagnostics, Mannheim, Germany) using QPCR SYBR Green Capillary Mix (ABgene, Surrey, UK) at 95°C for 15 minutes, followed by 40 cycles of 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds. .. The primer sequences used for amplification of the target genes are listed in .

    Enzyme-linked Immunosorbent Assay:

    Article Title: Assessment of the Frequency of Autoantibodies in Chronic Viral Hepatitis
    Article Snippet: .. ELISA (Vitros ECiO, Ortho Clinical Diagnostics) was used to examine hepatitis markers (HBs Ag, Anti HCV, HBe Ag, Anti HBe Ag); and quantitative Real Time Polymerase Chain Reaction (PCR) was used to detect HCV-RNA (Cobas Taqman48, Roche) at the ELISA and Molecular Microbiology Unit, Microbiology Laboratory, Medical Faculty of Afyon Kocatepe University. .. IFA method was utilized for the detection and pattern examination of ANA (ANA profile 3, Euroimmun) using fixed HEp-2 cells as substrate.

    Immunoprecipitation:

    Article Title: Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics. Disease‐associated polymorphisms within the conserved ECR1 enhancer differentially regulate the tissue‐specific activity of the cannabinoid‐1 receptor gene promoter; implications for cannabinoid pharmacogenetics
    Article Snippet: .. Quantitative real‐time polymerase chain reaction (PCR) for ChIP samples: quantitative PCR (qPCR) for ChIP samples was conducted using SYBR green reagents as per manufacturer's instructions (Roche) using the following primers to normalize transfection efficiencies from input DNA (LucChIP forward; CTTGCAGTTCTTCATGCCCG, LucChIP reverse; CTCACGAATACGACGGTGGG) and to assess immunoprecipitation of human ECR1T or ECR1C allelic variants following immunoprecipitation (hECR1 forward; TTAATGGCAGCTACATCCCC, hECR1 reverse; TCATGGCAGGAAAACTGCTC). ..

    Lysis:

    Article Title:
    Article Snippet: To measure the mRNA levels of the target genes, total RNAs were extracted using Qiagen lysis solution (Qiagen, Hilden, Germany) according to the manufacturer’s instructions and reverse-transcribed into cDNA using the GoScript reverse transcription system (Promega). .. Quantitative real-time polymerase chain reaction (PCR) was then performed with LightCycler 1.5 (Roche Diagnostics, Mannheim, Germany) using QPCR SYBR Green Capillary Mix (ABgene, Surrey, UK) at 95°C for 15 minutes, followed by 40 cycles of 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Roche quantitati
    Quantitati, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitati/product/Roche
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    quantitati - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    Image Search Results