qiaquick 96 well biorobot kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    QIAquick 96 PCR BioRobot Kit
    Description:
    For purification of 96 PCR products up to 10 μg 100 bp to 10 kb Kit contents Qiagen QIAquick 96 PCR BioRobot Kit For Purification of 4 x 96 PCR Products 40L Elution Volume 10g Binding Capacity 100 bp to 10 kb Fragment Size Automated Oligonucleotides dsDNA Recovery Removal 17 40mers Dye Terminator Proteins Ideal for Silica Technology Sequencing Microarray Analysis Ligation Transformation Restriction Digestion Labeling Includes 4 QIAquick 96 Plates Reagents Buffers Collection Microtubes 1 2mL and Caps 96 well Microplates RB and Lids Tape Pads Benefits Up to 95 recovery of ready to use DNA Fast and convenient procedure Cleanup of DNA up to 10 kb in three easy step
    Catalog Number:
    963141
    Price:
    810
    Category:
    QIAquick 96 PCR Purification Kits
    Buy from Supplier


    Structured Review

    Qiagen qiaquick 96 well biorobot kit
    QIAquick 96 PCR BioRobot Kit
    For purification of 96 PCR products up to 10 μg 100 bp to 10 kb Kit contents Qiagen QIAquick 96 PCR BioRobot Kit For Purification of 4 x 96 PCR Products 40L Elution Volume 10g Binding Capacity 100 bp to 10 kb Fragment Size Automated Oligonucleotides dsDNA Recovery Removal 17 40mers Dye Terminator Proteins Ideal for Silica Technology Sequencing Microarray Analysis Ligation Transformation Restriction Digestion Labeling Includes 4 QIAquick 96 Plates Reagents Buffers Collection Microtubes 1 2mL and Caps 96 well Microplates RB and Lids Tape Pads Benefits Up to 95 recovery of ready to use DNA Fast and convenient procedure Cleanup of DNA up to 10 kb in three easy step
    https://www.bioz.com/result/qiaquick 96 well biorobot kit/product/Qiagen
    Average 99 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    qiaquick 96 well biorobot kit - by Bioz Stars, 2020-04
    99/100 stars

    Related Products / Commonly Used Together

    pcr
    ultra-gaps glass slides

    Images

    Related Articles

    Clone Assay:

    Article Title: The Sterolgene v0 cDNA microarray: a systemic approach to studies of cholesterol homeostasis and drug metabolism
    Article Snippet: PCR products were prepared and cloned using the Qiagen PCR Cloning kit (Qiagen GmBH, Hilden, Germany). .. From these plasmids PCR products were amplified (Qbiogene, Morgan Irvine, CA, USA) and purified using the QIAquick 96 PCR BioRobot purification kit (Qiagen GmBH, Hilden, Germany).

    Article Title: Generation and characterization of ABBV642, a dual variable domain immunoglobulin molecule (DVD-Ig) that potently neutralizes VEGF and PDGF-BB and is designed for the treatment of exudative age-related macular degeneration
    Article Snippet: Antibody heavy and light chain variable regions (VH and VL) of the selected hybridomas were cloned and expressed as chimeric antibodies, and then further humanized using computer-aided high throughput humanization design software developed at AbbVie. .. The PCR reaction was purified using Qiagen Qiaquick PCR Purification Kit (28104 or 963141).

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: .. The clones selected for sequencing were subject to PCR with generic vector primers and the resulting fragments purified on BioRobot8000 using the QIAquick 96 PCR Biorobot kit (Qiagen, Inc., Valencia, CA). .. Sequencing was done on ABI3100 DNA Sequencer (Applied Biosystems, Foster City, CA) with Bid Dye v3.1 chemistry.

    Article Title: Pathway Analysis of Differentially Expressed Genes in Patients with Acute Aortic Dissection
    Article Snippet: Briefly, prespecified 200–400-bp fragments of selected cDNAs were generated by RT-PCR (SuperscriptTM II; Invitrogen, Groningen, The Netherlands), cloned into pGEM® -T Vector (Promega, Mannheim, Germany) and sequence-verified. .. Amplified inserts (Taq PCR Master Mix; Qiagen) were purified (Qiaquick 96 PCR BioRobot Kit; Qiagen), checked on an agarose gel, and spotted four times each (0.2 ng) on treated glass slides.

    Article Title: Combined Transcript and Metabolite Analysis Reveals Genes Involved in Spider Mite Induced Volatile Formation in Cucumber Plants 1
    Article Snippet: Inserts from the subtractive libraries, cloned in pGEMT easy, were amplified using vector primers in a colony PCR reaction. .. Qiaquick PCR BioRoBot kit (Qiagen, Venlo, The Netherlands) was used for DNA purification followed by complete liquid evaporation.

    Article Title: Generation and characterization of ABBV642, a dual variable domain immunoglobulin molecule (DVD-Ig) that potently neutralizes VEGF and PDGF-BB and is designed for the treatment of exudative age-related macular degeneration
    Article Snippet: The second-round PCR was purified using Qiagen PCR Purification Kit (28104 or 963141), the DNA concentration was determined by nanodrop reading and multiple PCRs were pooled for digest. .. The HC vector used for cloning was pHybE-hCg1mut (L234A, L235A, H435A) and the LC vector was pHybE-hCKappa.

    Amplification:

    Article Title: The Sterolgene v0 cDNA microarray: a systemic approach to studies of cholesterol homeostasis and drug metabolism
    Article Snippet: .. From these plasmids PCR products were amplified (Qbiogene, Morgan Irvine, CA, USA) and purified using the QIAquick 96 PCR BioRobot purification kit (Qiagen GmBH, Hilden, Germany). .. PCR products were dried and dissolved in 50% formamide and 1% CHAPS (3-[(3-cholamidopropyl)-dimethylammonio]-1-propane sulfonate) spotting buffer in final 200 ng/μl concentration.

    Article Title: Role of Pfmdr1 in In VitroPlasmodium falciparum Susceptibility to Chloroquine, Quinine, Monodesethylamodiaquine, Mefloquine, Lumefantrine, and Dihydroartemisinin
    Article Snippet: A 590-bp fragment was amplified with a primer pair (sense, 5′-AGA GAA AAA AGA TGG TAA CCT CAG-3′; antisense, 5′-ACC ACA AAC ATA AAT TAA CGG-3′) to determine the sequences of codons 86 and 184 (MDR1-1), and a second fragment (968 bp) was amplified with a primer pair (sense, 5′-CAG GAA GCA TTTTAT AAT ATG CAT-3′; antisense, 5′-CGT TTAACA TCT TCC AAT GTT GCA-3′) to determine the sequences of codons 1034, 1042, and 1246 (MDR1-2) ( ). .. Amplicons were purified using the QIAquick96 PCR BioRobot kit and an automated protocol on the BioRobot 8000 workstation (Qiagen, Courtaboeuf, France).

    Article Title: Comparative Genomic Analysis of Clinical Strains of Campylobacter jejuni from South Africa
    Article Snippet: A total of 1530, 227, 40 and 28 PCR products were amplified from strain NCTC 11168, strain RM1221, LOS genes and serotype HS∶41 capsule genes, respectively. .. The PCR products were purified on a Qiagen 8000 robot by using a Qiaquick 96-well Biorobot kit (Qiagen, Valencia, CA) and spotted in duplicate onto Ultra-GAPS glass slides (Corning Inc., Corning, N.

    Article Title: Pathway Analysis of Differentially Expressed Genes in Patients with Acute Aortic Dissection
    Article Snippet: .. Amplified inserts (Taq PCR Master Mix; Qiagen) were purified (Qiaquick 96 PCR BioRobot Kit; Qiagen), checked on an agarose gel, and spotted four times each (0.2 ng) on treated glass slides. ..

    Article Title: Combined Transcript and Metabolite Analysis Reveals Genes Involved in Spider Mite Induced Volatile Formation in Cucumber Plants 1
    Article Snippet: Inserts from the subtractive libraries, cloned in pGEMT easy, were amplified using vector primers in a colony PCR reaction. .. Qiaquick PCR BioRoBot kit (Qiagen, Venlo, The Netherlands) was used for DNA purification followed by complete liquid evaporation.

    Article Title: Culture of Campylobacter jejuni with Sodium Deoxycholate Induces Virulence Gene Expression
    Article Snippet: DNA fragments of individual open reading frames (ORFs) were amplified with the Sigma-Genosys (The Woodlands, TX) C. jejuni ORFmer primer set specific for strain NCTC 11168 coding sequences and with primers from Operon Technologies (Alameda, CA) specific for strain RM1221 unique sequences, as described previously ( ). .. The PCR products were purified with a Qiagen 8000 robot by using a QIAquick 96-well Biorobot kit (Qiagen, Valencia, CA).

    Article Title: Characterization of Genetically Matched Isolates of Campylobacter jejuni Reveals that Mutations in Genes Involved in Flagellar Biosynthesis Alter the Organism's Virulence Potential ▿
    Article Snippet: .. A total of 1,530 PCR products were successfully amplified and then purified on a QIAGEN 8000 robot using a Qiaquick 96-well Biorobot kit (QIAGEN), dried, and resuspended to an average concentration of 0.1 to 0.2 μg/μl in 20 μl of 50% dimethyl sulfoxide containing 0.3× saline sodium citrate (SSC; 1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). .. All of the PCR probes were then spotted in duplicate on GAPSII slides (Corning, Acton, MA) using an OmniGrid Accent (GeneMachines, Ann Arbor, MI) producing a final array that contained a total of 3,060 features.

    Article Title: Comparison of Genotypes of Salmonella enterica Serovar Enteritidis Phage Type 30 and 9c Strains Isolated during Three Outbreaks Associated with Raw Almonds ▿
    Article Snippet: We amplified a total of 4,422 and 192 PCR products from S . .. These PCR products were purified on a Qiagen 8000 robot using a QIAquick 96-well Biorobot kit (Qiagen, Valencia, CA), dried, and resuspended to an average concentration of 0.1 to 0.2 μg/μl in 10 μl of 50% dimethyl sulfoxide (DMSO) containing 0.3× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate).

    Article Title: Absence of association between Plasmodium falciparum small sub-unit ribosomal RNA gene mutations and in vitro decreased susceptibility to doxycycline
    Article Snippet: Paragraph title: Amplification and sequencing of pfssrRNA gene ... Amplicons were purified using the QIAquick 96 PCR BioRobot Kit and an automated protocol on the BioRobot 8000 workstation (Qiagen, Courtaboeuf, France).

    Article Title: A DNase Encoded by Integrated Element CJIE1 Inhibits Natural Transformation of Campylobacter jejuni ▿ ▿ †
    Article Snippet: A total of 1,530 and 227 PCR products were amplified from strain NCTC 11168 and strain RM1221, respectively. .. The PCR products were purified with a Qiagen 8000 robot by using a QIAquick 96-well Biorobot kit (Qiagen, Valencia, CA) and spotted in duplicate onto Ultra-GAPS glass slides (Corning Inc., Corning, NY) by using an OmniGrid Accent 17 (GeneMachines, Ann Arbor, MI), as described previously ( ).

    Polymerase Chain Reaction:

    Article Title: The Sterolgene v0 cDNA microarray: a systemic approach to studies of cholesterol homeostasis and drug metabolism
    Article Snippet: .. From these plasmids PCR products were amplified (Qbiogene, Morgan Irvine, CA, USA) and purified using the QIAquick 96 PCR BioRobot purification kit (Qiagen GmBH, Hilden, Germany). .. PCR products were dried and dissolved in 50% formamide and 1% CHAPS (3-[(3-cholamidopropyl)-dimethylammonio]-1-propane sulfonate) spotting buffer in final 200 ng/μl concentration.

    Article Title: Developmental staging of male murine embryonic gonad by SAGE analysis
    Article Snippet: .. The PCR products were cleaned using QIAquick96 PCR BioRobot Kit run on BioRobot 3000 (Qiagen Corp., Gaithersburg, MD, USA). .. Cleaned PCR products were sequenced using the 5′-CATG primer and BigDye V3.0 Terminator Ready Reaction on an AB PRISM 3100 Genetic Analyzer (PE Biosystems, Foster City, CA, USA).

    Article Title: Generation and characterization of ABBV642, a dual variable domain immunoglobulin molecule (DVD-Ig) that potently neutralizes VEGF and PDGF-BB and is designed for the treatment of exudative age-related macular degeneration
    Article Snippet: .. The PCR reaction was purified using Qiagen Qiaquick PCR Purification Kit (28104 or 963141). .. The first-round PCRs were used as the DNA template with the appropriate vector primers.

    Article Title: Role of Pfmdr1 in In VitroPlasmodium falciparum Susceptibility to Chloroquine, Quinine, Monodesethylamodiaquine, Mefloquine, Lumefantrine, and Dihydroartemisinin
    Article Snippet: .. Amplicons were purified using the QIAquick96 PCR BioRobot kit and an automated protocol on the BioRobot 8000 workstation (Qiagen, Courtaboeuf, France). .. The purified fragments were sequenced using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems) using the primers described above.

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: .. The clones selected for sequencing were subject to PCR with generic vector primers and the resulting fragments purified on BioRobot8000 using the QIAquick 96 PCR Biorobot kit (Qiagen, Inc., Valencia, CA). .. Sequencing was done on ABI3100 DNA Sequencer (Applied Biosystems, Foster City, CA) with Bid Dye v3.1 chemistry.

    Article Title: HEx: A heterologous expression platform for the discovery of fungal natural products
    Article Snippet: .. Amplicons were purified using the QIAquick 96 PCR BioRobot kit (963141, Qiagen) prior to their use in plasmid assembly. .. Similarly, regulatory cassettes containing fused terminators and promoters were amplified from the regulatory cassette plasmids described in table S6 and purified using the QIAquick PCR purification kit (28106, Qiagen).

    Article Title: Pathway Analysis of Differentially Expressed Genes in Patients with Acute Aortic Dissection
    Article Snippet: .. Amplified inserts (Taq PCR Master Mix; Qiagen) were purified (Qiaquick 96 PCR BioRobot Kit; Qiagen), checked on an agarose gel, and spotted four times each (0.2 ng) on treated glass slides. ..

    Article Title: Combined Transcript and Metabolite Analysis Reveals Genes Involved in Spider Mite Induced Volatile Formation in Cucumber Plants 1
    Article Snippet: .. Qiaquick PCR BioRoBot kit (Qiagen, Venlo, The Netherlands) was used for DNA purification followed by complete liquid evaporation. .. DNA was dissolved in 10 μ L 5× SSC before being arrayed in duplicates onto amino silane coated glass slides (PixSys 7500 BioDot; Genomic Solutions, Ann Arbor, MI).

    Article Title: Culture of Campylobacter jejuni with Sodium Deoxycholate Induces Virulence Gene Expression
    Article Snippet: .. The PCR products were purified with a Qiagen 8000 robot by using a QIAquick 96-well Biorobot kit (Qiagen, Valencia, CA). .. A total of 1,530 ORFs from strain NCTC 11168 and 227 ORFs from strain RM1221 were PCR amplified, purified, and spotted in duplicate onto Ultra-GAPS glass slides (Corning Inc., Corning, NY) using an OmniGrid Accent (GeneMachines, Ann Arbor, MI), as described previously ( ).

    Article Title: Generation and characterization of ABBV642, a dual variable domain immunoglobulin molecule (DVD-Ig) that potently neutralizes VEGF and PDGF-BB and is designed for the treatment of exudative age-related macular degeneration
    Article Snippet: .. The second-round PCR was purified using Qiagen PCR Purification Kit (28104 or 963141), the DNA concentration was determined by nanodrop reading and multiple PCRs were pooled for digest. .. PCR products and vectors were digested with XbaI and SalI for HCs or XbaI and BsiWI for LCs.

    Article Title: Characterization of Genetically Matched Isolates of Campylobacter jejuni Reveals that Mutations in Genes Involved in Flagellar Biosynthesis Alter the Organism's Virulence Potential ▿
    Article Snippet: .. A total of 1,530 PCR products were successfully amplified and then purified on a QIAGEN 8000 robot using a Qiaquick 96-well Biorobot kit (QIAGEN), dried, and resuspended to an average concentration of 0.1 to 0.2 μg/μl in 20 μl of 50% dimethyl sulfoxide containing 0.3× saline sodium citrate (SSC; 1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). .. All of the PCR probes were then spotted in duplicate on GAPSII slides (Corning, Acton, MA) using an OmniGrid Accent (GeneMachines, Ann Arbor, MI) producing a final array that contained a total of 3,060 features.

    Article Title: Comparison of Genotypes of Salmonella enterica Serovar Enteritidis Phage Type 30 and 9c Strains Isolated during Three Outbreaks Associated with Raw Almonds ▿
    Article Snippet: .. These PCR products were purified on a Qiagen 8000 robot using a QIAquick 96-well Biorobot kit (Qiagen, Valencia, CA), dried, and resuspended to an average concentration of 0.1 to 0.2 μg/μl in 10 μl of 50% dimethyl sulfoxide (DMSO) containing 0.3× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). .. All of the PCR probes then were spotted onto Ultra-GAPS glass slides (Corning Inc., Corning, NY) using an OmniGrid Accent (Digilab, Holliston, MA), producing a final array that contained a total of 4,664 features including duplicates.

    Article Title: Absence of association between Plasmodium falciparum small sub-unit ribosomal RNA gene mutations and in vitro decreased susceptibility to doxycycline
    Article Snippet: .. Amplicons were purified using the QIAquick 96 PCR BioRobot Kit and an automated protocol on the BioRobot 8000 workstation (Qiagen, Courtaboeuf, France). .. The purified fragments were sequenced using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) using the following primers: 5′-ACTAGTGTATTTCGGTTAACAGCCG-3′ (forward), 5′-ACCCTTATCAAGAGTATGTTTTAACCAT-3′ (reverse) and Pf_SSU_rRNA_R1481 CTTAAGAACTTATTCACCGCTA (reverse).

    Article Title: A DNase Encoded by Integrated Element CJIE1 Inhibits Natural Transformation of Campylobacter jejuni ▿ ▿ †
    Article Snippet: .. The PCR products were purified with a Qiagen 8000 robot by using a QIAquick 96-well Biorobot kit (Qiagen, Valencia, CA) and spotted in duplicate onto Ultra-GAPS glass slides (Corning Inc., Corning, NY) by using an OmniGrid Accent 17 (GeneMachines, Ann Arbor, MI), as described previously ( ). .. Immediately after printing, the microarrays were UV cross-linked at 300 mJ by using a Stratalinker 1800 UV cross-linker (Stratagene, La Jolla, CA) and stored in a desiccator.

    Construct:

    Article Title: Developmental staging of male murine embryonic gonad by SAGE analysis
    Article Snippet: Ten micrograms RNA was used to construct a SAGE library using the I-SAGE kit (Invitrogen). .. The PCR products were cleaned using QIAquick96 PCR BioRobot Kit run on BioRobot 3000 (Qiagen Corp., Gaithersburg, MD, USA).

    Microarray:

    Article Title: The Sterolgene v0 cDNA microarray: a systemic approach to studies of cholesterol homeostasis and drug metabolism
    Article Snippet: Paragraph title: cDNA microarray production ... From these plasmids PCR products were amplified (Qbiogene, Morgan Irvine, CA, USA) and purified using the QIAquick 96 PCR BioRobot purification kit (Qiagen GmBH, Hilden, Germany).

    Article Title: Comparative Genomic Analysis of Clinical Strains of Campylobacter jejuni from South Africa
    Article Snippet: Paragraph title: Construction of the C. jejuni DNA microarray ... The PCR products were purified on a Qiagen 8000 robot by using a Qiaquick 96-well Biorobot kit (Qiagen, Valencia, CA) and spotted in duplicate onto Ultra-GAPS glass slides (Corning Inc., Corning, N.

    Article Title: Pathway Analysis of Differentially Expressed Genes in Patients with Acute Aortic Dissection
    Article Snippet: Paragraph title: Microarray production ... Amplified inserts (Taq PCR Master Mix; Qiagen) were purified (Qiaquick 96 PCR BioRobot Kit; Qiagen), checked on an agarose gel, and spotted four times each (0.2 ng) on treated glass slides.

    Article Title: Culture of Campylobacter jejuni with Sodium Deoxycholate Induces Virulence Gene Expression
    Article Snippet: Paragraph title: Construction of the C. jejuni DNA microarray. ... The PCR products were purified with a Qiagen 8000 robot by using a QIAquick 96-well Biorobot kit (Qiagen, Valencia, CA).

    Article Title: Characterization of Genetically Matched Isolates of Campylobacter jejuni Reveals that Mutations in Genes Involved in Flagellar Biosynthesis Alter the Organism's Virulence Potential ▿
    Article Snippet: Paragraph title: Construction of the C. jejuni DNA microarray. ... A total of 1,530 PCR products were successfully amplified and then purified on a QIAGEN 8000 robot using a Qiaquick 96-well Biorobot kit (QIAGEN), dried, and resuspended to an average concentration of 0.1 to 0.2 μg/μl in 20 μl of 50% dimethyl sulfoxide containing 0.3× saline sodium citrate (SSC; 1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate).

    Article Title: Comparison of Genotypes of Salmonella enterica Serovar Enteritidis Phage Type 30 and 9c Strains Isolated during Three Outbreaks Associated with Raw Almonds ▿
    Article Snippet: Paragraph title: Construction of an S . Typhimurium/ S . Enteriditis DNA microarray. ... These PCR products were purified on a Qiagen 8000 robot using a QIAquick 96-well Biorobot kit (Qiagen, Valencia, CA), dried, and resuspended to an average concentration of 0.1 to 0.2 μg/μl in 10 μl of 50% dimethyl sulfoxide (DMSO) containing 0.3× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate).

    Article Title: A DNase Encoded by Integrated Element CJIE1 Inhibits Natural Transformation of Campylobacter jejuni ▿ ▿ †
    Article Snippet: Paragraph title: Construction of the C. jejuni microarray. ... The PCR products were purified with a Qiagen 8000 robot by using a QIAquick 96-well Biorobot kit (Qiagen, Valencia, CA) and spotted in duplicate onto Ultra-GAPS glass slides (Corning Inc., Corning, NY) by using an OmniGrid Accent 17 (GeneMachines, Ann Arbor, MI), as described previously ( ).

    Molecular Cloning:

    Article Title: Generation and characterization of ABBV642, a dual variable domain immunoglobulin molecule (DVD-Ig) that potently neutralizes VEGF and PDGF-BB and is designed for the treatment of exudative age-related macular degeneration
    Article Snippet: Paragraph title: Molecular cloning, protein expression and purification ... The PCR reaction was purified using Qiagen Qiaquick PCR Purification Kit (28104 or 963141).

    Luciferase:

    Article Title: The Sterolgene v0 cDNA microarray: a systemic approach to studies of cholesterol homeostasis and drug metabolism
    Article Snippet: Chloramphenicol acetyltransferase (CAT) and Renilla luciferase gene probes were designed as negative controls. .. From these plasmids PCR products were amplified (Qbiogene, Morgan Irvine, CA, USA) and purified using the QIAquick 96 PCR BioRobot purification kit (Qiagen GmBH, Hilden, Germany).

    Article Title: Combined Transcript and Metabolite Analysis Reveals Genes Involved in Spider Mite Induced Volatile Formation in Cucumber Plants 1
    Article Snippet: Qiaquick PCR BioRoBot kit (Qiagen, Venlo, The Netherlands) was used for DNA purification followed by complete liquid evaporation. .. On the array, 140 clones from the SSH− library, 573 clones from the SSH+ library, and 44 background (yeast and human origin) and reference (luciferase) clones were spotted.

    Activity Assay:

    Article Title: Generation and characterization of ABBV642, a dual variable domain immunoglobulin molecule (DVD-Ig) that potently neutralizes VEGF and PDGF-BB and is designed for the treatment of exudative age-related macular degeneration
    Article Snippet: Parental mAbs for the DVD-Ig molecule were generated using rat hybridoma technology at Aldevron (Madison, WI), and hybridoma supernatants were subsequently screened for activity at AbbVie Bioresearch Center (Worcester, MA). .. The PCR reaction was purified using Qiagen Qiaquick PCR Purification Kit (28104 or 963141).

    Expressing:

    Article Title: Generation and characterization of ABBV642, a dual variable domain immunoglobulin molecule (DVD-Ig) that potently neutralizes VEGF and PDGF-BB and is designed for the treatment of exudative age-related macular degeneration
    Article Snippet: Paragraph title: Molecular cloning, protein expression and purification ... The PCR reaction was purified using Qiagen Qiaquick PCR Purification Kit (28104 or 963141).

    Article Title: Combined Transcript and Metabolite Analysis Reveals Genes Involved in Spider Mite Induced Volatile Formation in Cucumber Plants 1
    Article Snippet: Qiaquick PCR BioRoBot kit (Qiagen, Venlo, The Netherlands) was used for DNA purification followed by complete liquid evaporation. .. Full-length luciferase cDNA clones spotted on the array were used to normalize expression values derived from the Cy3- or the Cy5 dyes respectively.

    Derivative Assay:

    Article Title: Combined Transcript and Metabolite Analysis Reveals Genes Involved in Spider Mite Induced Volatile Formation in Cucumber Plants 1
    Article Snippet: Qiaquick PCR BioRoBot kit (Qiagen, Venlo, The Netherlands) was used for DNA purification followed by complete liquid evaporation. .. Full-length luciferase cDNA clones spotted on the array were used to normalize expression values derived from the Cy3- or the Cy5 dyes respectively.

    Hybridization:

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: In addition to the spot hybridization, the dsDNAs and PEER products were cloned in separate libraries using pTAdvantage vector (Clontech, Palo Alto, CA) and Escherichia coli Top 10F′ electrocompetent cells (Clontech). .. The clones selected for sequencing were subject to PCR with generic vector primers and the resulting fragments purified on BioRobot8000 using the QIAquick 96 PCR Biorobot kit (Qiagen, Inc., Valencia, CA).

    Generated:

    Article Title: Generation and characterization of ABBV642, a dual variable domain immunoglobulin molecule (DVD-Ig) that potently neutralizes VEGF and PDGF-BB and is designed for the treatment of exudative age-related macular degeneration
    Article Snippet: DNA for the DVD-Ig molecule was generated using overlapping PCR with the parent mAb DNA as template DNA and the primers. .. The PCR reaction was purified using Qiagen Qiaquick PCR Purification Kit (28104 or 963141).

    Article Title: Pathway Analysis of Differentially Expressed Genes in Patients with Acute Aortic Dissection
    Article Snippet: Briefly, prespecified 200–400-bp fragments of selected cDNAs were generated by RT-PCR (SuperscriptTM II; Invitrogen, Groningen, The Netherlands), cloned into pGEM® -T Vector (Promega, Mannheim, Germany) and sequence-verified. .. Amplified inserts (Taq PCR Master Mix; Qiagen) were purified (Qiaquick 96 PCR BioRobot Kit; Qiagen), checked on an agarose gel, and spotted four times each (0.2 ng) on treated glass slides.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Pathway Analysis of Differentially Expressed Genes in Patients with Acute Aortic Dissection
    Article Snippet: Briefly, prespecified 200–400-bp fragments of selected cDNAs were generated by RT-PCR (SuperscriptTM II; Invitrogen, Groningen, The Netherlands), cloned into pGEM® -T Vector (Promega, Mannheim, Germany) and sequence-verified. .. Amplified inserts (Taq PCR Master Mix; Qiagen) were purified (Qiaquick 96 PCR BioRobot Kit; Qiagen), checked on an agarose gel, and spotted four times each (0.2 ng) on treated glass slides.

    Nucleic Acid Electrophoresis:

    Article Title: Characterization of Genetically Matched Isolates of Campylobacter jejuni Reveals that Mutations in Genes Involved in Flagellar Biosynthesis Alter the Organism's Virulence Potential ▿
    Article Snippet: Thermal cycling was performed using a Tetrad thermal cycler (MJ Research, Waltham, MA) with the following amplification parameters: 30 cycles of 25 s at 94°C, 25 s at 52°C, and 2 min at 72°C and a final extension at 72°C for 5 min. PCR products were analyzed by gel electrophoresis in a 1% (wt/vol) agarose gel (containing 0.5 μg of ethidium bromide/ml) in 1× Tris-acetate-EDTA buffer. .. A total of 1,530 PCR products were successfully amplified and then purified on a QIAGEN 8000 robot using a Qiaquick 96-well Biorobot kit (QIAGEN), dried, and resuspended to an average concentration of 0.1 to 0.2 μg/μl in 20 μl of 50% dimethyl sulfoxide containing 0.3× saline sodium citrate (SSC; 1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate).

    Article Title: Comparison of Genotypes of Salmonella enterica Serovar Enteritidis Phage Type 30 and 9c Strains Isolated during Three Outbreaks Associated with Raw Almonds ▿
    Article Snippet: Thermal cycling was performed using a Tetrad thermal cycler (Bio-Rad) with the following amplification parameters: 30 cycles of 25 s at 94°C, 25 s at 52°C, and 2 min at 72°C, with a final extension at 72°C for 5 min. PCR products were analyzed by gel electrophoresis in a 1% (wt/vol) agarose gel (containing 0.5 μg/ml of ethidium bromide) in 1× Tris-acetate-EDTA buffer. .. These PCR products were purified on a Qiagen 8000 robot using a QIAquick 96-well Biorobot kit (Qiagen, Valencia, CA), dried, and resuspended to an average concentration of 0.1 to 0.2 μg/μl in 10 μl of 50% dimethyl sulfoxide (DMSO) containing 0.3× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate).

    Purification:

    Article Title: The Sterolgene v0 cDNA microarray: a systemic approach to studies of cholesterol homeostasis and drug metabolism
    Article Snippet: .. From these plasmids PCR products were amplified (Qbiogene, Morgan Irvine, CA, USA) and purified using the QIAquick 96 PCR BioRobot purification kit (Qiagen GmBH, Hilden, Germany). .. PCR products were dried and dissolved in 50% formamide and 1% CHAPS (3-[(3-cholamidopropyl)-dimethylammonio]-1-propane sulfonate) spotting buffer in final 200 ng/μl concentration.

    Article Title: Generation and characterization of ABBV642, a dual variable domain immunoglobulin molecule (DVD-Ig) that potently neutralizes VEGF and PDGF-BB and is designed for the treatment of exudative age-related macular degeneration
    Article Snippet: .. The PCR reaction was purified using Qiagen Qiaquick PCR Purification Kit (28104 or 963141). .. The first-round PCRs were used as the DNA template with the appropriate vector primers.

    Article Title: Role of Pfmdr1 in In VitroPlasmodium falciparum Susceptibility to Chloroquine, Quinine, Monodesethylamodiaquine, Mefloquine, Lumefantrine, and Dihydroartemisinin
    Article Snippet: .. Amplicons were purified using the QIAquick96 PCR BioRobot kit and an automated protocol on the BioRobot 8000 workstation (Qiagen, Courtaboeuf, France). .. The purified fragments were sequenced using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems) using the primers described above.

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: .. The clones selected for sequencing were subject to PCR with generic vector primers and the resulting fragments purified on BioRobot8000 using the QIAquick 96 PCR Biorobot kit (Qiagen, Inc., Valencia, CA). .. Sequencing was done on ABI3100 DNA Sequencer (Applied Biosystems, Foster City, CA) with Bid Dye v3.1 chemistry.

    Article Title: HEx: A heterologous expression platform for the discovery of fungal natural products
    Article Snippet: .. Amplicons were purified using the QIAquick 96 PCR BioRobot kit (963141, Qiagen) prior to their use in plasmid assembly. .. Similarly, regulatory cassettes containing fused terminators and promoters were amplified from the regulatory cassette plasmids described in table S6 and purified using the QIAquick PCR purification kit (28106, Qiagen).

    Article Title: Pathway Analysis of Differentially Expressed Genes in Patients with Acute Aortic Dissection
    Article Snippet: .. Amplified inserts (Taq PCR Master Mix; Qiagen) were purified (Qiaquick 96 PCR BioRobot Kit; Qiagen), checked on an agarose gel, and spotted four times each (0.2 ng) on treated glass slides. ..

    Article Title: Culture of Campylobacter jejuni with Sodium Deoxycholate Induces Virulence Gene Expression
    Article Snippet: .. The PCR products were purified with a Qiagen 8000 robot by using a QIAquick 96-well Biorobot kit (Qiagen, Valencia, CA). .. A total of 1,530 ORFs from strain NCTC 11168 and 227 ORFs from strain RM1221 were PCR amplified, purified, and spotted in duplicate onto Ultra-GAPS glass slides (Corning Inc., Corning, NY) using an OmniGrid Accent (GeneMachines, Ann Arbor, MI), as described previously ( ).

    Article Title: Generation and characterization of ABBV642, a dual variable domain immunoglobulin molecule (DVD-Ig) that potently neutralizes VEGF and PDGF-BB and is designed for the treatment of exudative age-related macular degeneration
    Article Snippet: .. The second-round PCR was purified using Qiagen PCR Purification Kit (28104 or 963141), the DNA concentration was determined by nanodrop reading and multiple PCRs were pooled for digest. .. PCR products and vectors were digested with XbaI and SalI for HCs or XbaI and BsiWI for LCs.

    Article Title: Characterization of Genetically Matched Isolates of Campylobacter jejuni Reveals that Mutations in Genes Involved in Flagellar Biosynthesis Alter the Organism's Virulence Potential ▿
    Article Snippet: .. A total of 1,530 PCR products were successfully amplified and then purified on a QIAGEN 8000 robot using a Qiaquick 96-well Biorobot kit (QIAGEN), dried, and resuspended to an average concentration of 0.1 to 0.2 μg/μl in 20 μl of 50% dimethyl sulfoxide containing 0.3× saline sodium citrate (SSC; 1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). .. All of the PCR probes were then spotted in duplicate on GAPSII slides (Corning, Acton, MA) using an OmniGrid Accent (GeneMachines, Ann Arbor, MI) producing a final array that contained a total of 3,060 features.

    Article Title: Comparison of Genotypes of Salmonella enterica Serovar Enteritidis Phage Type 30 and 9c Strains Isolated during Three Outbreaks Associated with Raw Almonds ▿
    Article Snippet: .. These PCR products were purified on a Qiagen 8000 robot using a QIAquick 96-well Biorobot kit (Qiagen, Valencia, CA), dried, and resuspended to an average concentration of 0.1 to 0.2 μg/μl in 10 μl of 50% dimethyl sulfoxide (DMSO) containing 0.3× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). .. All of the PCR probes then were spotted onto Ultra-GAPS glass slides (Corning Inc., Corning, NY) using an OmniGrid Accent (Digilab, Holliston, MA), producing a final array that contained a total of 4,664 features including duplicates.

    Article Title: Absence of association between Plasmodium falciparum small sub-unit ribosomal RNA gene mutations and in vitro decreased susceptibility to doxycycline
    Article Snippet: .. Amplicons were purified using the QIAquick 96 PCR BioRobot Kit and an automated protocol on the BioRobot 8000 workstation (Qiagen, Courtaboeuf, France). .. The purified fragments were sequenced using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) using the following primers: 5′-ACTAGTGTATTTCGGTTAACAGCCG-3′ (forward), 5′-ACCCTTATCAAGAGTATGTTTTAACCAT-3′ (reverse) and Pf_SSU_rRNA_R1481 CTTAAGAACTTATTCACCGCTA (reverse).

    Article Title: A DNase Encoded by Integrated Element CJIE1 Inhibits Natural Transformation of Campylobacter jejuni ▿ ▿ †
    Article Snippet: .. The PCR products were purified with a Qiagen 8000 robot by using a QIAquick 96-well Biorobot kit (Qiagen, Valencia, CA) and spotted in duplicate onto Ultra-GAPS glass slides (Corning Inc., Corning, NY) by using an OmniGrid Accent 17 (GeneMachines, Ann Arbor, MI), as described previously ( ). .. Immediately after printing, the microarrays were UV cross-linked at 300 mJ by using a Stratalinker 1800 UV cross-linker (Stratagene, La Jolla, CA) and stored in a desiccator.

    Sequencing:

    Article Title: The Sterolgene v0 cDNA microarray: a systemic approach to studies of cholesterol homeostasis and drug metabolism
    Article Snippet: Plasmids were sequenced to verify the correct insert sequence. .. From these plasmids PCR products were amplified (Qbiogene, Morgan Irvine, CA, USA) and purified using the QIAquick 96 PCR BioRobot purification kit (Qiagen GmBH, Hilden, Germany).

    Article Title: Developmental staging of male murine embryonic gonad by SAGE analysis
    Article Snippet: The PCR products were cleaned using QIAquick96 PCR BioRobot Kit run on BioRobot 3000 (Qiagen Corp., Gaithersburg, MD, USA). .. SAGE2000 analysis software was used to extract SAGE tags from raw sequence data while genes encoded by the tag sequences were identified using the latest stable build of the SAGEmap database (build 151) from NCBI.

    Article Title: Role of Pfmdr1 in In VitroPlasmodium falciparum Susceptibility to Chloroquine, Quinine, Monodesethylamodiaquine, Mefloquine, Lumefantrine, and Dihydroartemisinin
    Article Snippet: Amplicons were purified using the QIAquick96 PCR BioRobot kit and an automated protocol on the BioRobot 8000 workstation (Qiagen, Courtaboeuf, France). .. The purified fragments were sequenced using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems) using the primers described above.

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: .. The clones selected for sequencing were subject to PCR with generic vector primers and the resulting fragments purified on BioRobot8000 using the QIAquick 96 PCR Biorobot kit (Qiagen, Inc., Valencia, CA). .. Sequencing was done on ABI3100 DNA Sequencer (Applied Biosystems, Foster City, CA) with Bid Dye v3.1 chemistry.

    Article Title: Comparative Genomic Analysis of Clinical Strains of Campylobacter jejuni from South Africa
    Article Snippet: Additional DNA fragments were amplified from strain RM3193 ( ) based on the published sequence for the serotype HS∶41 capsular locus ORFs and for LOS genes from locus classes A, B, C, E and F, as in previous studies . .. The PCR products were purified on a Qiagen 8000 robot by using a Qiaquick 96-well Biorobot kit (Qiagen, Valencia, CA) and spotted in duplicate onto Ultra-GAPS glass slides (Corning Inc., Corning, N.

    Article Title: Pathway Analysis of Differentially Expressed Genes in Patients with Acute Aortic Dissection
    Article Snippet: Briefly, prespecified 200–400-bp fragments of selected cDNAs were generated by RT-PCR (SuperscriptTM II; Invitrogen, Groningen, The Netherlands), cloned into pGEM® -T Vector (Promega, Mannheim, Germany) and sequence-verified. .. Amplified inserts (Taq PCR Master Mix; Qiagen) were purified (Qiaquick 96 PCR BioRobot Kit; Qiagen), checked on an agarose gel, and spotted four times each (0.2 ng) on treated glass slides.

    Article Title: Absence of association between Plasmodium falciparum small sub-unit ribosomal RNA gene mutations and in vitro decreased susceptibility to doxycycline
    Article Snippet: Paragraph title: Amplification and sequencing of pfssrRNA gene ... Amplicons were purified using the QIAquick 96 PCR BioRobot Kit and an automated protocol on the BioRobot 8000 workstation (Qiagen, Courtaboeuf, France).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: The Sterolgene v0 cDNA microarray: a systemic approach to studies of cholesterol homeostasis and drug metabolism
    Article Snippet: Chloramphenicol acetyltransferase (CAT) and Renilla luciferase gene probes were designed as negative controls. .. From these plasmids PCR products were amplified (Qbiogene, Morgan Irvine, CA, USA) and purified using the QIAquick 96 PCR BioRobot purification kit (Qiagen GmBH, Hilden, Germany).

    Article Title: Role of Pfmdr1 in In VitroPlasmodium falciparum Susceptibility to Chloroquine, Quinine, Monodesethylamodiaquine, Mefloquine, Lumefantrine, and Dihydroartemisinin
    Article Snippet: A 590-bp fragment was amplified with a primer pair (sense, 5′-AGA GAA AAA AGA TGG TAA CCT CAG-3′; antisense, 5′-ACC ACA AAC ATA AAT TAA CGG-3′) to determine the sequences of codons 86 and 184 (MDR1-1), and a second fragment (968 bp) was amplified with a primer pair (sense, 5′-CAG GAA GCA TTTTAT AAT ATG CAT-3′; antisense, 5′-CGT TTAACA TCT TCC AAT GTT GCA-3′) to determine the sequences of codons 1034, 1042, and 1246 (MDR1-2) ( ). .. Amplicons were purified using the QIAquick96 PCR BioRobot kit and an automated protocol on the BioRobot 8000 workstation (Qiagen, Courtaboeuf, France).

    Plasmid Preparation:

    Article Title: Generation and characterization of ABBV642, a dual variable domain immunoglobulin molecule (DVD-Ig) that potently neutralizes VEGF and PDGF-BB and is designed for the treatment of exudative age-related macular degeneration
    Article Snippet: The first-round PCR used the parent mAb DNA as template and the appropriate vector and mAb-linker primers using KOD Hot Start DNA Polymerase (EMD Millipore 71086). .. The PCR reaction was purified using Qiagen Qiaquick PCR Purification Kit (28104 or 963141).

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: .. The clones selected for sequencing were subject to PCR with generic vector primers and the resulting fragments purified on BioRobot8000 using the QIAquick 96 PCR Biorobot kit (Qiagen, Inc., Valencia, CA). .. Sequencing was done on ABI3100 DNA Sequencer (Applied Biosystems, Foster City, CA) with Bid Dye v3.1 chemistry.

    Article Title: HEx: A heterologous expression platform for the discovery of fungal natural products
    Article Snippet: .. Amplicons were purified using the QIAquick 96 PCR BioRobot kit (963141, Qiagen) prior to their use in plasmid assembly. .. Similarly, regulatory cassettes containing fused terminators and promoters were amplified from the regulatory cassette plasmids described in table S6 and purified using the QIAquick PCR purification kit (28106, Qiagen).

    Article Title: Pathway Analysis of Differentially Expressed Genes in Patients with Acute Aortic Dissection
    Article Snippet: Briefly, prespecified 200–400-bp fragments of selected cDNAs were generated by RT-PCR (SuperscriptTM II; Invitrogen, Groningen, The Netherlands), cloned into pGEM® -T Vector (Promega, Mannheim, Germany) and sequence-verified. .. Amplified inserts (Taq PCR Master Mix; Qiagen) were purified (Qiaquick 96 PCR BioRobot Kit; Qiagen), checked on an agarose gel, and spotted four times each (0.2 ng) on treated glass slides.

    Article Title: Combined Transcript and Metabolite Analysis Reveals Genes Involved in Spider Mite Induced Volatile Formation in Cucumber Plants 1
    Article Snippet: PCR reaction conditions: Colony PCR reaction corresponding to approximately 10 ng plasmid, 20 nmol dNTP, 100 pmol forward/reverse primer, 2.5 units Taq (Gibco BRL, Cleveland), reaction buffer with MgCl2 according to manufacturer's recommendations, and H2 O in a final volume of 100 μ L. PCR program 94°C 30 s, (94°C 30 s; 55°C 30 s, and 72°C 2.5 min) × 30. .. Qiaquick PCR BioRoBot kit (Qiagen, Venlo, The Netherlands) was used for DNA purification followed by complete liquid evaporation.

    Article Title: Generation and characterization of ABBV642, a dual variable domain immunoglobulin molecule (DVD-Ig) that potently neutralizes VEGF and PDGF-BB and is designed for the treatment of exudative age-related macular degeneration
    Article Snippet: The first-round PCRs were used as the DNA template with the appropriate vector primers. .. The second-round PCR was purified using Qiagen PCR Purification Kit (28104 or 963141), the DNA concentration was determined by nanodrop reading and multiple PCRs were pooled for digest.

    Article Title: Absence of association between Plasmodium falciparum small sub-unit ribosomal RNA gene mutations and in vitro decreased susceptibility to doxycycline
    Article Snippet: Amplicons were purified using the QIAquick 96 PCR BioRobot Kit and an automated protocol on the BioRobot 8000 workstation (Qiagen, Courtaboeuf, France). .. The purified products were sequenced using an ABI Prism 3100 analyser (Applied Biosystems), and the sequences were analysed using Vector NTI advance (TM) software (version 11, Invitrogen, Cergy Pontoise, France).

    Software:

    Article Title: Developmental staging of male murine embryonic gonad by SAGE analysis
    Article Snippet: The PCR products were cleaned using QIAquick96 PCR BioRobot Kit run on BioRobot 3000 (Qiagen Corp., Gaithersburg, MD, USA). .. SAGE2000 analysis software was used to extract SAGE tags from raw sequence data while genes encoded by the tag sequences were identified using the latest stable build of the SAGEmap database (build 151) from NCBI.

    Article Title: Generation and characterization of ABBV642, a dual variable domain immunoglobulin molecule (DVD-Ig) that potently neutralizes VEGF and PDGF-BB and is designed for the treatment of exudative age-related macular degeneration
    Article Snippet: Antibody heavy and light chain variable regions (VH and VL) of the selected hybridomas were cloned and expressed as chimeric antibodies, and then further humanized using computer-aided high throughput humanization design software developed at AbbVie. .. The PCR reaction was purified using Qiagen Qiaquick PCR Purification Kit (28104 or 963141).

    Article Title: Role of Pfmdr1 in In VitroPlasmodium falciparum Susceptibility to Chloroquine, Quinine, Monodesethylamodiaquine, Mefloquine, Lumefantrine, and Dihydroartemisinin
    Article Snippet: Amplicons were purified using the QIAquick96 PCR BioRobot kit and an automated protocol on the BioRobot 8000 workstation (Qiagen, Courtaboeuf, France). .. The purified products were sequenced using an ABI Prism 3100 analyzer (Applied Biosystems), and the sequences were analyzed using VectorNTI advance software (version 11; Invitrogen, Cergy Pontoise, France).

    Article Title: Absence of association between Plasmodium falciparum small sub-unit ribosomal RNA gene mutations and in vitro decreased susceptibility to doxycycline
    Article Snippet: Amplicons were purified using the QIAquick 96 PCR BioRobot Kit and an automated protocol on the BioRobot 8000 workstation (Qiagen, Courtaboeuf, France). .. The purified products were sequenced using an ABI Prism 3100 analyser (Applied Biosystems), and the sequences were analysed using Vector NTI advance (TM) software (version 11, Invitrogen, Cergy Pontoise, France).

    Agarose Gel Electrophoresis:

    Article Title: Role of Pfmdr1 in In VitroPlasmodium falciparum Susceptibility to Chloroquine, Quinine, Monodesethylamodiaquine, Mefloquine, Lumefantrine, and Dihydroartemisinin
    Article Snippet: The PCR products were separated using a 1.5% agarose gel containing 0.5 μg/ml ethidium bromide. .. Amplicons were purified using the QIAquick96 PCR BioRobot kit and an automated protocol on the BioRobot 8000 workstation (Qiagen, Courtaboeuf, France).

    Article Title: Pathway Analysis of Differentially Expressed Genes in Patients with Acute Aortic Dissection
    Article Snippet: .. Amplified inserts (Taq PCR Master Mix; Qiagen) were purified (Qiaquick 96 PCR BioRobot Kit; Qiagen), checked on an agarose gel, and spotted four times each (0.2 ng) on treated glass slides. ..

    Article Title: Generation and characterization of ABBV642, a dual variable domain immunoglobulin molecule (DVD-Ig) that potently neutralizes VEGF and PDGF-BB and is designed for the treatment of exudative age-related macular degeneration
    Article Snippet: The second-round PCR was purified using Qiagen PCR Purification Kit (28104 or 963141), the DNA concentration was determined by nanodrop reading and multiple PCRs were pooled for digest. .. Digested DNA was run on agarose gel, the appropriate sized band was extracted and Qiagen Gel Extraction Kit (28704) was used to clean the DNA.

    Article Title: Characterization of Genetically Matched Isolates of Campylobacter jejuni Reveals that Mutations in Genes Involved in Flagellar Biosynthesis Alter the Organism's Virulence Potential ▿
    Article Snippet: Thermal cycling was performed using a Tetrad thermal cycler (MJ Research, Waltham, MA) with the following amplification parameters: 30 cycles of 25 s at 94°C, 25 s at 52°C, and 2 min at 72°C and a final extension at 72°C for 5 min. PCR products were analyzed by gel electrophoresis in a 1% (wt/vol) agarose gel (containing 0.5 μg of ethidium bromide/ml) in 1× Tris-acetate-EDTA buffer. .. A total of 1,530 PCR products were successfully amplified and then purified on a QIAGEN 8000 robot using a Qiaquick 96-well Biorobot kit (QIAGEN), dried, and resuspended to an average concentration of 0.1 to 0.2 μg/μl in 20 μl of 50% dimethyl sulfoxide containing 0.3× saline sodium citrate (SSC; 1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate).

    Article Title: Comparison of Genotypes of Salmonella enterica Serovar Enteritidis Phage Type 30 and 9c Strains Isolated during Three Outbreaks Associated with Raw Almonds ▿
    Article Snippet: Thermal cycling was performed using a Tetrad thermal cycler (Bio-Rad) with the following amplification parameters: 30 cycles of 25 s at 94°C, 25 s at 52°C, and 2 min at 72°C, with a final extension at 72°C for 5 min. PCR products were analyzed by gel electrophoresis in a 1% (wt/vol) agarose gel (containing 0.5 μg/ml of ethidium bromide) in 1× Tris-acetate-EDTA buffer. .. These PCR products were purified on a Qiagen 8000 robot using a QIAquick 96-well Biorobot kit (Qiagen, Valencia, CA), dried, and resuspended to an average concentration of 0.1 to 0.2 μg/μl in 10 μl of 50% dimethyl sulfoxide (DMSO) containing 0.3× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate).

    Article Title: Absence of association between Plasmodium falciparum small sub-unit ribosomal RNA gene mutations and in vitro decreased susceptibility to doxycycline
    Article Snippet: The PCR products were loaded on 1 % agarose gel containing 0.5 μg/mL ethidium bromide. .. Amplicons were purified using the QIAquick 96 PCR BioRobot Kit and an automated protocol on the BioRobot 8000 workstation (Qiagen, Courtaboeuf, France).

    Evaporation:

    Article Title: Combined Transcript and Metabolite Analysis Reveals Genes Involved in Spider Mite Induced Volatile Formation in Cucumber Plants 1
    Article Snippet: .. Qiaquick PCR BioRoBot kit (Qiagen, Venlo, The Netherlands) was used for DNA purification followed by complete liquid evaporation. .. DNA was dissolved in 10 μ L 5× SSC before being arrayed in duplicates onto amino silane coated glass slides (PixSys 7500 BioDot; Genomic Solutions, Ann Arbor, MI).

    Concentration Assay:

    Article Title: The Sterolgene v0 cDNA microarray: a systemic approach to studies of cholesterol homeostasis and drug metabolism
    Article Snippet: From these plasmids PCR products were amplified (Qbiogene, Morgan Irvine, CA, USA) and purified using the QIAquick 96 PCR BioRobot purification kit (Qiagen GmBH, Hilden, Germany). .. PCR products were dried and dissolved in 50% formamide and 1% CHAPS (3-[(3-cholamidopropyl)-dimethylammonio]-1-propane sulfonate) spotting buffer in final 200 ng/μl concentration.

    Article Title: Generation and characterization of ABBV642, a dual variable domain immunoglobulin molecule (DVD-Ig) that potently neutralizes VEGF and PDGF-BB and is designed for the treatment of exudative age-related macular degeneration
    Article Snippet: The PCR reaction was purified using Qiagen Qiaquick PCR Purification Kit (28104 or 963141). .. The second-round PCR was purified using Qiagen PCR Purification Kit (28104 or 963141), the DNA concentration was determined by nanodrop reading and multiple PCRs were pooled for digest.

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: The initial concentration of the tested products was calculated by measuring A260 . .. The clones selected for sequencing were subject to PCR with generic vector primers and the resulting fragments purified on BioRobot8000 using the QIAquick 96 PCR Biorobot kit (Qiagen, Inc., Valencia, CA).

    Article Title: Generation and characterization of ABBV642, a dual variable domain immunoglobulin molecule (DVD-Ig) that potently neutralizes VEGF and PDGF-BB and is designed for the treatment of exudative age-related macular degeneration
    Article Snippet: .. The second-round PCR was purified using Qiagen PCR Purification Kit (28104 or 963141), the DNA concentration was determined by nanodrop reading and multiple PCRs were pooled for digest. .. PCR products and vectors were digested with XbaI and SalI for HCs or XbaI and BsiWI for LCs.

    Article Title: Characterization of Genetically Matched Isolates of Campylobacter jejuni Reveals that Mutations in Genes Involved in Flagellar Biosynthesis Alter the Organism's Virulence Potential ▿
    Article Snippet: .. A total of 1,530 PCR products were successfully amplified and then purified on a QIAGEN 8000 robot using a Qiaquick 96-well Biorobot kit (QIAGEN), dried, and resuspended to an average concentration of 0.1 to 0.2 μg/μl in 20 μl of 50% dimethyl sulfoxide containing 0.3× saline sodium citrate (SSC; 1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). .. All of the PCR probes were then spotted in duplicate on GAPSII slides (Corning, Acton, MA) using an OmniGrid Accent (GeneMachines, Ann Arbor, MI) producing a final array that contained a total of 3,060 features.

    Article Title: Comparison of Genotypes of Salmonella enterica Serovar Enteritidis Phage Type 30 and 9c Strains Isolated during Three Outbreaks Associated with Raw Almonds ▿
    Article Snippet: .. These PCR products were purified on a Qiagen 8000 robot using a QIAquick 96-well Biorobot kit (Qiagen, Valencia, CA), dried, and resuspended to an average concentration of 0.1 to 0.2 μg/μl in 10 μl of 50% dimethyl sulfoxide (DMSO) containing 0.3× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). .. All of the PCR probes then were spotted onto Ultra-GAPS glass slides (Corning Inc., Corning, NY) using an OmniGrid Accent (Digilab, Holliston, MA), producing a final array that contained a total of 4,664 features including duplicates.

    DNA Purification:

    Article Title: Combined Transcript and Metabolite Analysis Reveals Genes Involved in Spider Mite Induced Volatile Formation in Cucumber Plants 1
    Article Snippet: .. Qiaquick PCR BioRoBot kit (Qiagen, Venlo, The Netherlands) was used for DNA purification followed by complete liquid evaporation. .. DNA was dissolved in 10 μ L 5× SSC before being arrayed in duplicates onto amino silane coated glass slides (PixSys 7500 BioDot; Genomic Solutions, Ann Arbor, MI).

    High Throughput Screening Assay:

    Article Title: Generation and characterization of ABBV642, a dual variable domain immunoglobulin molecule (DVD-Ig) that potently neutralizes VEGF and PDGF-BB and is designed for the treatment of exudative age-related macular degeneration
    Article Snippet: Antibody heavy and light chain variable regions (VH and VL) of the selected hybridomas were cloned and expressed as chimeric antibodies, and then further humanized using computer-aided high throughput humanization design software developed at AbbVie. .. The PCR reaction was purified using Qiagen Qiaquick PCR Purification Kit (28104 or 963141).

    Gel Extraction:

    Article Title: Generation and characterization of ABBV642, a dual variable domain immunoglobulin molecule (DVD-Ig) that potently neutralizes VEGF and PDGF-BB and is designed for the treatment of exudative age-related macular degeneration
    Article Snippet: The second-round PCR was purified using Qiagen PCR Purification Kit (28104 or 963141), the DNA concentration was determined by nanodrop reading and multiple PCRs were pooled for digest. .. Digested DNA was run on agarose gel, the appropriate sized band was extracted and Qiagen Gel Extraction Kit (28704) was used to clean the DNA.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen qiaquick 96 well biorobot kit
    Qiaquick 96 Well Biorobot Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiaquick 96 well biorobot kit/product/Qiagen
    Average 99 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    qiaquick 96 well biorobot kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results