quant it dsdna hs kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Quant iT dsDNA Assay Kit
    Description:
    The Quant iT High Sensitivity dsDNA Assay Kit makes DNA quantitation easy and accurate The kit provides concentrated assay reagent dilution buffer and pre diluted DNA standards The assay is highly selective for double stranded DNA over RNA and in the range of 0 2 100 ng of DNA the fluorescence signal is linear A Quant iT dsDNA Assay Kit with a range of 2 1000 ng of dsDNA is available Q33130 and we also offer a Quant iT RNA Assay Kit Q33140 Check out our products for nucleic acid purification
    Catalog Number:
    q33120
    Price:
    None
    Applications:
    DNA & RNA Purification & Analysis|DNA Quantitation|Nucleic Acid Quantitation
    Category:
    Kits and Assays
    Buy from Supplier


    Structured Review

    Thermo Fisher quant it dsdna hs kit
    The Quant iT High Sensitivity dsDNA Assay Kit makes DNA quantitation easy and accurate The kit provides concentrated assay reagent dilution buffer and pre diluted DNA standards The assay is highly selective for double stranded DNA over RNA and in the range of 0 2 100 ng of DNA the fluorescence signal is linear A Quant iT dsDNA Assay Kit with a range of 2 1000 ng of dsDNA is available Q33130 and we also offer a Quant iT RNA Assay Kit Q33140 Check out our products for nucleic acid purification
    https://www.bioz.com/result/quant it dsdna hs kit/product/Thermo Fisher
    Average 90 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    quant it dsdna hs kit - by Bioz Stars, 2020-02
    90/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Repeated inoculation of cattle rumen with bison rumen contents alters the rumen microbiome and improves nitrogen digestibility in cattle
    Article Snippet: Paragraph title: PCR amplification and 16S rRNA aomplicon sequencing ... Quantitation of amplicons was performed in a Synergy HTX Multi-Mode Microplate Reader (model SIAFRM, Bio-Tek Instruments Inc., Winooski, USA) using a Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific, Waltham, USA).

    Article Title: Archaeal and bacterial communities across a chronosequence of drained lake basins in arctic alaska
    Article Snippet: Paragraph title: SSU rRNA gene amplicon analysis ... The DNA concentration was determined using Quant-iT dsDNA assay kit (Invitrogen, Carlsbad, CA).

    Article Title: Investigation and manipulation of metabolically active methanogen community composition during rumen development in black goats
    Article Snippet: Paragraph title: PCR amplification and 16S rRNA amplicon sequencing ... Quantitation of amplicons was performed in a Synergy HTX Multi-Mode Microplate Reader (model SIAFRM, Bio-Tek Instruments Inc., Winooski, USA) using a Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific, Waltham, USA).

    Article Title: Development of gut inflammation in mice colonized with mucosa-associated bacteria from patients with ulcerative colitis
    Article Snippet: Next generation sequencing analysis and bioinformatics For library preparation V3 and V4 region of 16S rRNA was amplified in triplicate PCR reaction using primer pair 341F (CCTACGGGNGGCWGCAG) and 806R (GGACTACHVGGGTWTCTAAT) to utilize to the maximum read length of employed 2 × 300 pair-end sequencing at Illumina MiSeq platform (San Diego, CA, USA). .. Concentrations of cleaned samples were measured fluorescently with Quant-iT dsDNA Assay kit (Thermo Fisher Scientific).

    Article Title: Endoplasmic reticulum stress-induced CHOP activation mediates the down-regulation of leptin in human neuroblastoma SH-SY5Y cells treated with the oxysterol 27-hydroxycholesterol
    Article Snippet: 1μL of the purified DNA was used for DNA concentration analysis using the “Quant iT™ dsDNA Assay kit from Invitrogen (Eugene, OR) The DNA fragment size was determined by electrophoresis on a 1.2% agarose FlashGelR system (Lonza, Rockland, ME). .. The amplification was performed using an iCycler iQ Multicolor Real Time PCR Detection System (BioRad, Hercules, CA).The fold enrichment of the bound C/EBPα in the leptin promoter region was calculated using the ΔΔCt method [ ] which normalizes ChIP Ct values of each sample to the % input and background.

    Article Title: Bacterial Community Analysis of Drinking Water Biofilms in Southern Sweden
    Article Snippet: Paragraph title: Amplicon library preparation ... Amplicons were quantified using the Quant-iT dsDNA assay kit (Invitrogen) and Quantifluor fluorometer (Promega), and pools were diluted to obtain a total of 1×107 copies μL−1 .

    Article Title: Michigan cohorts to determine associations of maternal pre-pregnancy body mass index with pregnancy and infant gastrointestinal microbial communities: Late pregnancy and early infancy
    Article Snippet: Paragraph title: DNA extraction and amplification ... After purification, the concentration of 16S rRNA gene amplicons was quantified using the Quant-IT dsDNA assay kit (Invitrogen, Carlsbad, CA).

    Construct:

    Article Title: The Genome of Haemoproteus tartakovskyi and Its Relationship to Human Malaria Parasites
    Article Snippet: The 3-kb paired end library was constructed according to the GS FLX Paired End Rapid Library Preparation method (April 2012 version) (Roche) including the use of a HydroShear Plus (Digilab Inc.) to fragmentize DNA. .. The 3-kb paired end library was then quantified using the Quant-iT dsDNA assay kit (Invitrogen) and a Quantiflour fluorometer (Promega), and finally diluted to obtain a total of 1 × 107 copies μl − 1 .

    Article Title: Oak genome reveals facets of long lifespan
    Article Snippet: DNA concentrations were determined with the Quant-iT dsDNA Assay Kit (Life Technologies, Carlsbad, California, USA) and a Qubit Fluorometer (Invitrogen, Carlsbad, CA, USA). .. Agarose-embedded high-molecular weight (HMW) DNA was prepared as described by Peterson et al. , and modified as described by Zhang et al. , to construct Illumina TruSeq Synthetic Long Read (TSLR) libraries.

    SYBR Green Assay:

    Article Title: Endoplasmic reticulum stress-induced CHOP activation mediates the down-regulation of leptin in human neuroblastoma SH-SY5Y cells treated with the oxysterol 27-hydroxycholesterol
    Article Snippet: 1μL of the purified DNA was used for DNA concentration analysis using the “Quant iT™ dsDNA Assay kit from Invitrogen (Eugene, OR) The DNA fragment size was determined by electrophoresis on a 1.2% agarose FlashGelR system (Lonza, Rockland, ME). .. The relative abundance of the C/EBPα antibody precipitated chromatin containing the C/EBPα binding site in the leptin promoter region was determined by qPCR using an iQ SYBR Green Supermix kit following the manufacturer's instructions (BioRad, Hercules, CA) and sequence specific primers ( ).

    Incubation:

    Article Title: E-PostersArthroplasty-CervicalP001 - Long Term Results With Activ C@ Cervical Total Disc Replacement (CTDR)P002 - Cervical Disc Arthroplasty: Clinical Outcomes, Heterotopic Ossification And Adjacent Segment Disease At Ten Years Follow-UpP003 - Medium-Term Outcomes Of Activ-C Artificial Disc Replacement For Symptomatic Single Level Cervical Degenerative DiseasesP004 - MRI Interferences Of 3 Differe
    Article Snippet: .. Cell growth in the beads at the end of the incubation period was determined using Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific). ..

    Article Title: Rapid detection of structural variation in a human genome using nanochannel-based genome mapping technology
    Article Snippet: Plugs were incubated with lysis buffer and proteinase K for four hours at 50°C. .. The purified DNA was subjected to four hours of drop dialysis (Millipore, #VCWP04700) and quantified using Nanodrop 1000 (Thermal Fisher Scientific) and/or the Quant-iT dsDNA Assay Kit (Invitrogen/Molecular Probes).

    Article Title: Endoplasmic reticulum stress-induced CHOP activation mediates the down-regulation of leptin in human neuroblastoma SH-SY5Y cells treated with the oxysterol 27-hydroxycholesterol
    Article Snippet: The DNA from the DNA-protein complexes from all the samples including the input and negative control was reverse cross-linked by incubation with 2μL of Proteinase K for 2 hours at 65°C. .. 1μL of the purified DNA was used for DNA concentration analysis using the “Quant iT™ dsDNA Assay kit from Invitrogen (Eugene, OR) The DNA fragment size was determined by electrophoresis on a 1.2% agarose FlashGelR system (Lonza, Rockland, ME).

    Expressing:

    Article Title: E-PostersArthroplasty-CervicalP001 - Long Term Results With Activ C@ Cervical Total Disc Replacement (CTDR)P002 - Cervical Disc Arthroplasty: Clinical Outcomes, Heterotopic Ossification And Adjacent Segment Disease At Ten Years Follow-UpP003 - Medium-Term Outcomes Of Activ-C Artificial Disc Replacement For Symptomatic Single Level Cervical Degenerative DiseasesP004 - MRI Interferences Of 3 Differe
    Article Snippet: Gene expression of matrix proteins type I and II collagen and aggrecan were determined by qPCR. .. Cell growth in the beads at the end of the incubation period was determined using Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific).

    Modification:

    Article Title: E-PostersArthroplasty-CervicalP001 - Long Term Results With Activ C@ Cervical Total Disc Replacement (CTDR)P002 - Cervical Disc Arthroplasty: Clinical Outcomes, Heterotopic Ossification And Adjacent Segment Disease At Ten Years Follow-UpP003 - Medium-Term Outcomes Of Activ-C Artificial Disc Replacement For Symptomatic Single Level Cervical Degenerative DiseasesP004 - MRI Interferences Of 3 Differe
    Article Snippet: A modified GAG assay was performed on the beads to determine proteoglycan content and the hydroxyproline assay was performed to determine collagen content. .. Cell growth in the beads at the end of the incubation period was determined using Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific).

    Article Title: Oak genome reveals facets of long lifespan
    Article Snippet: DNA concentrations were determined with the Quant-iT dsDNA Assay Kit (Life Technologies, Carlsbad, California, USA) and a Qubit Fluorometer (Invitrogen, Carlsbad, CA, USA). .. Agarose-embedded high-molecular weight (HMW) DNA was prepared as described by Peterson et al. , and modified as described by Zhang et al. , to construct Illumina TruSeq Synthetic Long Read (TSLR) libraries.

    Ligation:

    Article Title: The Genome of Haemoproteus tartakovskyi and Its Relationship to Human Malaria Parasites
    Article Snippet: After adaptor ligation and purification, the library was inspected using the DNA High Sensitivity kit on a 2100 BioAnalyzer (Agilent). .. The 3-kb paired end library was then quantified using the Quant-iT dsDNA assay kit (Invitrogen) and a Quantiflour fluorometer (Promega), and finally diluted to obtain a total of 1 × 107 copies μl − 1 .

    Cell Culture:

    Article Title: E-PostersArthroplasty-CervicalP001 - Long Term Results With Activ C@ Cervical Total Disc Replacement (CTDR)P002 - Cervical Disc Arthroplasty: Clinical Outcomes, Heterotopic Ossification And Adjacent Segment Disease At Ten Years Follow-UpP003 - Medium-Term Outcomes Of Activ-C Artificial Disc Replacement For Symptomatic Single Level Cervical Degenerative DiseasesP004 - MRI Interferences Of 3 Differe
    Article Snippet: Bovine nucleus pulposus (NP) and annulus fibrosus (AF) cells were cultured in PrimeGrowthTM IVD Cell, DMEM, Alpha MEM, and Ham’s F12 media supplemented with 10% FBS and antibiotics. .. Cell growth in the beads at the end of the incubation period was determined using Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific).

    Sequencing:

    Article Title: The Genome of Haemoproteus tartakovskyi and Its Relationship to Human Malaria Parasites
    Article Snippet: Paragraph title: Sequencing and Genome Assembly ... The 3-kb paired end library was then quantified using the Quant-iT dsDNA assay kit (Invitrogen) and a Quantiflour fluorometer (Promega), and finally diluted to obtain a total of 1 × 107 copies μl − 1 .

    Article Title: Repeated inoculation of cattle rumen with bison rumen contents alters the rumen microbiome and improves nitrogen digestibility in cattle
    Article Snippet: Paragraph title: PCR amplification and 16S rRNA aomplicon sequencing ... Quantitation of amplicons was performed in a Synergy HTX Multi-Mode Microplate Reader (model SIAFRM, Bio-Tek Instruments Inc., Winooski, USA) using a Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific, Waltham, USA).

    Article Title: Archaeal and bacterial communities across a chronosequence of drained lake basins in arctic alaska
    Article Snippet: The DNA concentration was determined using Quant-iT dsDNA assay kit (Invitrogen, Carlsbad, CA). .. Amplification was achieved with universal primers 926F (5′- CCTATCCCCTGTGTGCCTTGGCAGTC TCAGAAACTYAAAKGAATTGRCGG-3′) sequencing adapter in bold, key underlined and SSU-specific primer following) and 1392wR (5′-CCATCTCATCCCTGCGTGTCTCCGACTCAGXXXXXACGGGCGGTGWGTRC), where Xs indicate a variable length multiplex identifier listed in (similar to a tested primer set in Engelbrektson et al. , 2010).

    Article Title: Investigation and manipulation of metabolically active methanogen community composition during rumen development in black goats
    Article Snippet: Paragraph title: PCR amplification and 16S rRNA amplicon sequencing ... Quantitation of amplicons was performed in a Synergy HTX Multi-Mode Microplate Reader (model SIAFRM, Bio-Tek Instruments Inc., Winooski, USA) using a Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific, Waltham, USA).

    Article Title: Development of gut inflammation in mice colonized with mucosa-associated bacteria from patients with ulcerative colitis
    Article Snippet: Next generation sequencing analysis and bioinformatics For library preparation V3 and V4 region of 16S rRNA was amplified in triplicate PCR reaction using primer pair 341F (CCTACGGGNGGCWGCAG) and 806R (GGACTACHVGGGTWTCTAAT) to utilize to the maximum read length of employed 2 × 300 pair-end sequencing at Illumina MiSeq platform (San Diego, CA, USA). .. Concentrations of cleaned samples were measured fluorescently with Quant-iT dsDNA Assay kit (Thermo Fisher Scientific).

    Article Title: Endoplasmic reticulum stress-induced CHOP activation mediates the down-regulation of leptin in human neuroblastoma SH-SY5Y cells treated with the oxysterol 27-hydroxycholesterol
    Article Snippet: 1μL of the purified DNA was used for DNA concentration analysis using the “Quant iT™ dsDNA Assay kit from Invitrogen (Eugene, OR) The DNA fragment size was determined by electrophoresis on a 1.2% agarose FlashGelR system (Lonza, Rockland, ME). .. The relative abundance of the C/EBPα antibody precipitated chromatin containing the C/EBPα binding site in the leptin promoter region was determined by qPCR using an iQ SYBR Green Supermix kit following the manufacturer's instructions (BioRad, Hercules, CA) and sequence specific primers ( ).

    Article Title: Oak genome reveals facets of long lifespan
    Article Snippet: Paragraph title: DNA sample preparation for reference genome sequencing ... DNA concentrations were determined with the Quant-iT dsDNA Assay Kit (Life Technologies, Carlsbad, California, USA) and a Qubit Fluorometer (Invitrogen, Carlsbad, CA, USA).

    Article Title: Michigan cohorts to determine associations of maternal pre-pregnancy body mass index with pregnancy and infant gastrointestinal microbial communities: Late pregnancy and early infancy
    Article Snippet: After purification, the concentration of 16S rRNA gene amplicons was quantified using the Quant-IT dsDNA assay kit (Invitrogen, Carlsbad, CA). .. For sequencing, equal amounts (in nanograms) of the purified 16S samples were pooled.

    Sonication:

    Article Title: Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance
    Article Snippet: Isolation of nucleic acids and protein from gradient purified mitochondria Gradient purified mitochondrial pellets were sonicated until completely dissolved before nucleic acid and protein isolation. .. Nucleic acids were isolated from gradient purified mitochondria using the AllPrep DNA/RNA Mini Kit from Qiagen using 600 μL Buffer RLT Plus. mtDNA quantification was performed using the Quant-iT dsDNA Assay Kit by Invitrogen and measured on a TECAN Genios Pro 96-well plate optical reader.

    Binding Assay:

    Article Title: Endoplasmic reticulum stress-induced CHOP activation mediates the down-regulation of leptin in human neuroblastoma SH-SY5Y cells treated with the oxysterol 27-hydroxycholesterol
    Article Snippet: The DNA-protein complexes were collected with Protein G agarose beads and washed to remove non-specific antibody binding. .. 1μL of the purified DNA was used for DNA concentration analysis using the “Quant iT™ dsDNA Assay kit from Invitrogen (Eugene, OR) The DNA fragment size was determined by electrophoresis on a 1.2% agarose FlashGelR system (Lonza, Rockland, ME).

    DNA Extraction:

    Article Title: Novel biomarker panel predicts prognosis in HPV-negative oropharyngeal cancer: An analysis of the TAX 324 trial (WU)
    Article Snippet: DNA extraction was performed using the QIAamp DNA Micro Kit (Qiagen, Valencia, CA), following the instruction manual protocol for laser-microdissected tissue. .. DNA was quantitated using the Quant-iT dsDNA Assay Kit, (Invitrogen, Eugene, OR) and stored at −80° C. Working 0.5 ng/μl dilutions were prepared from stored aliquots.

    Article Title: Archaeal and bacterial communities across a chronosequence of drained lake basins in arctic alaska
    Article Snippet: Permafrost R1 and Permafrost R2 samples were extracted with the PowerMax Soil DNA extraction kit due to low yield. .. The DNA concentration was determined using Quant-iT dsDNA assay kit (Invitrogen, Carlsbad, CA).

    Article Title: Rapid detection of structural variation in a human genome using nanochannel-based genome mapping technology
    Article Snippet: Paragraph title: High-molecular weight DNA extraction ... The purified DNA was subjected to four hours of drop dialysis (Millipore, #VCWP04700) and quantified using Nanodrop 1000 (Thermal Fisher Scientific) and/or the Quant-iT dsDNA Assay Kit (Invitrogen/Molecular Probes).

    Article Title: High Pressure-Induced mtDNA Alterations in Retinal Ganglion Cells and Subsequent Apoptosis
    Article Snippet: Paragraph title: DNA Isolation ... The amount of DNA was determined using the Quant-iT dsDNA assay kit (Invitrogen, Carlsbad, CA, USA).

    Article Title: Michigan cohorts to determine associations of maternal pre-pregnancy body mass index with pregnancy and infant gastrointestinal microbial communities: Late pregnancy and early infancy
    Article Snippet: Paragraph title: DNA extraction and amplification ... After purification, the concentration of 16S rRNA gene amplicons was quantified using the Quant-IT dsDNA assay kit (Invitrogen, Carlsbad, CA).

    Isolation:

    Article Title: Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance
    Article Snippet: .. Nucleic acids were isolated from gradient purified mitochondria using the AllPrep DNA/RNA Mini Kit from Qiagen using 600 μL Buffer RLT Plus. mtDNA quantification was performed using the Quant-iT dsDNA Assay Kit by Invitrogen and measured on a TECAN Genios Pro 96-well plate optical reader. .. For protein isolation, the mitochondrial pellets were sonicated until dissolved and vortexed every 5 min for 30 min while held on ice.

    Article Title: High Pressure-Induced mtDNA Alterations in Retinal Ganglion Cells and Subsequent Apoptosis
    Article Snippet: Shortly, the total DNA was isolated using the DNeasy blood and tissue kit (QIAGEN, Duess eldorf, Germany). mtDNA were obtained from the isolated mitochondria by use of mitochondrial lysis buffer containing proteinase K (0.2 mg/ml), SDS (0.5%), Tris-HCl (10 mM) and 0.05 M EDTA. .. The amount of DNA was determined using the Quant-iT dsDNA assay kit (Invitrogen, Carlsbad, CA, USA).

    Negative Control:

    Article Title: Repeated inoculation of cattle rumen with bison rumen contents alters the rumen microbiome and improves nitrogen digestibility in cattle
    Article Snippet: Each cDNA sample was amplified in duplicate, and 3 wells per run served as a negative control for the master mix. .. Quantitation of amplicons was performed in a Synergy HTX Multi-Mode Microplate Reader (model SIAFRM, Bio-Tek Instruments Inc., Winooski, USA) using a Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific, Waltham, USA).

    Article Title: Investigation and manipulation of metabolically active methanogen community composition during rumen development in black goats
    Article Snippet: Each cDNA sample was amplified in duplicates, and 3 wells per run served as a negative control for the master mix. .. Quantitation of amplicons was performed in a Synergy HTX Multi-Mode Microplate Reader (model SIAFRM, Bio-Tek Instruments Inc., Winooski, USA) using a Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific, Waltham, USA).

    Article Title: Endoplasmic reticulum stress-induced CHOP activation mediates the down-regulation of leptin in human neuroblastoma SH-SY5Y cells treated with the oxysterol 27-hydroxycholesterol
    Article Snippet: The DNA from the DNA-protein complexes from all the samples including the input and negative control was reverse cross-linked by incubation with 2μL of Proteinase K for 2 hours at 65°C. .. 1μL of the purified DNA was used for DNA concentration analysis using the “Quant iT™ dsDNA Assay kit from Invitrogen (Eugene, OR) The DNA fragment size was determined by electrophoresis on a 1.2% agarose FlashGelR system (Lonza, Rockland, ME).

    Titration:

    Article Title: Bacterial Community Analysis of Drinking Water Biofilms in Southern Sweden
    Article Snippet: Amplicons were quantified using the Quant-iT dsDNA assay kit (Invitrogen) and Quantifluor fluorometer (Promega), and pools were diluted to obtain a total of 1×107 copies μL−1 . .. Titration and library production (aiming at 10–15% enrichment) were performed using emulsion PCR and the Lib-A kit (Roche).

    Polymerase Chain Reaction:

    Article Title: Repeated inoculation of cattle rumen with bison rumen contents alters the rumen microbiome and improves nitrogen digestibility in cattle
    Article Snippet: Paragraph title: PCR amplification and 16S rRNA aomplicon sequencing ... Quantitation of amplicons was performed in a Synergy HTX Multi-Mode Microplate Reader (model SIAFRM, Bio-Tek Instruments Inc., Winooski, USA) using a Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific, Waltham, USA).

    Article Title: Novel biomarker panel predicts prognosis in HPV-negative oropharyngeal cancer: An analysis of the TAX 324 trial (WU)
    Article Snippet: DNA was quantitated using the Quant-iT dsDNA Assay Kit, (Invitrogen, Eugene, OR) and stored at −80° C. Working 0.5 ng/μl dilutions were prepared from stored aliquots. .. Sufficient DNA for PCR analysis was recovered in 265 out of 270 cases.

    Article Title: Archaeal and bacterial communities across a chronosequence of drained lake basins in arctic alaska
    Article Snippet: SSU rRNA gene amplicon analysis DNA was extracted from thawed samples that were kept frozen at −80 °C using the PowerSoil DNA extraction kit (MoBio Laboratories, Carlsbad, CA), quantified, and checked for quality via PCR amplification. .. The DNA concentration was determined using Quant-iT dsDNA assay kit (Invitrogen, Carlsbad, CA).

    Article Title: Investigation and manipulation of metabolically active methanogen community composition during rumen development in black goats
    Article Snippet: Paragraph title: PCR amplification and 16S rRNA amplicon sequencing ... Quantitation of amplicons was performed in a Synergy HTX Multi-Mode Microplate Reader (model SIAFRM, Bio-Tek Instruments Inc., Winooski, USA) using a Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific, Waltham, USA).

    Article Title: Development of gut inflammation in mice colonized with mucosa-associated bacteria from patients with ulcerative colitis
    Article Snippet: Next, the triplicates from the same template reactions were pooled and cleaned using UltraClean htp 96 well PCR clean-up kit (MoBio, Carlsbad, CA, USA). .. Concentrations of cleaned samples were measured fluorescently with Quant-iT dsDNA Assay kit (Thermo Fisher Scientific).

    Article Title: Bacterial Community Analysis of Drinking Water Biofilms in Southern Sweden
    Article Snippet: Amplicons were quantified using the Quant-iT dsDNA assay kit (Invitrogen) and Quantifluor fluorometer (Promega), and pools were diluted to obtain a total of 1×107 copies μL−1 . .. Titration and library production (aiming at 10–15% enrichment) were performed using emulsion PCR and the Lib-A kit (Roche).

    IA:

    Article Title: Michigan cohorts to determine associations of maternal pre-pregnancy body mass index with pregnancy and infant gastrointestinal microbial communities: Late pregnancy and early infancy
    Article Snippet: Successful amplification triplicates were pooled and purified using Agencourt AMPure XP (Beckman Coulter, Brea, CA) with the following alterations to the protocol: 0.7 times the sample volume of AMPure was used for purification and 16S rRNA DNA was eluted using 25 μL of low EDTA TE buffer (IDT, Coralville, IA). .. After purification, the concentration of 16S rRNA gene amplicons was quantified using the Quant-IT dsDNA assay kit (Invitrogen, Carlsbad, CA).

    Agarose Gel Electrophoresis:

    Article Title: Development of gut inflammation in mice colonized with mucosa-associated bacteria from patients with ulcerative colitis
    Article Snippet: PCR reactions were checked on agarose gel for presence of expected product in samples and its absence in negative controls. .. Concentrations of cleaned samples were measured fluorescently with Quant-iT dsDNA Assay kit (Thermo Fisher Scientific).

    Article Title: Michigan cohorts to determine associations of maternal pre-pregnancy body mass index with pregnancy and infant gastrointestinal microbial communities: Late pregnancy and early infancy
    Article Snippet: Amplification success was checked by electrophoresis on a 1% agarose gel run at 200 V for 30 min. .. After purification, the concentration of 16S rRNA gene amplicons was quantified using the Quant-IT dsDNA assay kit (Invitrogen, Carlsbad, CA).

    Purification:

    Article Title: The Genome of Haemoproteus tartakovskyi and Its Relationship to Human Malaria Parasites
    Article Snippet: After adaptor ligation and purification, the library was inspected using the DNA High Sensitivity kit on a 2100 BioAnalyzer (Agilent). .. The 3-kb paired end library was then quantified using the Quant-iT dsDNA assay kit (Invitrogen) and a Quantiflour fluorometer (Promega), and finally diluted to obtain a total of 1 × 107 copies μl − 1 .

    Article Title: Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance
    Article Snippet: .. Nucleic acids were isolated from gradient purified mitochondria using the AllPrep DNA/RNA Mini Kit from Qiagen using 600 μL Buffer RLT Plus. mtDNA quantification was performed using the Quant-iT dsDNA Assay Kit by Invitrogen and measured on a TECAN Genios Pro 96-well plate optical reader. .. For protein isolation, the mitochondrial pellets were sonicated until dissolved and vortexed every 5 min for 30 min while held on ice.

    Article Title: Repeated inoculation of cattle rumen with bison rumen contents alters the rumen microbiome and improves nitrogen digestibility in cattle
    Article Snippet: Quantitation of amplicons was performed in a Synergy HTX Multi-Mode Microplate Reader (model SIAFRM, Bio-Tek Instruments Inc., Winooski, USA) using a Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific, Waltham, USA). .. The amplicons were pooled in equimolar concentrations and purified using Agencourt AMPure XP beads (Beckman Coulter Inc., Brea, USA) and then further quantified as described above.

    Article Title: Investigation and manipulation of metabolically active methanogen community composition during rumen development in black goats
    Article Snippet: Quantitation of amplicons was performed in a Synergy HTX Multi-Mode Microplate Reader (model SIAFRM, Bio-Tek Instruments Inc., Winooski, USA) using a Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific, Waltham, USA). .. The amplicons were pooled in equimolar concentrations and purified using Agencourt AMPure XP beads (Beckman Coulter Inc., Brea, USA) and then further quantified as described above.

    Article Title: Rapid detection of structural variation in a human genome using nanochannel-based genome mapping technology
    Article Snippet: .. The purified DNA was subjected to four hours of drop dialysis (Millipore, #VCWP04700) and quantified using Nanodrop 1000 (Thermal Fisher Scientific) and/or the Quant-iT dsDNA Assay Kit (Invitrogen/Molecular Probes). .. DNA labeling DNA was labeled according to commercial protocols using the IrysPrep Reagent Kit (BioNano Genomics, Inc).

    Article Title: Endoplasmic reticulum stress-induced CHOP activation mediates the down-regulation of leptin in human neuroblastoma SH-SY5Y cells treated with the oxysterol 27-hydroxycholesterol
    Article Snippet: .. 1μL of the purified DNA was used for DNA concentration analysis using the “Quant iT™ dsDNA Assay kit from Invitrogen (Eugene, OR) The DNA fragment size was determined by electrophoresis on a 1.2% agarose FlashGelR system (Lonza, Rockland, ME). .. The relative abundance of the C/EBPα antibody precipitated chromatin containing the C/EBPα binding site in the leptin promoter region was determined by qPCR using an iQ SYBR Green Supermix kit following the manufacturer's instructions (BioRad, Hercules, CA) and sequence specific primers ( ).

    Article Title: Bacterial Community Analysis of Drinking Water Biofilms in Southern Sweden
    Article Snippet: Amplicon library preparation Pooled amplicons were purified using the E.Z.N.A® Cycle Pure Kit (OMEGA, Bio-tek) and Cycle-Pure Spin Protocol according to the manufacturer’s instructions. .. Amplicons were quantified using the Quant-iT dsDNA assay kit (Invitrogen) and Quantifluor fluorometer (Promega), and pools were diluted to obtain a total of 1×107 copies μL−1 .

    Article Title: Michigan cohorts to determine associations of maternal pre-pregnancy body mass index with pregnancy and infant gastrointestinal microbial communities: Late pregnancy and early infancy
    Article Snippet: .. After purification, the concentration of 16S rRNA gene amplicons was quantified using the Quant-IT dsDNA assay kit (Invitrogen, Carlsbad, CA). .. Purified 16S rRNA amplicons were pooled and quality checked using an Agilent 2100 Bioanalyzer with the High Sensitivity DNA Chip (Agilent, 5067–4626).

    Chromatin Immunoprecipitation:

    Article Title: Endoplasmic reticulum stress-induced CHOP activation mediates the down-regulation of leptin in human neuroblastoma SH-SY5Y cells treated with the oxysterol 27-hydroxycholesterol
    Article Snippet: Paragraph title: 2.9. Chromatin Immunoprecipitation (ChIP) Analysis ... 1μL of the purified DNA was used for DNA concentration analysis using the “Quant iT™ dsDNA Assay kit from Invitrogen (Eugene, OR) The DNA fragment size was determined by electrophoresis on a 1.2% agarose FlashGelR system (Lonza, Rockland, ME).

    Article Title: Michigan cohorts to determine associations of maternal pre-pregnancy body mass index with pregnancy and infant gastrointestinal microbial communities: Late pregnancy and early infancy
    Article Snippet: After purification, the concentration of 16S rRNA gene amplicons was quantified using the Quant-IT dsDNA assay kit (Invitrogen, Carlsbad, CA). .. Purified 16S rRNA amplicons were pooled and quality checked using an Agilent 2100 Bioanalyzer with the High Sensitivity DNA Chip (Agilent, 5067–4626).

    Viability Assay:

    Article Title: E-PostersArthroplasty-CervicalP001 - Long Term Results With Activ C@ Cervical Total Disc Replacement (CTDR)P002 - Cervical Disc Arthroplasty: Clinical Outcomes, Heterotopic Ossification And Adjacent Segment Disease At Ten Years Follow-UpP003 - Medium-Term Outcomes Of Activ-C Artificial Disc Replacement For Symptomatic Single Level Cervical Degenerative DiseasesP004 - MRI Interferences Of 3 Differe
    Article Snippet: Cell viability was determined by counting live and dead cells in the beads following incubation with the Live/Dead Viability Assay kit (Thermo Fisher Scientific). .. Cell growth in the beads at the end of the incubation period was determined using Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific).

    Hydroxyproline Assay:

    Article Title: E-PostersArthroplasty-CervicalP001 - Long Term Results With Activ C@ Cervical Total Disc Replacement (CTDR)P002 - Cervical Disc Arthroplasty: Clinical Outcomes, Heterotopic Ossification And Adjacent Segment Disease At Ten Years Follow-UpP003 - Medium-Term Outcomes Of Activ-C Artificial Disc Replacement For Symptomatic Single Level Cervical Degenerative DiseasesP004 - MRI Interferences Of 3 Differe
    Article Snippet: A modified GAG assay was performed on the beads to determine proteoglycan content and the hydroxyproline assay was performed to determine collagen content. .. Cell growth in the beads at the end of the incubation period was determined using Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific).

    Real-time Polymerase Chain Reaction:

    Article Title: E-PostersArthroplasty-CervicalP001 - Long Term Results With Activ C@ Cervical Total Disc Replacement (CTDR)P002 - Cervical Disc Arthroplasty: Clinical Outcomes, Heterotopic Ossification And Adjacent Segment Disease At Ten Years Follow-UpP003 - Medium-Term Outcomes Of Activ-C Artificial Disc Replacement For Symptomatic Single Level Cervical Degenerative DiseasesP004 - MRI Interferences Of 3 Differe
    Article Snippet: Gene expression of matrix proteins type I and II collagen and aggrecan were determined by qPCR. .. Cell growth in the beads at the end of the incubation period was determined using Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific).

    Article Title: Endoplasmic reticulum stress-induced CHOP activation mediates the down-regulation of leptin in human neuroblastoma SH-SY5Y cells treated with the oxysterol 27-hydroxycholesterol
    Article Snippet: 1μL of the purified DNA was used for DNA concentration analysis using the “Quant iT™ dsDNA Assay kit from Invitrogen (Eugene, OR) The DNA fragment size was determined by electrophoresis on a 1.2% agarose FlashGelR system (Lonza, Rockland, ME). .. The relative abundance of the C/EBPα antibody precipitated chromatin containing the C/EBPα binding site in the leptin promoter region was determined by qPCR using an iQ SYBR Green Supermix kit following the manufacturer's instructions (BioRad, Hercules, CA) and sequence specific primers ( ).

    Multiplex Assay:

    Article Title: Archaeal and bacterial communities across a chronosequence of drained lake basins in arctic alaska
    Article Snippet: The DNA concentration was determined using Quant-iT dsDNA assay kit (Invitrogen, Carlsbad, CA). .. Amplification was achieved with universal primers 926F (5′- CCTATCCCCTGTGTGCCTTGGCAGTC TCAGAAACTYAAAKGAATTGRCGG-3′) sequencing adapter in bold, key underlined and SSU-specific primer following) and 1392wR (5′-CCATCTCATCCCTGCGTGTCTCCGACTCAGXXXXXACGGGCGGTGWGTRC), where Xs indicate a variable length multiplex identifier listed in (similar to a tested primer set in Engelbrektson et al. , 2010).

    Sample Prep:

    Article Title: Development of gut inflammation in mice colonized with mucosa-associated bacteria from patients with ulcerative colitis
    Article Snippet: Concentrations of cleaned samples were measured fluorescently with Quant-iT dsDNA Assay kit (Thermo Fisher Scientific). .. Sequencing adapters were ligated to the PCR amplicons with the help of TruSeq PCR-Free LT Sample preparation Kit following manufacturer instructions (Illumina, Inc).

    Article Title: Oak genome reveals facets of long lifespan
    Article Snippet: Paragraph title: DNA sample preparation for reference genome sequencing ... DNA concentrations were determined with the Quant-iT dsDNA Assay Kit (Life Technologies, Carlsbad, California, USA) and a Qubit Fluorometer (Invitrogen, Carlsbad, CA, USA).

    Electrophoresis:

    Article Title: Endoplasmic reticulum stress-induced CHOP activation mediates the down-regulation of leptin in human neuroblastoma SH-SY5Y cells treated with the oxysterol 27-hydroxycholesterol
    Article Snippet: .. 1μL of the purified DNA was used for DNA concentration analysis using the “Quant iT™ dsDNA Assay kit from Invitrogen (Eugene, OR) The DNA fragment size was determined by electrophoresis on a 1.2% agarose FlashGelR system (Lonza, Rockland, ME). .. The relative abundance of the C/EBPα antibody precipitated chromatin containing the C/EBPα binding site in the leptin promoter region was determined by qPCR using an iQ SYBR Green Supermix kit following the manufacturer's instructions (BioRad, Hercules, CA) and sequence specific primers ( ).

    Article Title: Michigan cohorts to determine associations of maternal pre-pregnancy body mass index with pregnancy and infant gastrointestinal microbial communities: Late pregnancy and early infancy
    Article Snippet: Amplification success was checked by electrophoresis on a 1% agarose gel run at 200 V for 30 min. .. After purification, the concentration of 16S rRNA gene amplicons was quantified using the Quant-IT dsDNA assay kit (Invitrogen, Carlsbad, CA).

    Next-Generation Sequencing:

    Article Title: Development of gut inflammation in mice colonized with mucosa-associated bacteria from patients with ulcerative colitis
    Article Snippet: Paragraph title: Next generation sequencing analysis and bioinformatics ... Concentrations of cleaned samples were measured fluorescently with Quant-iT dsDNA Assay kit (Thermo Fisher Scientific).

    dsDNA Assay:

    Article Title: The Genome of Haemoproteus tartakovskyi and Its Relationship to Human Malaria Parasites
    Article Snippet: .. The 3-kb paired end library was then quantified using the Quant-iT dsDNA assay kit (Invitrogen) and a Quantiflour fluorometer (Promega), and finally diluted to obtain a total of 1 × 107 copies μl − 1 . .. Titrations and library production (aiming at 10–15% enrichment) were performed by emulsion polymer chain reaction and by using the Lib-L kit (Roche).

    Article Title: Parkinson's disease brain mitochondria have impaired respirasome assembly, age-related increases in distribution of oxidative damage to mtDNA and no differences in heteroplasmic mtDNA mutation abundance
    Article Snippet: .. Nucleic acids were isolated from gradient purified mitochondria using the AllPrep DNA/RNA Mini Kit from Qiagen using 600 μL Buffer RLT Plus. mtDNA quantification was performed using the Quant-iT dsDNA Assay Kit by Invitrogen and measured on a TECAN Genios Pro 96-well plate optical reader. .. For protein isolation, the mitochondrial pellets were sonicated until dissolved and vortexed every 5 min for 30 min while held on ice.

    Article Title: Repeated inoculation of cattle rumen with bison rumen contents alters the rumen microbiome and improves nitrogen digestibility in cattle
    Article Snippet: .. Quantitation of amplicons was performed in a Synergy HTX Multi-Mode Microplate Reader (model SIAFRM, Bio-Tek Instruments Inc., Winooski, USA) using a Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific, Waltham, USA). .. The amplicons were pooled in equimolar concentrations and purified using Agencourt AMPure XP beads (Beckman Coulter Inc., Brea, USA) and then further quantified as described above.

    Article Title: Novel biomarker panel predicts prognosis in HPV-negative oropharyngeal cancer: An analysis of the TAX 324 trial (WU)
    Article Snippet: .. DNA was quantitated using the Quant-iT dsDNA Assay Kit, (Invitrogen, Eugene, OR) and stored at −80° C. Working 0.5 ng/μl dilutions were prepared from stored aliquots. .. Sufficient DNA for PCR analysis was recovered in 265 out of 270 cases.

    Article Title: E-PostersArthroplasty-CervicalP001 - Long Term Results With Activ C@ Cervical Total Disc Replacement (CTDR)P002 - Cervical Disc Arthroplasty: Clinical Outcomes, Heterotopic Ossification And Adjacent Segment Disease At Ten Years Follow-UpP003 - Medium-Term Outcomes Of Activ-C Artificial Disc Replacement For Symptomatic Single Level Cervical Degenerative DiseasesP004 - MRI Interferences Of 3 Differe
    Article Snippet: .. Cell growth in the beads at the end of the incubation period was determined using Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific). ..

    Article Title: Archaeal and bacterial communities across a chronosequence of drained lake basins in arctic alaska
    Article Snippet: .. The DNA concentration was determined using Quant-iT dsDNA assay kit (Invitrogen, Carlsbad, CA). .. Amplification was achieved with universal primers 926F (5′- CCTATCCCCTGTGTGCCTTGGCAGTC TCAGAAACTYAAAKGAATTGRCGG-3′) sequencing adapter in bold, key underlined and SSU-specific primer following) and 1392wR (5′-CCATCTCATCCCTGCGTGTCTCCGACTCAGXXXXXACGGGCGGTGWGTRC), where Xs indicate a variable length multiplex identifier listed in (similar to a tested primer set in Engelbrektson et al. , 2010).

    Article Title: Investigation and manipulation of metabolically active methanogen community composition during rumen development in black goats
    Article Snippet: .. Quantitation of amplicons was performed in a Synergy HTX Multi-Mode Microplate Reader (model SIAFRM, Bio-Tek Instruments Inc., Winooski, USA) using a Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific, Waltham, USA). .. The amplicons were pooled in equimolar concentrations and purified using Agencourt AMPure XP beads (Beckman Coulter Inc., Brea, USA) and then further quantified as described above.

    Article Title: Identification of QTL controlling domestication-related traits in cowpea (Vigna unguiculata L. Walp)
    Article Snippet: .. Total genomic DNA of each line and parents was extracted from dried leaves using Plant DNeasy (Qiagen, Germany), quantified using Quant-IT dsDNA Assay Kit (Thermo Fisher Scientific, USA), and the concentration adjusted to 80 ng/µl. ..

    Article Title: Development of gut inflammation in mice colonized with mucosa-associated bacteria from patients with ulcerative colitis
    Article Snippet: .. Concentrations of cleaned samples were measured fluorescently with Quant-iT dsDNA Assay kit (Thermo Fisher Scientific). .. Sequencing adapters were ligated to the PCR amplicons with the help of TruSeq PCR-Free LT Sample preparation Kit following manufacturer instructions (Illumina, Inc).

    Article Title: Rapid detection of structural variation in a human genome using nanochannel-based genome mapping technology
    Article Snippet: .. The purified DNA was subjected to four hours of drop dialysis (Millipore, #VCWP04700) and quantified using Nanodrop 1000 (Thermal Fisher Scientific) and/or the Quant-iT dsDNA Assay Kit (Invitrogen/Molecular Probes). .. DNA labeling DNA was labeled according to commercial protocols using the IrysPrep Reagent Kit (BioNano Genomics, Inc).

    Article Title: Endoplasmic reticulum stress-induced CHOP activation mediates the down-regulation of leptin in human neuroblastoma SH-SY5Y cells treated with the oxysterol 27-hydroxycholesterol
    Article Snippet: .. 1μL of the purified DNA was used for DNA concentration analysis using the “Quant iT™ dsDNA Assay kit from Invitrogen (Eugene, OR) The DNA fragment size was determined by electrophoresis on a 1.2% agarose FlashGelR system (Lonza, Rockland, ME). .. The relative abundance of the C/EBPα antibody precipitated chromatin containing the C/EBPα binding site in the leptin promoter region was determined by qPCR using an iQ SYBR Green Supermix kit following the manufacturer's instructions (BioRad, Hercules, CA) and sequence specific primers ( ).

    Article Title: Bacterial Community Analysis of Drinking Water Biofilms in Southern Sweden
    Article Snippet: .. Amplicons were quantified using the Quant-iT dsDNA assay kit (Invitrogen) and Quantifluor fluorometer (Promega), and pools were diluted to obtain a total of 1×107 copies μL−1 . .. Titration and library production (aiming at 10–15% enrichment) were performed using emulsion PCR and the Lib-A kit (Roche).

    Article Title: Oak genome reveals facets of long lifespan
    Article Snippet: .. DNA concentrations were determined with the Quant-iT dsDNA Assay Kit (Life Technologies, Carlsbad, California, USA) and a Qubit Fluorometer (Invitrogen, Carlsbad, CA, USA). ..

    Article Title: High Pressure-Induced mtDNA Alterations in Retinal Ganglion Cells and Subsequent Apoptosis
    Article Snippet: .. The amount of DNA was determined using the Quant-iT dsDNA assay kit (Invitrogen, Carlsbad, CA, USA). .. Quantification of mtDNA Mutation mtDNA mutation frequency was detected by random mutation capture assay as described in our published article (Wu et al., ).

    Article Title: Michigan cohorts to determine associations of maternal pre-pregnancy body mass index with pregnancy and infant gastrointestinal microbial communities: Late pregnancy and early infancy
    Article Snippet: .. After purification, the concentration of 16S rRNA gene amplicons was quantified using the Quant-IT dsDNA assay kit (Invitrogen, Carlsbad, CA). .. Purified 16S rRNA amplicons were pooled and quality checked using an Agilent 2100 Bioanalyzer with the High Sensitivity DNA Chip (Agilent, 5067–4626).

    Quantitation Assay:

    Article Title: Repeated inoculation of cattle rumen with bison rumen contents alters the rumen microbiome and improves nitrogen digestibility in cattle
    Article Snippet: .. Quantitation of amplicons was performed in a Synergy HTX Multi-Mode Microplate Reader (model SIAFRM, Bio-Tek Instruments Inc., Winooski, USA) using a Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific, Waltham, USA). .. The amplicons were pooled in equimolar concentrations and purified using Agencourt AMPure XP beads (Beckman Coulter Inc., Brea, USA) and then further quantified as described above.

    Article Title: Investigation and manipulation of metabolically active methanogen community composition during rumen development in black goats
    Article Snippet: .. Quantitation of amplicons was performed in a Synergy HTX Multi-Mode Microplate Reader (model SIAFRM, Bio-Tek Instruments Inc., Winooski, USA) using a Quant-iT dsDNA Assay Kit (Thermo Fisher Scientific, Waltham, USA). .. The amplicons were pooled in equimolar concentrations and purified using Agencourt AMPure XP beads (Beckman Coulter Inc., Brea, USA) and then further quantified as described above.

    Concentration Assay:

    Article Title: Archaeal and bacterial communities across a chronosequence of drained lake basins in arctic alaska
    Article Snippet: .. The DNA concentration was determined using Quant-iT dsDNA assay kit (Invitrogen, Carlsbad, CA). .. Amplification was achieved with universal primers 926F (5′- CCTATCCCCTGTGTGCCTTGGCAGTC TCAGAAACTYAAAKGAATTGRCGG-3′) sequencing adapter in bold, key underlined and SSU-specific primer following) and 1392wR (5′-CCATCTCATCCCTGCGTGTCTCCGACTCAGXXXXXACGGGCGGTGWGTRC), where Xs indicate a variable length multiplex identifier listed in (similar to a tested primer set in Engelbrektson et al. , 2010).

    Article Title: Identification of QTL controlling domestication-related traits in cowpea (Vigna unguiculata L. Walp)
    Article Snippet: .. Total genomic DNA of each line and parents was extracted from dried leaves using Plant DNeasy (Qiagen, Germany), quantified using Quant-IT dsDNA Assay Kit (Thermo Fisher Scientific, USA), and the concentration adjusted to 80 ng/µl. ..

    Article Title: Development of gut inflammation in mice colonized with mucosa-associated bacteria from patients with ulcerative colitis
    Article Snippet: Concentrations of cleaned samples were measured fluorescently with Quant-iT dsDNA Assay kit (Thermo Fisher Scientific). .. Next, sample libraries were pooled in equimolar concentration to produce final library, which was sequenced on Illumina MiSeq instrument at Genomics Core Facility, CEITEC (Brno, Czech Republic).

    Article Title: Endoplasmic reticulum stress-induced CHOP activation mediates the down-regulation of leptin in human neuroblastoma SH-SY5Y cells treated with the oxysterol 27-hydroxycholesterol
    Article Snippet: .. 1μL of the purified DNA was used for DNA concentration analysis using the “Quant iT™ dsDNA Assay kit from Invitrogen (Eugene, OR) The DNA fragment size was determined by electrophoresis on a 1.2% agarose FlashGelR system (Lonza, Rockland, ME). .. The relative abundance of the C/EBPα antibody precipitated chromatin containing the C/EBPα binding site in the leptin promoter region was determined by qPCR using an iQ SYBR Green Supermix kit following the manufacturer's instructions (BioRad, Hercules, CA) and sequence specific primers ( ).

    Article Title: Michigan cohorts to determine associations of maternal pre-pregnancy body mass index with pregnancy and infant gastrointestinal microbial communities: Late pregnancy and early infancy
    Article Snippet: .. After purification, the concentration of 16S rRNA gene amplicons was quantified using the Quant-IT dsDNA assay kit (Invitrogen, Carlsbad, CA). .. Purified 16S rRNA amplicons were pooled and quality checked using an Agilent 2100 Bioanalyzer with the High Sensitivity DNA Chip (Agilent, 5067–4626).

    Lysis:

    Article Title: Rapid detection of structural variation in a human genome using nanochannel-based genome mapping technology
    Article Snippet: Plugs were incubated with lysis buffer and proteinase K for four hours at 50°C. .. The purified DNA was subjected to four hours of drop dialysis (Millipore, #VCWP04700) and quantified using Nanodrop 1000 (Thermal Fisher Scientific) and/or the Quant-iT dsDNA Assay Kit (Invitrogen/Molecular Probes).

    Article Title: High Pressure-Induced mtDNA Alterations in Retinal Ganglion Cells and Subsequent Apoptosis
    Article Snippet: Shortly, the total DNA was isolated using the DNeasy blood and tissue kit (QIAGEN, Duess eldorf, Germany). mtDNA were obtained from the isolated mitochondria by use of mitochondrial lysis buffer containing proteinase K (0.2 mg/ml), SDS (0.5%), Tris-HCl (10 mM) and 0.05 M EDTA. .. The amount of DNA was determined using the Quant-iT dsDNA assay kit (Invitrogen, Carlsbad, CA, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher quant it dsdna assay kit
    Quant It Dsdna Assay Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 287 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quant it dsdna assay kit/product/Thermo Fisher
    Average 90 stars, based on 287 article reviews
    Price from $9.99 to $1999.99
    quant it dsdna assay kit - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results