q5 hotstart polymerase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    New England Biolabs q5 hotstart polymerase
    Q5 Hotstart Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 hotstart polymerase/product/New England Biolabs
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    q5 hotstart polymerase - by Bioz Stars, 2020-03
    90/100 stars

    Images

    Related Articles

    FACS:

    Article Title: Distinct SoxB1 networks are required for naïve and primed pluripotency
    Article Snippet: 48 hr after transfection, mCherry-positive cells were FACS sorted, replated and expanded for 72 hr. .. Genomic DNA (gDNA) was extracted using the DNeasy Blood and Tissue kit (Qiagen, Germany) following the manufacturer’s instructions. gDNA was PCR amplified using the Q5 HotStart Polymerase (NEB, Ipswich, USA) and primers flanking either the Sox2 sgRNA or Sox3 sgRNAs recognition sites.

    Clone Assay:

    Article Title: Distinct SoxB1 networks are required for naïve and primed pluripotency
    Article Snippet: For Sox3 indel analysis, two individual sgRNAs were cloned in BbsI -linearised pSpCas9(BB)−2A-mCherry that was obtained by fusing a 2A-mCherry cassette to the Cas9 CDS of the eSpCas9(1.1) plasmid (Addgene 71814). .. Genomic DNA (gDNA) was extracted using the DNeasy Blood and Tissue kit (Qiagen, Germany) following the manufacturer’s instructions. gDNA was PCR amplified using the Q5 HotStart Polymerase (NEB, Ipswich, USA) and primers flanking either the Sox2 sgRNA or Sox3 sgRNAs recognition sites.

    Article Title: A systems biology approach identifies FUT8 as a driver of melanoma metastasis
    Article Snippet: .. The FUT8 promoter was cloned from human genomic cDNA using Q5 Hotstart Polymerase (New England Biolabs) and inserted into the pLightSwitch-Prom reporter vector (SwitchGear Genomics) using the forward primer 5′-TTTCAGTTGGAAGGAGGTAGGG-3′, and reverse primer 5′-CCGCTCGGACTCGGA-3′. .. Plasmids were purified using Endo-Free Plasmid Maxi Kit (Qiagen).

    Article Title: MicroRNA-424 Predicts a Role for β-1,4 Branched Glycosylation in Cell Cycle Progression *
    Article Snippet: .. The 3′-UTRs of MGAT4A , OGT , and GALNT13 ( ) were cloned from MCF-7 cDNA using Q5 Hotstart Polymerase (New England BioLabs) and inserted into the pLightSwitch_3′-UTR vector (SwitchGear Genomics) using the primers listed in . .. Plasmids were purified using Endo-Free Plasmid Maxi kit (Qiagen).

    Article Title: B cell superantigens in the human intestinal microbiota
    Article Snippet: Immunoglobulin heavy chain variable regions were amplified from 2 μL cDNA using Q5 HotStart polymerase (NEB) and forward primer MsVHE GGGAATTCGAGGTGCAGCTGCAGGAGTCTGG and reverse Cα primer GAAAGTTCACGGTGGTTATATCC. .. PCR fragments were cloned into vectors using the NEB PCR cloning kit, transformed into 10-beta competent E. coli ).

    Transfection:

    Article Title: Distinct SoxB1 networks are required for naïve and primed pluripotency
    Article Snippet: 48 hr after transfection, mCherry-positive cells were FACS sorted, replated and expanded for 72 hr. .. Genomic DNA (gDNA) was extracted using the DNeasy Blood and Tissue kit (Qiagen, Germany) following the manufacturer’s instructions. gDNA was PCR amplified using the Q5 HotStart Polymerase (NEB, Ipswich, USA) and primers flanking either the Sox2 sgRNA or Sox3 sgRNAs recognition sites.

    Amplification:

    Article Title: Distinct SoxB1 networks are required for naïve and primed pluripotency
    Article Snippet: .. Genomic DNA (gDNA) was extracted using the DNeasy Blood and Tissue kit (Qiagen, Germany) following the manufacturer’s instructions. gDNA was PCR amplified using the Q5 HotStart Polymerase (NEB, Ipswich, USA) and primers flanking either the Sox2 sgRNA or Sox3 sgRNAs recognition sites. ..

    Article Title: B cell superantigens in the human intestinal microbiota
    Article Snippet: .. Immunoglobulin heavy chain variable regions were amplified from 2 μL cDNA using Q5 HotStart polymerase (NEB) and forward primer MsVHE GGGAATTCGAGGTGCAGCTGCAGGAGTCTGG and reverse Cα primer GAAAGTTCACGGTGGTTATATCC. ..

    Reporter Assay:

    Article Title: A systems biology approach identifies FUT8 as a driver of melanoma metastasis
    Article Snippet: Paragraph title: Luciferase Reporter Assay ... The FUT8 promoter was cloned from human genomic cDNA using Q5 Hotstart Polymerase (New England Biolabs) and inserted into the pLightSwitch-Prom reporter vector (SwitchGear Genomics) using the forward primer 5′-TTTCAGTTGGAAGGAGGTAGGG-3′, and reverse primer 5′-CCGCTCGGACTCGGA-3′.

    Article Title: MicroRNA-424 Predicts a Role for β-1,4 Branched Glycosylation in Cell Cycle Progression *
    Article Snippet: Paragraph title: Luciferase Reporter Assay ... The 3′-UTRs of MGAT4A , OGT , and GALNT13 ( ) were cloned from MCF-7 cDNA using Q5 Hotstart Polymerase (New England BioLabs) and inserted into the pLightSwitch_3′-UTR vector (SwitchGear Genomics) using the primers listed in .

    Generated:

    Article Title: Distinct SoxB1 networks are required for naïve and primed pluripotency
    Article Snippet: Genomic DNA (gDNA) was extracted using the DNeasy Blood and Tissue kit (Qiagen, Germany) following the manufacturer’s instructions. gDNA was PCR amplified using the Q5 HotStart Polymerase (NEB, Ipswich, USA) and primers flanking either the Sox2 sgRNA or Sox3 sgRNAs recognition sites. .. PCR amplicons were purified and submitted for Sanger sequencing using the same forward primer that they had been generated with.

    Purification:

    Article Title: Distinct SoxB1 networks are required for naïve and primed pluripotency
    Article Snippet: Genomic DNA (gDNA) was extracted using the DNeasy Blood and Tissue kit (Qiagen, Germany) following the manufacturer’s instructions. gDNA was PCR amplified using the Q5 HotStart Polymerase (NEB, Ipswich, USA) and primers flanking either the Sox2 sgRNA or Sox3 sgRNAs recognition sites. .. PCR amplicons were purified and submitted for Sanger sequencing using the same forward primer that they had been generated with.

    Article Title: A systems biology approach identifies FUT8 as a driver of melanoma metastasis
    Article Snippet: The FUT8 promoter was cloned from human genomic cDNA using Q5 Hotstart Polymerase (New England Biolabs) and inserted into the pLightSwitch-Prom reporter vector (SwitchGear Genomics) using the forward primer 5′-TTTCAGTTGGAAGGAGGTAGGG-3′, and reverse primer 5′-CCGCTCGGACTCGGA-3′. .. Plasmids were purified using Endo-Free Plasmid Maxi Kit (Qiagen).

    Article Title: MicroRNA-424 Predicts a Role for β-1,4 Branched Glycosylation in Cell Cycle Progression *
    Article Snippet: The 3′-UTRs of MGAT4A , OGT , and GALNT13 ( ) were cloned from MCF-7 cDNA using Q5 Hotstart Polymerase (New England BioLabs) and inserted into the pLightSwitch_3′-UTR vector (SwitchGear Genomics) using the primers listed in . .. Plasmids were purified using Endo-Free Plasmid Maxi kit (Qiagen).

    Article Title: B cell superantigens in the human intestinal microbiota
    Article Snippet: Immunoglobulin heavy chain variable regions were amplified from 2 μL cDNA using Q5 HotStart polymerase (NEB) and forward primer MsVHE GGGAATTCGAGGTGCAGCTGCAGGAGTCTGG and reverse Cα primer GAAAGTTCACGGTGGTTATATCC. .. PCR fragments were visualized by agarose gel electrophoresis and a ~500 nt band was excised from the gel and purified using the QIAquick gel extraction kit (Qiagen).

    Polymerase Chain Reaction:

    Article Title: Distinct SoxB1 networks are required for naïve and primed pluripotency
    Article Snippet: .. Genomic DNA (gDNA) was extracted using the DNeasy Blood and Tissue kit (Qiagen, Germany) following the manufacturer’s instructions. gDNA was PCR amplified using the Q5 HotStart Polymerase (NEB, Ipswich, USA) and primers flanking either the Sox2 sgRNA or Sox3 sgRNAs recognition sites. ..

    Article Title: B cell superantigens in the human intestinal microbiota
    Article Snippet: Immunoglobulin heavy chain variable regions were amplified from 2 μL cDNA using Q5 HotStart polymerase (NEB) and forward primer MsVHE GGGAATTCGAGGTGCAGCTGCAGGAGTCTGG and reverse Cα primer GAAAGTTCACGGTGGTTATATCC. .. PCR fragments were visualized by agarose gel electrophoresis and a ~500 nt band was excised from the gel and purified using the QIAquick gel extraction kit (Qiagen).

    Incubation:

    Article Title: B cell superantigens in the human intestinal microbiota
    Article Snippet: The column was transferred to a new 1.5 mL collection tube and 30 μL RNase-free water was added and incubated for 1–2 mins, then centrifuged for 1 min at 8,000g to elute the RNA. cDNA synthesis was performed with the Superscript IV First Strand cDNA synthesis kit (Thermo) using poly-d(T) primers according to the manufacturer’s protocol. .. Immunoglobulin heavy chain variable regions were amplified from 2 μL cDNA using Q5 HotStart polymerase (NEB) and forward primer MsVHE GGGAATTCGAGGTGCAGCTGCAGGAGTCTGG and reverse Cα primer GAAAGTTCACGGTGGTTATATCC.

    Luciferase:

    Article Title: A systems biology approach identifies FUT8 as a driver of melanoma metastasis
    Article Snippet: Paragraph title: Luciferase Reporter Assay ... The FUT8 promoter was cloned from human genomic cDNA using Q5 Hotstart Polymerase (New England Biolabs) and inserted into the pLightSwitch-Prom reporter vector (SwitchGear Genomics) using the forward primer 5′-TTTCAGTTGGAAGGAGGTAGGG-3′, and reverse primer 5′-CCGCTCGGACTCGGA-3′.

    Article Title: MicroRNA-424 Predicts a Role for β-1,4 Branched Glycosylation in Cell Cycle Progression *
    Article Snippet: Paragraph title: Luciferase Reporter Assay ... The 3′-UTRs of MGAT4A , OGT , and GALNT13 ( ) were cloned from MCF-7 cDNA using Q5 Hotstart Polymerase (New England BioLabs) and inserted into the pLightSwitch_3′-UTR vector (SwitchGear Genomics) using the primers listed in .

    Expressing:

    Article Title: Distinct SoxB1 networks are required for naïve and primed pluripotency
    Article Snippet: The resulting plasmid, or the empty vector control, were then transfected using Lipofectamine 3000 (Life Technologies, Waltham, USA) into SCKO ESCs constitutively expressing either SOX1, SOX3 or GFP. .. Genomic DNA (gDNA) was extracted using the DNeasy Blood and Tissue kit (Qiagen, Germany) following the manufacturer’s instructions. gDNA was PCR amplified using the Q5 HotStart Polymerase (NEB, Ipswich, USA) and primers flanking either the Sox2 sgRNA or Sox3 sgRNAs recognition sites.

    Gel Extraction:

    Article Title: B cell superantigens in the human intestinal microbiota
    Article Snippet: Immunoglobulin heavy chain variable regions were amplified from 2 μL cDNA using Q5 HotStart polymerase (NEB) and forward primer MsVHE GGGAATTCGAGGTGCAGCTGCAGGAGTCTGG and reverse Cα primer GAAAGTTCACGGTGGTTATATCC. .. PCR fragments were visualized by agarose gel electrophoresis and a ~500 nt band was excised from the gel and purified using the QIAquick gel extraction kit (Qiagen).

    Sequencing:

    Article Title: Distinct SoxB1 networks are required for naïve and primed pluripotency
    Article Snippet: Genomic DNA (gDNA) was extracted using the DNeasy Blood and Tissue kit (Qiagen, Germany) following the manufacturer’s instructions. gDNA was PCR amplified using the Q5 HotStart Polymerase (NEB, Ipswich, USA) and primers flanking either the Sox2 sgRNA or Sox3 sgRNAs recognition sites. .. PCR amplicons were purified and submitted for Sanger sequencing using the same forward primer that they had been generated with.

    Agarose Gel Electrophoresis:

    Article Title: B cell superantigens in the human intestinal microbiota
    Article Snippet: Immunoglobulin heavy chain variable regions were amplified from 2 μL cDNA using Q5 HotStart polymerase (NEB) and forward primer MsVHE GGGAATTCGAGGTGCAGCTGCAGGAGTCTGG and reverse Cα primer GAAAGTTCACGGTGGTTATATCC. .. PCR fragments were visualized by agarose gel electrophoresis and a ~500 nt band was excised from the gel and purified using the QIAquick gel extraction kit (Qiagen).

    Centrifugation:

    Article Title: B cell superantigens in the human intestinal microbiota
    Article Snippet: Flow through was discarded and 500 μL buffer RPE was added prior to centrifugation at 8,000g for 2 mins. .. Immunoglobulin heavy chain variable regions were amplified from 2 μL cDNA using Q5 HotStart polymerase (NEB) and forward primer MsVHE GGGAATTCGAGGTGCAGCTGCAGGAGTCTGG and reverse Cα primer GAAAGTTCACGGTGGTTATATCC.

    Transformation Assay:

    Article Title: B cell superantigens in the human intestinal microbiota
    Article Snippet: Immunoglobulin heavy chain variable regions were amplified from 2 μL cDNA using Q5 HotStart polymerase (NEB) and forward primer MsVHE GGGAATTCGAGGTGCAGCTGCAGGAGTCTGG and reverse Cα primer GAAAGTTCACGGTGGTTATATCC. .. PCR fragments were cloned into vectors using the NEB PCR cloning kit, transformed into 10-beta competent E. coli ).

    Plasmid Preparation:

    Article Title: Distinct SoxB1 networks are required for naïve and primed pluripotency
    Article Snippet: 106 E14Tg2a (Sox2+/+ ), SCKO (Sox2fl/- ), SKO1 (Sox2-/- ) and SKO6 (Sox2-/- ) EpiSCs were then transfected with 1 μg of sgRNA-containing plasmids or empty vector using Lipofectamine 3000 (Life Technologies, Waltham, USA). .. Genomic DNA (gDNA) was extracted using the DNeasy Blood and Tissue kit (Qiagen, Germany) following the manufacturer’s instructions. gDNA was PCR amplified using the Q5 HotStart Polymerase (NEB, Ipswich, USA) and primers flanking either the Sox2 sgRNA or Sox3 sgRNAs recognition sites.

    Article Title: A systems biology approach identifies FUT8 as a driver of melanoma metastasis
    Article Snippet: .. The FUT8 promoter was cloned from human genomic cDNA using Q5 Hotstart Polymerase (New England Biolabs) and inserted into the pLightSwitch-Prom reporter vector (SwitchGear Genomics) using the forward primer 5′-TTTCAGTTGGAAGGAGGTAGGG-3′, and reverse primer 5′-CCGCTCGGACTCGGA-3′. .. Plasmids were purified using Endo-Free Plasmid Maxi Kit (Qiagen).

    Article Title: MicroRNA-424 Predicts a Role for β-1,4 Branched Glycosylation in Cell Cycle Progression *
    Article Snippet: .. The 3′-UTRs of MGAT4A , OGT , and GALNT13 ( ) were cloned from MCF-7 cDNA using Q5 Hotstart Polymerase (New England BioLabs) and inserted into the pLightSwitch_3′-UTR vector (SwitchGear Genomics) using the primers listed in . .. Plasmids were purified using Endo-Free Plasmid Maxi kit (Qiagen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs q5 hotstart 2x master mix
    Q5 Hotstart 2x Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 hotstart 2x master mix/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    q5 hotstart 2x master mix - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs q5 hotstart high fidelity 2x master mix
    Q5 Hotstart High Fidelity 2x Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 hotstart high fidelity 2x master mix/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    q5 hotstart high fidelity 2x master mix - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs q5 hotstart high fidelity polymerase
    Q5 Hotstart High Fidelity Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 hotstart high fidelity polymerase/product/New England Biolabs
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    q5 hotstart high fidelity polymerase - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results