q5 high fidelity master mix  (New England Biolabs)

Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Q5 High Fidelity 2X Master Mix
    Q5 High Fidelity 2X Master Mix 500 rxns
    Catalog Number:
    500 rxns
    Thermostable DNA Polymerases
    Buy from Supplier

    Structured Review

    New England Biolabs q5 high fidelity master mix
    Q5 High Fidelity 2X Master Mix
    Q5 High Fidelity 2X Master Mix 500 rxns
    https://www.bioz.com/result/q5 high fidelity master mix/product/New England Biolabs
    Average 99 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    q5 high fidelity master mix - by Bioz Stars, 2020-03
    99/100 stars


    Related Articles

    Clone Assay:

    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli
    Article Snippet: Three such plasmids, carrying expression DNA corresponding to each of the amino acid sequences compared in Fig. were produced as follows: Nampt-PET28a vector containing Nampt gene from Mus musculus strain C57BL/6 J, a gift from dr. Cynthia Wolberger (Addgene plasmid # 25630), was cloned in E . coli DH5α and maintained (as a glycerol stock) at −80 °C. pET28a-hdNadV and pET28a-soNadV plasmids carrying the nucleotide sequence corresponding to nadV gene from Haemophilus ducreyi (strain: ATCC 27722), respectively Shewanella oneidensis (strain: MR-1) were constructed as follows: The gene sequences were selected from the GenBank database (Gene ID: 2716561 respectively 1169740), optimized for expression in E . coli (using Genome Compiler software v. 2.2.55 (Genome Compiler Corporation 2015), considering the frequency of codon usage and GC content, eliminating unwanted restriction sequences), synthesized de novo (GenScript) and ligated into pET-28a(+) vector which was first double digested with NcoI and XhoI restriction enzymes. .. For the simultaneous expression of Nampt and PRPP synthetase a bicistronic vector was constructed by PCR amplifying the baPrs sequence (Q5 High-Fidelity 2X Master Mix, NEB) from pUC57-Kan plasmid with M13 forward and reverse primers, double digestion with XbaI and NcoI restriction enzymes (NEB) of PCR product and pET28a-hdNAdV plasmid, followed by the separation of the desired DNA fragments on 1.5% agarose gel electrophoresis , purification from gel (using Wizard SV Gel and PCR Clean-Up System, Promega, Madison, USA) of desired bands (pET28a-hdNadV and baPrs) followed by ligation with T4 DNA ligase (NEB) (as shown in Fig. ).

    Article Title: Divergent evolutionary histories of DNA markers in a Hawaiian population of the coral Montipora capitata
    Article Snippet: Paragraph title: Cloning and Sanger sequencing ... For this region, we used a 3 min, 98 °C denature step, followed by 35 cycles of 98 °C 30 s, 55 °C 30 s, 72 °C 30 s, and finished with a 5 min 72 °C extension, using the NEBNext High-Fidelity 2X Master Mix.

    Article Title: Novel oncolytic chimeric orthopoxvirus causes regression of pancreatic cancer xenografts and exhibits abscopal effect at a single low dose
    Article Snippet: Generation of recombinant chimeric orthopoxvirus expressing firefly luciferase To construct thymidine kinase (TK) shuttle vector, the left and right flanking sequences of the TK gene were PCR-amplified from CF33 genomic DNA using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGCATATGATCTATGGATTACCATG GATGACAACTC-3′ and 5′-CGTTTAACTCGTCTAATTAATTCTGTAC-3′ (left flank), 5′-CAGGTAAAAGTACA GAATTAATTAGACGAGTTAAACGAGC CGTCGACGGATCCGCTAGCGGCCGCGGAGG TAATGATATGTATCAATCGGTGTGTAG-3′ and 5′-GCGGAATTCGTAATTACTTAGTA AATCCGCCGTACTAGG-3′ (right flank). .. The resulting fragment was digested with Nde I and Eco RI and cloned into plasmid pGPT to yield p33NC-TK.

    Article Title: Novel oncolytic chimeric orthopoxvirus causes regression of pancreatic cancer xenografts and exhibits abscopal effect at a single low dose
    Article Snippet: The resulting fragment was digested with Nde I and Eco RI and cloned into plasmid pGPT to yield p33NC-TK. .. The Emerald expression cassette with the VACV H5 early/late promoter was PCR-amplified from the plasmid Emerald-pBAD (Addgene, Cambridge, MA) using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGAAGCTTGAGCTCAAAAATTGAAAATAAATACAAAGGTTCTTGAGG GTTGTGTTAAATTGAAAGCGAGAAATAATCATAAATAGTCGACCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACC-3′ and 5′-GCGGGATCCATAAAAATT AATTAATCAGTACAGCTCGTCCATGCCGAGAGTGATC-3′.

    Article Title: In Vitro and In Vivo Inhibition of the Infectivity of Human Enterovirus 71 by a Sulfonated Food Azo Dye, Brilliant Black BN
    Article Snippet: All PCR was performed using Q5 high-fidelity 2× master mix (New England Biolabs), and PCR products were extracted using the QIAquick gel extraction kit (Qiagen) after DNA gel electrophoresis. .. The purified GFP-AITTL gene and linearized pJET-hPolI-B4 plasmid were ligated together by using the In-Fusion HD cloning kit (Clontech), forming the recombinant plasmid pJET-hPolI-B4/GFP.

    Article Title: The regulatory control of Cebpa enhancers and silencers in the myeloid and red-blood cell lineages
    Article Snippet: Paragraph title: Construct design and cloning using Gibson assembly ... Each CRM or promoter insert was amplified from genomic DNA of C57BL/6J mice using Q5 High-Fidelity 2X Master Mix (NEB, M0492L) following the manufacturer’s instructions.

    Article Title: Molecular Characterization of Divergent Closterovirus Isolates Infecting Ribes Species
    Article Snippet: Missing sequence segments were obtained by PCR amplification using the Q5 High-Fidelity Master Mix (NEB, Ipswich, MA, USA). .. Sequence verification and gap-filling were done through Sanger sequencing of PCR amplicons or cloned into a pGEM T-Easy vector system (Promega, Road Madison, WI, USA).


    Article Title: Optimized CRISPR guide RNA design for two high-fidelity Cas9 variants by deep learning
    Article Snippet: .. The integrated region containing the gRNA coding sequences and target sequences were PCR amplified using primers Deep-seq-library-F/R with Q5 High-Fidelity 2X Master Mix (NEB). .. We performed 66 PCR reactions using 10 µg of genomic DNA as a template per reaction for deep-sequencing analysis; we took eight independent PCR reactions using 20 ng of plasmid DNA as a template per reaction.

    Article Title: Proteasomal degradation of NOD2 by NLRP12 in monocytes promotes bacterial tolerance and colonization by enteropathogens
    Article Snippet: .. 75 ng of cDNAs were amplified using Q5 High-Fidelity 2X Master Mix (New England BioLabs). .. Forward and reverse primers used in PCR amplification are located in the 5’UTR and 3’UTR of NLRP12 cDNA respectively (Sequences available upon request), which can amplify the two alleles of NLRP12 in the patients and the healthy donor.

    Article Title: Polymorphism and structure of style–specific arabinogalactan proteins as determinants of pollen tube growth in Nicotiana
    Article Snippet: All PCR reactions were performed using Q5 High-Fidelity 2X Master Mix (NEB, Frankfurt, Germany) or Phusion High-Fidelity DNA Polymerase (NEB, Frankfurt, Germany) in a Bio-Rad iCycler Thermal Cycler. .. A second-round of amplification (nested-PCR) was done using another species- and gene-specific primer.

    Article Title: Grazing livestock are exposed to terrestrial cyanobacteria
    Article Snippet: All PCR steps used the Q5 High-Fidelity 2X Master Mix (New England Biolabs). .. The reaction ran at 94 °C for 2 min, 20 cycles of 94 °C for 1 min, 55 °C for 45 s, 72 °C for 1.5 min followed by 72 °C for 20 min. After each PCR round, AMPure XP PCR Purification (Agencourt) was used to purify amplified DNA from other components of the reaction mixture.

    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli
    Article Snippet: For the simultaneous expression of Nampt and PRPP synthetase a bicistronic vector was constructed by PCR amplifying the baPrs sequence (Q5 High-Fidelity 2X Master Mix, NEB) from pUC57-Kan plasmid with M13 forward and reverse primers, double digestion with XbaI and NcoI restriction enzymes (NEB) of PCR product and pET28a-hdNAdV plasmid, followed by the separation of the desired DNA fragments on 1.5% agarose gel electrophoresis , purification from gel (using Wizard SV Gel and PCR Clean-Up System, Promega, Madison, USA) of desired bands (pET28a-hdNadV and baPrs) followed by ligation with T4 DNA ligase (NEB) (as shown in Fig. ). .. The vectors presence was verified by 1.5% agarose gel electrophoresis and by PCR amplification with T7 forward and reverse primers (Supplementary Fig. ).

    Article Title: PCR-based detection of composite transposons and translocatable units from oral metagenomic DNA
    Article Snippet: Paragraph title: PCR amplification ... Q5 PCR reaction consisted of 12.5 μL Q5 high-fidelity 2X master mix (NEB, Hitchin, UK), 0.2 μM of each primer, 50–100 ng of DNA template and molecular grade water up to a total of 25 μL.

    Article Title: Divergent evolutionary histories of DNA markers in a Hawaiian population of the coral Montipora capitata
    Article Snippet: We also amplified a widely used Pax-C intron using the primers Mont_Pax-FP1 and Mont_Pax-RP1 ( ). .. For this region, we used a 3 min, 98 °C denature step, followed by 35 cycles of 98 °C 30 s, 55 °C 30 s, 72 °C 30 s, and finished with a 5 min 72 °C extension, using the NEBNext High-Fidelity 2X Master Mix.

    Article Title: In Vitro and In Vivo Inhibition of the Infectivity of Human Enterovirus 71 by a Sulfonated Food Azo Dye, Brilliant Black BN
    Article Snippet: The GFP gene from the pLVX-IRES-ZsGreen1 vector (Clontech) with an EV71 protease 2A recognition sequence AITTL at the 3′ end was amplified with primers GFP-F and GFP-R ( ). .. All PCR was performed using Q5 high-fidelity 2× master mix (New England Biolabs), and PCR products were extracted using the QIAquick gel extraction kit (Qiagen) after DNA gel electrophoresis.

    Article Title: Microplastics Reduce Short-Term Effects of Environmental Contaminants. Part II: Polyethylene Particles Decrease the Effect of Polycyclic Aromatic Hydrocarbons on Microorganisms
    Article Snippet: .. For PCR amplification, the Q5® High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA) was used in 50 µL volumes with 20 ng of DNA per reaction. .. The PCRs were conducted in a BIO RAD S1000 Thermal Cycler (Hercules, CA, USA) using the following program: 98 °C 60 s [98 °C 10 s, 70 °C 20 s, 72 °C 20 s] × 10, [98 °C 10 s, 70 °C 10 s, 72 °C 20 s] × 25, 72 °C 2 min. PCR Products were cleaned using the New England Biolabs Monarch™ PCR & DNA Cleanup Kit following the manufacturer’s instructions.

    Article Title: The microbiome composition of Aedes aegypti is not critical for Wolbachia-mediated inhibition of dengue virus
    Article Snippet: .. Samples were amplified (25 cycles) using Q5 HotStart 2X Master Mix (New England BioLabs) with a primer pair for the V3 and V4 regions of bacterial small subunit (SSU) ribosomal gene (16s) (Australian Centre for Ecogenomics primer pair Bac_SSU_341F-806wR: 341F CCTACGGGNGGCWGCAG; 806R GACTACHVGGGTATCTAATCC). ..

    Article Title: The regulatory control of Cebpa enhancers and silencers in the myeloid and red-blood cell lineages
    Article Snippet: .. Each CRM or promoter insert was amplified from genomic DNA of C57BL/6J mice using Q5 High-Fidelity 2X Master Mix (NEB, M0492L) following the manufacturer’s instructions. .. The following PCR cycling conditions were used: initial denaturation of 30s at 98C, 30 cycles of 30s at 98C, 30s at 60C, and 60s at 72C, and a final extension for 10 minutes at 72C.

    Article Title: Molecular Characterization of Divergent Closterovirus Isolates Infecting Ribes Species
    Article Snippet: .. Missing sequence segments were obtained by PCR amplification using the Q5 High-Fidelity Master Mix (NEB, Ipswich, MA, USA). .. The 5′-termini were completed and sequenced with a 5′ rapid amplification of complementary DNA (cDNA) ends (RACE) kit (Invitrogen, Carlsbad, CA, USA), and the 3′-ends were derived as previously described [ ].


    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli
    Article Snippet: For pET28a-soNadV plasmid, for technical reasons a restriction site for NcoI enzyme (5′C▼ CATGG3′) was added, assuming no effect on the enzyme activity. pUC57-Kan-prs plasmid was generated by ligation of Prs gene sequence (Gene ID: ) with L135I mutation (CTC to ATA) synthesized by GenScript and ligated into NcoI/XbaI restriction sites of pUC57-Kan plasmid. .. For the simultaneous expression of Nampt and PRPP synthetase a bicistronic vector was constructed by PCR amplifying the baPrs sequence (Q5 High-Fidelity 2X Master Mix, NEB) from pUC57-Kan plasmid with M13 forward and reverse primers, double digestion with XbaI and NcoI restriction enzymes (NEB) of PCR product and pET28a-hdNAdV plasmid, followed by the separation of the desired DNA fragments on 1.5% agarose gel electrophoresis , purification from gel (using Wizard SV Gel and PCR Clean-Up System, Promega, Madison, USA) of desired bands (pET28a-hdNadV and baPrs) followed by ligation with T4 DNA ligase (NEB) (as shown in Fig. ).


    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli
    Article Snippet: .. For the simultaneous expression of Nampt and PRPP synthetase a bicistronic vector was constructed by PCR amplifying the baPrs sequence (Q5 High-Fidelity 2X Master Mix, NEB) from pUC57-Kan plasmid with M13 forward and reverse primers, double digestion with XbaI and NcoI restriction enzymes (NEB) of PCR product and pET28a-hdNAdV plasmid, followed by the separation of the desired DNA fragments on 1.5% agarose gel electrophoresis , purification from gel (using Wizard SV Gel and PCR Clean-Up System, Promega, Madison, USA) of desired bands (pET28a-hdNadV and baPrs) followed by ligation with T4 DNA ligase (NEB) (as shown in Fig. ). .. Resulted bicistronic vector pET28a-baPrs-hdNadV was deposited at Addgene under the ID #91950.

    Article Title: Novel oncolytic chimeric orthopoxvirus causes regression of pancreatic cancer xenografts and exhibits abscopal effect at a single low dose
    Article Snippet: .. Generation of recombinant chimeric orthopoxvirus expressing firefly luciferase To construct thymidine kinase (TK) shuttle vector, the left and right flanking sequences of the TK gene were PCR-amplified from CF33 genomic DNA using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGCATATGATCTATGGATTACCATG GATGACAACTC-3′ and 5′-CGTTTAACTCGTCTAATTAATTCTGTAC-3′ (left flank), 5′-CAGGTAAAAGTACA GAATTAATTAGACGAGTTAAACGAGC CGTCGACGGATCCGCTAGCGGCCGCGGAGG TAATGATATGTATCAATCGGTGTGTAG-3′ and 5′-GCGGAATTCGTAATTACTTAGTA AATCCGCCGTACTAGG-3′ (right flank). ..

    Article Title: Novel oncolytic chimeric orthopoxvirus causes regression of pancreatic cancer xenografts and exhibits abscopal effect at a single low dose
    Article Snippet: To construct thymidine kinase (TK) shuttle vector, the left and right flanking sequences of the TK gene were PCR-amplified from CF33 genomic DNA using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGCATATGATCTATGGATTACCATG GATGACAACTC-3′ and 5′-CGTTTAACTCGTCTAATTAATTCTGTAC-3′ (left flank), 5′-CAGGTAAAAGTACA GAATTAATTAGACGAGTTAAACGAGC CGTCGACGGATCCGCTAGCGGCCGCGGAGG TAATGATATGTATCAATCGGTGTGTAG-3′ and 5′-GCGGAATTCGTAATTACTTAGTA AATCCGCCGTACTAGG-3′ (right flank). .. The Emerald expression cassette with the VACV H5 early/late promoter was PCR-amplified from the plasmid Emerald-pBAD (Addgene, Cambridge, MA) using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGAAGCTTGAGCTCAAAAATTGAAAATAAATACAAAGGTTCTTGAGG GTTGTGTTAAATTGAAAGCGAGAAATAATCATAAATAGTCGACCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACC-3′ and 5′-GCGGGATCCATAAAAATT AATTAATCAGTACAGCTCGTCCATGCCGAGAGTGATC-3′.

    Article Title: In Vitro and In Vivo Inhibition of the Infectivity of Human Enterovirus 71 by a Sulfonated Food Azo Dye, Brilliant Black BN
    Article Snippet: The genome of EV71-B4 with a green fluorescent protein (GFP) gene was constructed as described previously , with modifications. .. All PCR was performed using Q5 high-fidelity 2× master mix (New England Biolabs), and PCR products were extracted using the QIAquick gel extraction kit (Qiagen) after DNA gel electrophoresis.

    Article Title: The regulatory control of Cebpa enhancers and silencers in the myeloid and red-blood cell lineages
    Article Snippet: Paragraph title: Construct design and cloning using Gibson assembly ... Each CRM or promoter insert was amplified from genomic DNA of C57BL/6J mice using Q5 High-Fidelity 2X Master Mix (NEB, M0492L) following the manufacturer’s instructions.


    Article Title: Microplastics Reduce Short-Term Effects of Environmental Contaminants. Part II: Polyethylene Particles Decrease the Effect of Polycyclic Aromatic Hydrocarbons on Microorganisms
    Article Snippet: For PCR amplification, the Q5® High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA) was used in 50 µL volumes with 20 ng of DNA per reaction. .. Separation of fragments and analysis of peak intensity for the attained ARISA fragment lengths (AFLs) was conducted by Eurofins Genomics via Capillary electrophoresis on an ABI 3130 XL sequencing machine (Applied Biosystems, Foster City, CA, USA) using the LIZ1200 size standard and the ABI-G filter system.


    Article Title: Microplastics Reduce Short-Term Effects of Environmental Contaminants. Part II: Polyethylene Particles Decrease the Effect of Polycyclic Aromatic Hydrocarbons on Microorganisms
    Article Snippet: To achieve better cell lysis, samples were incubated at 70 °C for 10 min at 350 rpm (Eppendorf Thermomixer Comfort, Hamburg, Germany). .. For PCR amplification, the Q5® High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA) was used in 50 µL volumes with 20 ng of DNA per reaction.


    Article Title: Novel oncolytic chimeric orthopoxvirus causes regression of pancreatic cancer xenografts and exhibits abscopal effect at a single low dose
    Article Snippet: .. Generation of recombinant chimeric orthopoxvirus expressing firefly luciferase To construct thymidine kinase (TK) shuttle vector, the left and right flanking sequences of the TK gene were PCR-amplified from CF33 genomic DNA using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGCATATGATCTATGGATTACCATG GATGACAACTC-3′ and 5′-CGTTTAACTCGTCTAATTAATTCTGTAC-3′ (left flank), 5′-CAGGTAAAAGTACA GAATTAATTAGACGAGTTAAACGAGC CGTCGACGGATCCGCTAGCGGCCGCGGAGG TAATGATATGTATCAATCGGTGTGTAG-3′ and 5′-GCGGAATTCGTAATTACTTAGTA AATCCGCCGTACTAGG-3′ (right flank). ..

    Article Title: Novel oncolytic chimeric orthopoxvirus causes regression of pancreatic cancer xenografts and exhibits abscopal effect at a single low dose
    Article Snippet: Paragraph title: Generation of recombinant chimeric orthopoxvirus expressing firefly luciferase ... The Emerald expression cassette with the VACV H5 early/late promoter was PCR-amplified from the plasmid Emerald-pBAD (Addgene, Cambridge, MA) using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGAAGCTTGAGCTCAAAAATTGAAAATAAATACAAAGGTTCTTGAGG GTTGTGTTAAATTGAAAGCGAGAAATAATCATAAATAGTCGACCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACC-3′ and 5′-GCGGGATCCATAAAAATT AATTAATCAGTACAGCTCGTCCATGCCGAGAGTGATC-3′.

    Article Title: The regulatory control of Cebpa enhancers and silencers in the myeloid and red-blood cell lineages
    Article Snippet: Construct design and cloning using Gibson assembly Putative CRMs were cloned into a pGL4.10luc2 Luciferase reporter vector (Promega, E6651). .. Each CRM or promoter insert was amplified from genomic DNA of C57BL/6J mice using Q5 High-Fidelity 2X Master Mix (NEB, M0492L) following the manufacturer’s instructions.

    Activity Assay:

    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli
    Article Snippet: For pET28a-soNadV plasmid, for technical reasons a restriction site for NcoI enzyme (5′C▼ CATGG3′) was added, assuming no effect on the enzyme activity. pUC57-Kan-prs plasmid was generated by ligation of Prs gene sequence (Gene ID: ) with L135I mutation (CTC to ATA) synthesized by GenScript and ligated into NcoI/XbaI restriction sites of pUC57-Kan plasmid. .. For the simultaneous expression of Nampt and PRPP synthetase a bicistronic vector was constructed by PCR amplifying the baPrs sequence (Q5 High-Fidelity 2X Master Mix, NEB) from pUC57-Kan plasmid with M13 forward and reverse primers, double digestion with XbaI and NcoI restriction enzymes (NEB) of PCR product and pET28a-hdNAdV plasmid, followed by the separation of the desired DNA fragments on 1.5% agarose gel electrophoresis , purification from gel (using Wizard SV Gel and PCR Clean-Up System, Promega, Madison, USA) of desired bands (pET28a-hdNadV and baPrs) followed by ligation with T4 DNA ligase (NEB) (as shown in Fig. ).

    Cell Culture:

    Article Title: Optimized CRISPR guide RNA design for two high-fidelity Cas9 variants by deep learning
    Article Snippet: Cells were harvested and the genomic DNA was isolated using Blood & Cell Culture DNA Kits (Qiagen) following the manufacturer’s instructions. .. The integrated region containing the gRNA coding sequences and target sequences were PCR amplified using primers Deep-seq-library-F/R with Q5 High-Fidelity 2X Master Mix (NEB).


    Article Title: Proteasomal degradation of NOD2 by NLRP12 in monocytes promotes bacterial tolerance and colonization by enteropathogens
    Article Snippet: Paragraph title: Gene expression analysis ... 75 ng of cDNAs were amplified using Q5 High-Fidelity 2X Master Mix (New England BioLabs).

    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli
    Article Snippet: .. For the simultaneous expression of Nampt and PRPP synthetase a bicistronic vector was constructed by PCR amplifying the baPrs sequence (Q5 High-Fidelity 2X Master Mix, NEB) from pUC57-Kan plasmid with M13 forward and reverse primers, double digestion with XbaI and NcoI restriction enzymes (NEB) of PCR product and pET28a-hdNAdV plasmid, followed by the separation of the desired DNA fragments on 1.5% agarose gel electrophoresis , purification from gel (using Wizard SV Gel and PCR Clean-Up System, Promega, Madison, USA) of desired bands (pET28a-hdNadV and baPrs) followed by ligation with T4 DNA ligase (NEB) (as shown in Fig. ). .. Resulted bicistronic vector pET28a-baPrs-hdNadV was deposited at Addgene under the ID #91950.

    Article Title: Novel oncolytic chimeric orthopoxvirus causes regression of pancreatic cancer xenografts and exhibits abscopal effect at a single low dose
    Article Snippet: .. Generation of recombinant chimeric orthopoxvirus expressing firefly luciferase To construct thymidine kinase (TK) shuttle vector, the left and right flanking sequences of the TK gene were PCR-amplified from CF33 genomic DNA using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGCATATGATCTATGGATTACCATG GATGACAACTC-3′ and 5′-CGTTTAACTCGTCTAATTAATTCTGTAC-3′ (left flank), 5′-CAGGTAAAAGTACA GAATTAATTAGACGAGTTAAACGAGC CGTCGACGGATCCGCTAGCGGCCGCGGAGG TAATGATATGTATCAATCGGTGTGTAG-3′ and 5′-GCGGAATTCGTAATTACTTAGTA AATCCGCCGTACTAGG-3′ (right flank). ..

    Article Title: Novel oncolytic chimeric orthopoxvirus causes regression of pancreatic cancer xenografts and exhibits abscopal effect at a single low dose
    Article Snippet: .. The Emerald expression cassette with the VACV H5 early/late promoter was PCR-amplified from the plasmid Emerald-pBAD (Addgene, Cambridge, MA) using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGAAGCTTGAGCTCAAAAATTGAAAATAAATACAAAGGTTCTTGAGG GTTGTGTTAAATTGAAAGCGAGAAATAATCATAAATAGTCGACCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACC-3′ and 5′-GCGGGATCCATAAAAATT AATTAATCAGTACAGCTCGTCCATGCCGAGAGTGATC-3′. .. The PCR fragment was digested with Sac I and Bam HI and cloned into plasmid p33NC-TK to yield p33NCTK-H5-Emerald.

    Transformation Assay:

    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli
    Article Snippet: The transformed kanamycin (km) resistant bacteria were selected on agar plates. .. For the simultaneous expression of Nampt and PRPP synthetase a bicistronic vector was constructed by PCR amplifying the baPrs sequence (Q5 High-Fidelity 2X Master Mix, NEB) from pUC57-Kan plasmid with M13 forward and reverse primers, double digestion with XbaI and NcoI restriction enzymes (NEB) of PCR product and pET28a-hdNAdV plasmid, followed by the separation of the desired DNA fragments on 1.5% agarose gel electrophoresis , purification from gel (using Wizard SV Gel and PCR Clean-Up System, Promega, Madison, USA) of desired bands (pET28a-hdNadV and baPrs) followed by ligation with T4 DNA ligase (NEB) (as shown in Fig. ).

    Derivative Assay:

    Article Title: Molecular Characterization of Divergent Closterovirus Isolates Infecting Ribes Species
    Article Snippet: Missing sequence segments were obtained by PCR amplification using the Q5 High-Fidelity Master Mix (NEB, Ipswich, MA, USA). .. The 5′-termini were completed and sequenced with a 5′ rapid amplification of complementary DNA (cDNA) ends (RACE) kit (Invitrogen, Carlsbad, CA, USA), and the 3′-ends were derived as previously described [ ].


    Article Title: In Vitro and In Vivo Inhibition of the Infectivity of Human Enterovirus 71 by a Sulfonated Food Azo Dye, Brilliant Black BN
    Article Snippet: All PCR was performed using Q5 high-fidelity 2× master mix (New England Biolabs), and PCR products were extracted using the QIAquick gel extraction kit (Qiagen) after DNA gel electrophoresis. .. The infectious EV71-GFP reporter virus was generated by direct transfection of the plasmid pJET-hPolI-B4/GFP into RD cells using Lipofectamine 2000 (Thermo Fisher Scientific) and then further propagated in RD cells for 2 passages.

    Polymerase Cycling Assembly:

    Article Title: Divergent evolutionary histories of DNA markers in a Hawaiian population of the coral Montipora capitata
    Article Snippet: For this region, we used a 3 min, 98 °C denature step, followed by 35 cycles of 98 °C 30 s, 55 °C 30 s, 72 °C 30 s, and finished with a 5 min 72 °C extension, using the NEBNext High-Fidelity 2X Master Mix. .. Using sequences of putative single-copy genes identified in the M. capitata RNA-seq assembly PCR primers were designed to yield ca.


    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli
    Article Snippet: .. For the simultaneous expression of Nampt and PRPP synthetase a bicistronic vector was constructed by PCR amplifying the baPrs sequence (Q5 High-Fidelity 2X Master Mix, NEB) from pUC57-Kan plasmid with M13 forward and reverse primers, double digestion with XbaI and NcoI restriction enzymes (NEB) of PCR product and pET28a-hdNAdV plasmid, followed by the separation of the desired DNA fragments on 1.5% agarose gel electrophoresis , purification from gel (using Wizard SV Gel and PCR Clean-Up System, Promega, Madison, USA) of desired bands (pET28a-hdNadV and baPrs) followed by ligation with T4 DNA ligase (NEB) (as shown in Fig. ). .. Resulted bicistronic vector pET28a-baPrs-hdNadV was deposited at Addgene under the ID #91950.


    Article Title: Optimized CRISPR guide RNA design for two high-fidelity Cas9 variants by deep learning
    Article Snippet: After 24 h, cells were infected with gRNA library with at least 1000-fold coverage of each gRNAs. .. The integrated region containing the gRNA coding sequences and target sequences were PCR amplified using primers Deep-seq-library-F/R with Q5 High-Fidelity 2X Master Mix (NEB).


    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli
    Article Snippet: For pET28a-soNadV plasmid, for technical reasons a restriction site for NcoI enzyme (5′C▼ CATGG3′) was added, assuming no effect on the enzyme activity. pUC57-Kan-prs plasmid was generated by ligation of Prs gene sequence (Gene ID: ) with L135I mutation (CTC to ATA) synthesized by GenScript and ligated into NcoI/XbaI restriction sites of pUC57-Kan plasmid. .. For the simultaneous expression of Nampt and PRPP synthetase a bicistronic vector was constructed by PCR amplifying the baPrs sequence (Q5 High-Fidelity 2X Master Mix, NEB) from pUC57-Kan plasmid with M13 forward and reverse primers, double digestion with XbaI and NcoI restriction enzymes (NEB) of PCR product and pET28a-hdNAdV plasmid, followed by the separation of the desired DNA fragments on 1.5% agarose gel electrophoresis , purification from gel (using Wizard SV Gel and PCR Clean-Up System, Promega, Madison, USA) of desired bands (pET28a-hdNadV and baPrs) followed by ligation with T4 DNA ligase (NEB) (as shown in Fig. ).

    Article Title: In Vitro and In Vivo Inhibition of the Infectivity of Human Enterovirus 71 by a Sulfonated Food Azo Dye, Brilliant Black BN
    Article Snippet: All PCR was performed using Q5 high-fidelity 2× master mix (New England Biolabs), and PCR products were extracted using the QIAquick gel extraction kit (Qiagen) after DNA gel electrophoresis. .. The infectious EV71-GFP reporter virus was generated by direct transfection of the plasmid pJET-hPolI-B4/GFP into RD cells using Lipofectamine 2000 (Thermo Fisher Scientific) and then further propagated in RD cells for 2 passages.


    Article Title: Proteasomal degradation of NOD2 by NLRP12 in monocytes promotes bacterial tolerance and colonization by enteropathogens
    Article Snippet: 75 ng of cDNAs were amplified using Q5 High-Fidelity 2X Master Mix (New England BioLabs). .. Exon 3 of NLRP12 cDNA was sequenced with the Big Dye Terminator sequencing kit (Applied Biosystems) using two different primers (sequences available upon request), and run on an ABI 3730 × l automated sequencer.

    Article Title: Polymorphism and structure of style–specific arabinogalactan proteins as determinants of pollen tube growth in Nicotiana
    Article Snippet: Paragraph title: RNA isolation and cDNA sequencing ... All PCR reactions were performed using Q5 High-Fidelity 2X Master Mix (NEB, Frankfurt, Germany) or Phusion High-Fidelity DNA Polymerase (NEB, Frankfurt, Germany) in a Bio-Rad iCycler Thermal Cycler.

    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli
    Article Snippet: .. For the simultaneous expression of Nampt and PRPP synthetase a bicistronic vector was constructed by PCR amplifying the baPrs sequence (Q5 High-Fidelity 2X Master Mix, NEB) from pUC57-Kan plasmid with M13 forward and reverse primers, double digestion with XbaI and NcoI restriction enzymes (NEB) of PCR product and pET28a-hdNAdV plasmid, followed by the separation of the desired DNA fragments on 1.5% agarose gel electrophoresis , purification from gel (using Wizard SV Gel and PCR Clean-Up System, Promega, Madison, USA) of desired bands (pET28a-hdNadV and baPrs) followed by ligation with T4 DNA ligase (NEB) (as shown in Fig. ). .. Resulted bicistronic vector pET28a-baPrs-hdNadV was deposited at Addgene under the ID #91950.

    Article Title: Divergent evolutionary histories of DNA markers in a Hawaiian population of the coral Montipora capitata
    Article Snippet: Paragraph title: Cloning and Sanger sequencing ... For this region, we used a 3 min, 98 °C denature step, followed by 35 cycles of 98 °C 30 s, 55 °C 30 s, 72 °C 30 s, and finished with a 5 min 72 °C extension, using the NEBNext High-Fidelity 2X Master Mix.

    Article Title: Novel oncolytic chimeric orthopoxvirus causes regression of pancreatic cancer xenografts and exhibits abscopal effect at a single low dose
    Article Snippet: Generation of recombinant chimeric orthopoxvirus expressing firefly luciferase To construct thymidine kinase (TK) shuttle vector, the left and right flanking sequences of the TK gene were PCR-amplified from CF33 genomic DNA using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGCATATGATCTATGGATTACCATG GATGACAACTC-3′ and 5′-CGTTTAACTCGTCTAATTAATTCTGTAC-3′ (left flank), 5′-CAGGTAAAAGTACA GAATTAATTAGACGAGTTAAACGAGC CGTCGACGGATCCGCTAGCGGCCGCGGAGG TAATGATATGTATCAATCGGTGTGTAG-3′ and 5′-GCGGAATTCGTAATTACTTAGTA AATCCGCCGTACTAGG-3′ (right flank). .. The flanking sequences of TK in the shuttle vector were confirmed by sequencing. p33NC-TK contains the left and right flanking sequences of TK separated by Sac I, Sal I, BamH I, Nhe I and Not I, and Escherichia coli guanine phosphoribosyltransferase (gpt) gene driven by the VACV early promoter p7.5E as a transient dominant selectable marker.

    Article Title: Novel oncolytic chimeric orthopoxvirus causes regression of pancreatic cancer xenografts and exhibits abscopal effect at a single low dose
    Article Snippet: The flanking sequences of TK in the shuttle vector were confirmed by sequencing. p33NC-TK contains the left and right flanking sequences of TK separated by Sac I, Sal I, BamH I, Nhe I and Not I, and Escherichia coli guanine phosphoribosyltransferase (gpt) gene driven by the VACV early promoter p7.5E as a transient dominant selectable marker. .. The Emerald expression cassette with the VACV H5 early/late promoter was PCR-amplified from the plasmid Emerald-pBAD (Addgene, Cambridge, MA) using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGAAGCTTGAGCTCAAAAATTGAAAATAAATACAAAGGTTCTTGAGG GTTGTGTTAAATTGAAAGCGAGAAATAATCATAAATAGTCGACCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACC-3′ and 5′-GCGGGATCCATAAAAATT AATTAATCAGTACAGCTCGTCCATGCCGAGAGTGATC-3′.

    Article Title: In Vitro and In Vivo Inhibition of the Infectivity of Human Enterovirus 71 by a Sulfonated Food Azo Dye, Brilliant Black BN
    Article Snippet: The GFP gene from the pLVX-IRES-ZsGreen1 vector (Clontech) with an EV71 protease 2A recognition sequence AITTL at the 3′ end was amplified with primers GFP-F and GFP-R ( ). .. All PCR was performed using Q5 high-fidelity 2× master mix (New England Biolabs), and PCR products were extracted using the QIAquick gel extraction kit (Qiagen) after DNA gel electrophoresis.

    Article Title: Microplastics Reduce Short-Term Effects of Environmental Contaminants. Part II: Polyethylene Particles Decrease the Effect of Polycyclic Aromatic Hydrocarbons on Microorganisms
    Article Snippet: For PCR amplification, the Q5® High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA) was used in 50 µL volumes with 20 ng of DNA per reaction. .. Separation of fragments and analysis of peak intensity for the attained ARISA fragment lengths (AFLs) was conducted by Eurofins Genomics via Capillary electrophoresis on an ABI 3130 XL sequencing machine (Applied Biosystems, Foster City, CA, USA) using the LIZ1200 size standard and the ABI-G filter system.

    Article Title: The regulatory control of Cebpa enhancers and silencers in the myeloid and red-blood cell lineages
    Article Snippet: Each CRM or promoter insert was amplified from genomic DNA of C57BL/6J mice using Q5 High-Fidelity 2X Master Mix (NEB, M0492L) following the manufacturer’s instructions. .. Primers included 40bp of sequence homologous to pGL4.10luc2 (Table C in ).

    Article Title: Molecular Characterization of Divergent Closterovirus Isolates Infecting Ribes Species
    Article Snippet: .. Missing sequence segments were obtained by PCR amplification using the Q5 High-Fidelity Master Mix (NEB, Ipswich, MA, USA). .. The 5′-termini were completed and sequenced with a 5′ rapid amplification of complementary DNA (cDNA) ends (RACE) kit (Invitrogen, Carlsbad, CA, USA), and the 3′-ends were derived as previously described [ ].


    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli
    Article Snippet: Recombinant Nicotinamide phosphoribosyltransferase (Nampt) gene was cloned in pET-28a(+) expression vector from Novagen which permits protein expression under the control of T7 lac promoter . .. For the simultaneous expression of Nampt and PRPP synthetase a bicistronic vector was constructed by PCR amplifying the baPrs sequence (Q5 High-Fidelity 2X Master Mix, NEB) from pUC57-Kan plasmid with M13 forward and reverse primers, double digestion with XbaI and NcoI restriction enzymes (NEB) of PCR product and pET28a-hdNAdV plasmid, followed by the separation of the desired DNA fragments on 1.5% agarose gel electrophoresis , purification from gel (using Wizard SV Gel and PCR Clean-Up System, Promega, Madison, USA) of desired bands (pET28a-hdNadV and baPrs) followed by ligation with T4 DNA ligase (NEB) (as shown in Fig. ).

    Article Title: Novel oncolytic chimeric orthopoxvirus causes regression of pancreatic cancer xenografts and exhibits abscopal effect at a single low dose
    Article Snippet: .. Generation of recombinant chimeric orthopoxvirus expressing firefly luciferase To construct thymidine kinase (TK) shuttle vector, the left and right flanking sequences of the TK gene were PCR-amplified from CF33 genomic DNA using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGCATATGATCTATGGATTACCATG GATGACAACTC-3′ and 5′-CGTTTAACTCGTCTAATTAATTCTGTAC-3′ (left flank), 5′-CAGGTAAAAGTACA GAATTAATTAGACGAGTTAAACGAGC CGTCGACGGATCCGCTAGCGGCCGCGGAGG TAATGATATGTATCAATCGGTGTGTAG-3′ and 5′-GCGGAATTCGTAATTACTTAGTA AATCCGCCGTACTAGG-3′ (right flank). ..

    Article Title: Novel oncolytic chimeric orthopoxvirus causes regression of pancreatic cancer xenografts and exhibits abscopal effect at a single low dose
    Article Snippet: Paragraph title: Generation of recombinant chimeric orthopoxvirus expressing firefly luciferase ... The Emerald expression cassette with the VACV H5 early/late promoter was PCR-amplified from the plasmid Emerald-pBAD (Addgene, Cambridge, MA) using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGAAGCTTGAGCTCAAAAATTGAAAATAAATACAAAGGTTCTTGAGG GTTGTGTTAAATTGAAAGCGAGAAATAATCATAAATAGTCGACCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACC-3′ and 5′-GCGGGATCCATAAAAATT AATTAATCAGTACAGCTCGTCCATGCCGAGAGTGATC-3′.

    Article Title: In Vitro and In Vivo Inhibition of the Infectivity of Human Enterovirus 71 by a Sulfonated Food Azo Dye, Brilliant Black BN
    Article Snippet: All PCR was performed using Q5 high-fidelity 2× master mix (New England Biolabs), and PCR products were extracted using the QIAquick gel extraction kit (Qiagen) after DNA gel electrophoresis. .. The purified GFP-AITTL gene and linearized pJET-hPolI-B4 plasmid were ligated together by using the In-Fusion HD cloning kit (Clontech), forming the recombinant plasmid pJET-hPolI-B4/GFP.

    DNA Gel Electrophoresis:

    Article Title: In Vitro and In Vivo Inhibition of the Infectivity of Human Enterovirus 71 by a Sulfonated Food Azo Dye, Brilliant Black BN
    Article Snippet: .. All PCR was performed using Q5 high-fidelity 2× master mix (New England Biolabs), and PCR products were extracted using the QIAquick gel extraction kit (Qiagen) after DNA gel electrophoresis. .. The purified GFP-AITTL gene and linearized pJET-hPolI-B4 plasmid were ligated together by using the In-Fusion HD cloning kit (Clontech), forming the recombinant plasmid pJET-hPolI-B4/GFP.

    DNA Extraction:

    Article Title: Grazing livestock are exposed to terrestrial cyanobacteria
    Article Snippet: The MO-BIO Powersoil DNA Isolation Kit was used to extract total sample DNA following manufacturer’s instructions. .. All PCR steps used the Q5 High-Fidelity 2X Master Mix (New England Biolabs).

    Article Title: Microplastics Reduce Short-Term Effects of Environmental Contaminants. Part II: Polyethylene Particles Decrease the Effect of Polycyclic Aromatic Hydrocarbons on Microorganisms
    Article Snippet: 0.25 g of sediment was extracted using the PowerSoil DNA Isolation Kit (former MO BIO Laboratories, Carlsbad, CA, USA, now Qiagen, Germantown, MD, USA) according to the manufacturer’s instructions with minor modifications. .. For PCR amplification, the Q5® High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA) was used in 50 µL volumes with 20 ng of DNA per reaction.

    Nucleic Acid Electrophoresis:

    Article Title: PCR-based detection of composite transposons and translocatable units from oral metagenomic DNA
    Article Snippet: Q5 PCR reaction consisted of 12.5 μL Q5 high-fidelity 2X master mix (NEB, Hitchin, UK), 0.2 μM of each primer, 50–100 ng of DNA template and molecular grade water up to a total of 25 μL. .. PCR amplicons were visualized by gel electrophoresis on 1% agarose gel stained with GelRed nucleic acid stain (Biotium, Cambridge, UK).

    RNA Sequencing Assay:

    Article Title: Divergent evolutionary histories of DNA markers in a Hawaiian population of the coral Montipora capitata
    Article Snippet: For this region, we used a 3 min, 98 °C denature step, followed by 35 cycles of 98 °C 30 s, 55 °C 30 s, 72 °C 30 s, and finished with a 5 min 72 °C extension, using the NEBNext High-Fidelity 2X Master Mix. .. Using sequences of putative single-copy genes identified in the M. capitata RNA-seq assembly PCR primers were designed to yield ca.


    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli
    Article Snippet: For pET28a-soNadV plasmid, for technical reasons a restriction site for NcoI enzyme (5′C▼ CATGG3′) was added, assuming no effect on the enzyme activity. pUC57-Kan-prs plasmid was generated by ligation of Prs gene sequence (Gene ID: ) with L135I mutation (CTC to ATA) synthesized by GenScript and ligated into NcoI/XbaI restriction sites of pUC57-Kan plasmid. .. For the simultaneous expression of Nampt and PRPP synthetase a bicistronic vector was constructed by PCR amplifying the baPrs sequence (Q5 High-Fidelity 2X Master Mix, NEB) from pUC57-Kan plasmid with M13 forward and reverse primers, double digestion with XbaI and NcoI restriction enzymes (NEB) of PCR product and pET28a-hdNAdV plasmid, followed by the separation of the desired DNA fragments on 1.5% agarose gel electrophoresis , purification from gel (using Wizard SV Gel and PCR Clean-Up System, Promega, Madison, USA) of desired bands (pET28a-hdNadV and baPrs) followed by ligation with T4 DNA ligase (NEB) (as shown in Fig. ).


    Article Title: Optimized CRISPR guide RNA design for two high-fidelity Cas9 variants by deep learning
    Article Snippet: Cells were harvested and the genomic DNA was isolated using Blood & Cell Culture DNA Kits (Qiagen) following the manufacturer’s instructions. .. The integrated region containing the gRNA coding sequences and target sequences were PCR amplified using primers Deep-seq-library-F/R with Q5 High-Fidelity 2X Master Mix (NEB).

    Article Title: Polymorphism and structure of style–specific arabinogalactan proteins as determinants of pollen tube growth in Nicotiana
    Article Snippet: Paragraph title: RNA isolation and cDNA sequencing ... All PCR reactions were performed using Q5 High-Fidelity 2X Master Mix (NEB, Frankfurt, Germany) or Phusion High-Fidelity DNA Polymerase (NEB, Frankfurt, Germany) in a Bio-Rad iCycler Thermal Cycler.

    Article Title: Molecular Characterization of Divergent Closterovirus Isolates Infecting Ribes Species
    Article Snippet: Missing sequence segments were obtained by PCR amplification using the Q5 High-Fidelity Master Mix (NEB, Ipswich, MA, USA). .. SLO: Total RNA was extracted from 100 mg of leaf tissue using an RNeasy Plant Mini Kit (Qiagen, Sverige, Denmark), in which RLT buffer was supplemented with a 10% Plant RNA Isolation Aid (Thermo Fisher Scientific).

    Mouse Assay:

    Article Title: The regulatory control of Cebpa enhancers and silencers in the myeloid and red-blood cell lineages
    Article Snippet: .. Each CRM or promoter insert was amplified from genomic DNA of C57BL/6J mice using Q5 High-Fidelity 2X Master Mix (NEB, M0492L) following the manufacturer’s instructions. .. The following PCR cycling conditions were used: initial denaturation of 30s at 98C, 30 cycles of 30s at 98C, 30s at 60C, and 60s at 72C, and a final extension for 10 minutes at 72C.

    Polymerase Chain Reaction:

    Article Title: Optimized CRISPR guide RNA design for two high-fidelity Cas9 variants by deep learning
    Article Snippet: .. The integrated region containing the gRNA coding sequences and target sequences were PCR amplified using primers Deep-seq-library-F/R with Q5 High-Fidelity 2X Master Mix (NEB). .. We performed 66 PCR reactions using 10 µg of genomic DNA as a template per reaction for deep-sequencing analysis; we took eight independent PCR reactions using 20 ng of plasmid DNA as a template per reaction.

    Article Title: Proteasomal degradation of NOD2 by NLRP12 in monocytes promotes bacterial tolerance and colonization by enteropathogens
    Article Snippet: Relative mRNA levels (2−ΔΔCt ) were determined by comparing (a) the PCR cycle thresholds (Ct) for the gene of interest and Actb (ΔCt) and (b) ΔCt values for treated and control groups (ΔΔCt). .. 75 ng of cDNAs were amplified using Q5 High-Fidelity 2X Master Mix (New England BioLabs).

    Article Title: Polymorphism and structure of style–specific arabinogalactan proteins as determinants of pollen tube growth in Nicotiana
    Article Snippet: .. All PCR reactions were performed using Q5 High-Fidelity 2X Master Mix (NEB, Frankfurt, Germany) or Phusion High-Fidelity DNA Polymerase (NEB, Frankfurt, Germany) in a Bio-Rad iCycler Thermal Cycler. ..

    Article Title: Grazing livestock are exposed to terrestrial cyanobacteria
    Article Snippet: .. All PCR steps used the Q5 High-Fidelity 2X Master Mix (New England Biolabs). .. The first round of PCR consisted of 20 cycles using the primers 28 F (5’ GAGTTTGATCNTGGCTCAG 3’) and 805R (5’ GACTACCAGGGTATCTAATC 3’) in a total reaction volume of 50 μL.

    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli
    Article Snippet: .. For the simultaneous expression of Nampt and PRPP synthetase a bicistronic vector was constructed by PCR amplifying the baPrs sequence (Q5 High-Fidelity 2X Master Mix, NEB) from pUC57-Kan plasmid with M13 forward and reverse primers, double digestion with XbaI and NcoI restriction enzymes (NEB) of PCR product and pET28a-hdNAdV plasmid, followed by the separation of the desired DNA fragments on 1.5% agarose gel electrophoresis , purification from gel (using Wizard SV Gel and PCR Clean-Up System, Promega, Madison, USA) of desired bands (pET28a-hdNadV and baPrs) followed by ligation with T4 DNA ligase (NEB) (as shown in Fig. ). .. Resulted bicistronic vector pET28a-baPrs-hdNadV was deposited at Addgene under the ID #91950.

    Article Title: PCR-based detection of composite transposons and translocatable units from oral metagenomic DNA
    Article Snippet: .. Q5 PCR reaction consisted of 12.5 μL Q5 high-fidelity 2X master mix (NEB, Hitchin, UK), 0.2 μM of each primer, 50–100 ng of DNA template and molecular grade water up to a total of 25 μL. .. PCR amplicons were visualized by gel electrophoresis on 1% agarose gel stained with GelRed nucleic acid stain (Biotium, Cambridge, UK).

    Article Title: Divergent evolutionary histories of DNA markers in a Hawaiian population of the coral Montipora capitata
    Article Snippet: Some of these MTC and ITS1 amplification products were cloned into the vector pCR-Blunt II-TOPO using the Invitrogen Zero Blunt TOPO PCR Cloning Kit (ThermoFisher Scientific). .. For this region, we used a 3 min, 98 °C denature step, followed by 35 cycles of 98 °C 30 s, 55 °C 30 s, 72 °C 30 s, and finished with a 5 min 72 °C extension, using the NEBNext High-Fidelity 2X Master Mix.

    Article Title: Novel oncolytic chimeric orthopoxvirus causes regression of pancreatic cancer xenografts and exhibits abscopal effect at a single low dose
    Article Snippet: .. Generation of recombinant chimeric orthopoxvirus expressing firefly luciferase To construct thymidine kinase (TK) shuttle vector, the left and right flanking sequences of the TK gene were PCR-amplified from CF33 genomic DNA using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGCATATGATCTATGGATTACCATG GATGACAACTC-3′ and 5′-CGTTTAACTCGTCTAATTAATTCTGTAC-3′ (left flank), 5′-CAGGTAAAAGTACA GAATTAATTAGACGAGTTAAACGAGC CGTCGACGGATCCGCTAGCGGCCGCGGAGG TAATGATATGTATCAATCGGTGTGTAG-3′ and 5′-GCGGAATTCGTAATTACTTAGTA AATCCGCCGTACTAGG-3′ (right flank). ..

    Article Title: Novel oncolytic chimeric orthopoxvirus causes regression of pancreatic cancer xenografts and exhibits abscopal effect at a single low dose
    Article Snippet: .. The Emerald expression cassette with the VACV H5 early/late promoter was PCR-amplified from the plasmid Emerald-pBAD (Addgene, Cambridge, MA) using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGAAGCTTGAGCTCAAAAATTGAAAATAAATACAAAGGTTCTTGAGG GTTGTGTTAAATTGAAAGCGAGAAATAATCATAAATAGTCGACCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACC-3′ and 5′-GCGGGATCCATAAAAATT AATTAATCAGTACAGCTCGTCCATGCCGAGAGTGATC-3′. .. The PCR fragment was digested with Sac I and Bam HI and cloned into plasmid p33NC-TK to yield p33NCTK-H5-Emerald.

    Article Title: In Vitro and In Vivo Inhibition of the Infectivity of Human Enterovirus 71 by a Sulfonated Food Azo Dye, Brilliant Black BN
    Article Snippet: .. All PCR was performed using Q5 high-fidelity 2× master mix (New England Biolabs), and PCR products were extracted using the QIAquick gel extraction kit (Qiagen) after DNA gel electrophoresis. .. The purified GFP-AITTL gene and linearized pJET-hPolI-B4 plasmid were ligated together by using the In-Fusion HD cloning kit (Clontech), forming the recombinant plasmid pJET-hPolI-B4/GFP.

    Article Title: Microplastics Reduce Short-Term Effects of Environmental Contaminants. Part II: Polyethylene Particles Decrease the Effect of Polycyclic Aromatic Hydrocarbons on Microorganisms
    Article Snippet: .. For PCR amplification, the Q5® High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA) was used in 50 µL volumes with 20 ng of DNA per reaction. .. The PCRs were conducted in a BIO RAD S1000 Thermal Cycler (Hercules, CA, USA) using the following program: 98 °C 60 s [98 °C 10 s, 70 °C 20 s, 72 °C 20 s] × 10, [98 °C 10 s, 70 °C 10 s, 72 °C 20 s] × 25, 72 °C 2 min. PCR Products were cleaned using the New England Biolabs Monarch™ PCR & DNA Cleanup Kit following the manufacturer’s instructions.

    Article Title: The regulatory control of Cebpa enhancers and silencers in the myeloid and red-blood cell lineages
    Article Snippet: Each CRM or promoter insert was amplified from genomic DNA of C57BL/6J mice using Q5 High-Fidelity 2X Master Mix (NEB, M0492L) following the manufacturer’s instructions. .. The following PCR cycling conditions were used: initial denaturation of 30s at 98C, 30 cycles of 30s at 98C, 30s at 60C, and 60s at 72C, and a final extension for 10 minutes at 72C.

    Article Title: Soil Macroinvertebrate Presence Alters Microbial Community Composition and Activity in the Rhizosphere
    Article Snippet: The amplicons were cleaned with MagBio HighPrep PCR beads (MagBio Genomics, Gaithersburg MD, United States) in clear 96-well plates. .. The cleaned amplicons received attachments of unique two-barcode index combinations through combination of the following into each well of a 96-well plate: 5 μL of sample, 2.5 μL of forward and reverse primers containing designated barcodes that target the attached overhangs, 2.5 μL of water, and 12.5 μL of Q5 High Fidelity 2X Master Mix (New England Biolabs, Inc., Ipswich, MA, United States).

    Article Title: Molecular Characterization of Divergent Closterovirus Isolates Infecting Ribes Species
    Article Snippet: .. Missing sequence segments were obtained by PCR amplification using the Q5 High-Fidelity Master Mix (NEB, Ipswich, MA, USA). .. The 5′-termini were completed and sequenced with a 5′ rapid amplification of complementary DNA (cDNA) ends (RACE) kit (Invitrogen, Carlsbad, CA, USA), and the 3′-ends were derived as previously described [ ].

    Gel Extraction:

    Article Title: Optimized CRISPR guide RNA design for two high-fidelity Cas9 variants by deep learning
    Article Snippet: The integrated region containing the gRNA coding sequences and target sequences were PCR amplified using primers Deep-seq-library-F/R with Q5 High-Fidelity 2X Master Mix (NEB). .. The PCR products were mixed and purified using the Gel Extraction Kit (Qiagen).

    Article Title: In Vitro and In Vivo Inhibition of the Infectivity of Human Enterovirus 71 by a Sulfonated Food Azo Dye, Brilliant Black BN
    Article Snippet: .. All PCR was performed using Q5 high-fidelity 2× master mix (New England Biolabs), and PCR products were extracted using the QIAquick gel extraction kit (Qiagen) after DNA gel electrophoresis. .. The purified GFP-AITTL gene and linearized pJET-hPolI-B4 plasmid were ligated together by using the In-Fusion HD cloning kit (Clontech), forming the recombinant plasmid pJET-hPolI-B4/GFP.

    Nested PCR:

    Article Title: Polymorphism and structure of style–specific arabinogalactan proteins as determinants of pollen tube growth in Nicotiana
    Article Snippet: All PCR reactions were performed using Q5 High-Fidelity 2X Master Mix (NEB, Frankfurt, Germany) or Phusion High-Fidelity DNA Polymerase (NEB, Frankfurt, Germany) in a Bio-Rad iCycler Thermal Cycler. .. A second-round of amplification (nested-PCR) was done using another species- and gene-specific primer.

    Article Title: Grazing livestock are exposed to terrestrial cyanobacteria
    Article Snippet: 100 ng DNA was used in a two-round nested PCR protocol to amplify the V2-V3 region of the 16S gene. .. All PCR steps used the Q5 High-Fidelity 2X Master Mix (New England Biolabs).

    Agarose Gel Electrophoresis:

    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli
    Article Snippet: .. For the simultaneous expression of Nampt and PRPP synthetase a bicistronic vector was constructed by PCR amplifying the baPrs sequence (Q5 High-Fidelity 2X Master Mix, NEB) from pUC57-Kan plasmid with M13 forward and reverse primers, double digestion with XbaI and NcoI restriction enzymes (NEB) of PCR product and pET28a-hdNAdV plasmid, followed by the separation of the desired DNA fragments on 1.5% agarose gel electrophoresis , purification from gel (using Wizard SV Gel and PCR Clean-Up System, Promega, Madison, USA) of desired bands (pET28a-hdNadV and baPrs) followed by ligation with T4 DNA ligase (NEB) (as shown in Fig. ). .. Resulted bicistronic vector pET28a-baPrs-hdNadV was deposited at Addgene under the ID #91950.

    Article Title: PCR-based detection of composite transposons and translocatable units from oral metagenomic DNA
    Article Snippet: Q5 PCR reaction consisted of 12.5 μL Q5 high-fidelity 2X master mix (NEB, Hitchin, UK), 0.2 μM of each primer, 50–100 ng of DNA template and molecular grade water up to a total of 25 μL. .. PCR amplicons were visualized by gel electrophoresis on 1% agarose gel stained with GelRed nucleic acid stain (Biotium, Cambridge, UK).


    Article Title: Optimized CRISPR guide RNA design for two high-fidelity Cas9 variants by deep learning
    Article Snippet: The integrated region containing the gRNA coding sequences and target sequences were PCR amplified using primers Deep-seq-library-F/R with Q5 High-Fidelity 2X Master Mix (NEB). .. The PCR products were mixed and purified using the Gel Extraction Kit (Qiagen).

    Article Title: Grazing livestock are exposed to terrestrial cyanobacteria
    Article Snippet: All PCR steps used the Q5 High-Fidelity 2X Master Mix (New England Biolabs). .. The reaction ran at 94 °C for 2 min, 20 cycles of 94 °C for 1 min, 55 °C for 45 s, 72 °C for 1.5 min followed by 72 °C for 20 min. After each PCR round, AMPure XP PCR Purification (Agencourt) was used to purify amplified DNA from other components of the reaction mixture.

    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli
    Article Snippet: .. For the simultaneous expression of Nampt and PRPP synthetase a bicistronic vector was constructed by PCR amplifying the baPrs sequence (Q5 High-Fidelity 2X Master Mix, NEB) from pUC57-Kan plasmid with M13 forward and reverse primers, double digestion with XbaI and NcoI restriction enzymes (NEB) of PCR product and pET28a-hdNAdV plasmid, followed by the separation of the desired DNA fragments on 1.5% agarose gel electrophoresis , purification from gel (using Wizard SV Gel and PCR Clean-Up System, Promega, Madison, USA) of desired bands (pET28a-hdNadV and baPrs) followed by ligation with T4 DNA ligase (NEB) (as shown in Fig. ). .. Resulted bicistronic vector pET28a-baPrs-hdNadV was deposited at Addgene under the ID #91950.

    Article Title: Divergent evolutionary histories of DNA markers in a Hawaiian population of the coral Montipora capitata
    Article Snippet: Ten colonies from each set were picked, plasmids were purified, and inserts were Sanger-sequenced using the vector-specific primers SP6 and T7. .. For this region, we used a 3 min, 98 °C denature step, followed by 35 cycles of 98 °C 30 s, 55 °C 30 s, 72 °C 30 s, and finished with a 5 min 72 °C extension, using the NEBNext High-Fidelity 2X Master Mix.

    Article Title: In Vitro and In Vivo Inhibition of the Infectivity of Human Enterovirus 71 by a Sulfonated Food Azo Dye, Brilliant Black BN
    Article Snippet: All PCR was performed using Q5 high-fidelity 2× master mix (New England Biolabs), and PCR products were extracted using the QIAquick gel extraction kit (Qiagen) after DNA gel electrophoresis. .. The purified GFP-AITTL gene and linearized pJET-hPolI-B4 plasmid were ligated together by using the In-Fusion HD cloning kit (Clontech), forming the recombinant plasmid pJET-hPolI-B4/GFP.

    Article Title: Molecular Characterization of Divergent Closterovirus Isolates Infecting Ribes Species
    Article Snippet: GR and G55: Four red currant accessions were extracted with the GeneJET Plant RNA Purification Kit (Thermo Fisher Scientific, Vilnius, Lithuania) and mRNA-enriched (TruSeq Stranded mRNA kit, Illumina, San Diego, CA, USA) before being subjected to HTS (SeqMe s.r.o., Dobříš, Czech Republic). .. Missing sequence segments were obtained by PCR amplification using the Q5 High-Fidelity Master Mix (NEB, Ipswich, MA, USA).

    Plasmid Preparation:

    Article Title: Optimized CRISPR guide RNA design for two high-fidelity Cas9 variants by deep learning
    Article Snippet: The integrated region containing the gRNA coding sequences and target sequences were PCR amplified using primers Deep-seq-library-F/R with Q5 High-Fidelity 2X Master Mix (NEB). .. We performed 66 PCR reactions using 10 µg of genomic DNA as a template per reaction for deep-sequencing analysis; we took eight independent PCR reactions using 20 ng of plasmid DNA as a template per reaction.

    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli
    Article Snippet: .. For the simultaneous expression of Nampt and PRPP synthetase a bicistronic vector was constructed by PCR amplifying the baPrs sequence (Q5 High-Fidelity 2X Master Mix, NEB) from pUC57-Kan plasmid with M13 forward and reverse primers, double digestion with XbaI and NcoI restriction enzymes (NEB) of PCR product and pET28a-hdNAdV plasmid, followed by the separation of the desired DNA fragments on 1.5% agarose gel electrophoresis , purification from gel (using Wizard SV Gel and PCR Clean-Up System, Promega, Madison, USA) of desired bands (pET28a-hdNadV and baPrs) followed by ligation with T4 DNA ligase (NEB) (as shown in Fig. ). .. Resulted bicistronic vector pET28a-baPrs-hdNadV was deposited at Addgene under the ID #91950.

    Article Title: Divergent evolutionary histories of DNA markers in a Hawaiian population of the coral Montipora capitata
    Article Snippet: Ten colonies from each set were picked, plasmids were purified, and inserts were Sanger-sequenced using the vector-specific primers SP6 and T7. .. For this region, we used a 3 min, 98 °C denature step, followed by 35 cycles of 98 °C 30 s, 55 °C 30 s, 72 °C 30 s, and finished with a 5 min 72 °C extension, using the NEBNext High-Fidelity 2X Master Mix.

    Article Title: Novel oncolytic chimeric orthopoxvirus causes regression of pancreatic cancer xenografts and exhibits abscopal effect at a single low dose
    Article Snippet: .. Generation of recombinant chimeric orthopoxvirus expressing firefly luciferase To construct thymidine kinase (TK) shuttle vector, the left and right flanking sequences of the TK gene were PCR-amplified from CF33 genomic DNA using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGCATATGATCTATGGATTACCATG GATGACAACTC-3′ and 5′-CGTTTAACTCGTCTAATTAATTCTGTAC-3′ (left flank), 5′-CAGGTAAAAGTACA GAATTAATTAGACGAGTTAAACGAGC CGTCGACGGATCCGCTAGCGGCCGCGGAGG TAATGATATGTATCAATCGGTGTGTAG-3′ and 5′-GCGGAATTCGTAATTACTTAGTA AATCCGCCGTACTAGG-3′ (right flank). ..

    Article Title: Novel oncolytic chimeric orthopoxvirus causes regression of pancreatic cancer xenografts and exhibits abscopal effect at a single low dose
    Article Snippet: .. The Emerald expression cassette with the VACV H5 early/late promoter was PCR-amplified from the plasmid Emerald-pBAD (Addgene, Cambridge, MA) using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGAAGCTTGAGCTCAAAAATTGAAAATAAATACAAAGGTTCTTGAGG GTTGTGTTAAATTGAAAGCGAGAAATAATCATAAATAGTCGACCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACC-3′ and 5′-GCGGGATCCATAAAAATT AATTAATCAGTACAGCTCGTCCATGCCGAGAGTGATC-3′. .. The PCR fragment was digested with Sac I and Bam HI and cloned into plasmid p33NC-TK to yield p33NCTK-H5-Emerald.

    Article Title: In Vitro and In Vivo Inhibition of the Infectivity of Human Enterovirus 71 by a Sulfonated Food Azo Dye, Brilliant Black BN
    Article Snippet: The GFP gene from the pLVX-IRES-ZsGreen1 vector (Clontech) with an EV71 protease 2A recognition sequence AITTL at the 3′ end was amplified with primers GFP-F and GFP-R ( ). .. All PCR was performed using Q5 high-fidelity 2× master mix (New England Biolabs), and PCR products were extracted using the QIAquick gel extraction kit (Qiagen) after DNA gel electrophoresis.

    Article Title: The regulatory control of Cebpa enhancers and silencers in the myeloid and red-blood cell lineages
    Article Snippet: Construct design and cloning using Gibson assembly Putative CRMs were cloned into a pGL4.10luc2 Luciferase reporter vector (Promega, E6651). .. Each CRM or promoter insert was amplified from genomic DNA of C57BL/6J mice using Q5 High-Fidelity 2X Master Mix (NEB, M0492L) following the manufacturer’s instructions.

    Article Title: Molecular Characterization of Divergent Closterovirus Isolates Infecting Ribes Species
    Article Snippet: Missing sequence segments were obtained by PCR amplification using the Q5 High-Fidelity Master Mix (NEB, Ipswich, MA, USA). .. Sequence verification and gap-filling were done through Sanger sequencing of PCR amplicons or cloned into a pGEM T-Easy vector system (Promega, Road Madison, WI, USA).


    Article Title: Proteasomal degradation of NOD2 by NLRP12 in monocytes promotes bacterial tolerance and colonization by enteropathogens
    Article Snippet: 75 ng of cDNAs were amplified using Q5 High-Fidelity 2X Master Mix (New England BioLabs). .. Sequences were analyzed with SeqScape software (Applied Biosystems).

    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli
    Article Snippet: Three such plasmids, carrying expression DNA corresponding to each of the amino acid sequences compared in Fig. were produced as follows: Nampt-PET28a vector containing Nampt gene from Mus musculus strain C57BL/6 J, a gift from dr. Cynthia Wolberger (Addgene plasmid # 25630), was cloned in E . coli DH5α and maintained (as a glycerol stock) at −80 °C. pET28a-hdNadV and pET28a-soNadV plasmids carrying the nucleotide sequence corresponding to nadV gene from Haemophilus ducreyi (strain: ATCC 27722), respectively Shewanella oneidensis (strain: MR-1) were constructed as follows: The gene sequences were selected from the GenBank database (Gene ID: 2716561 respectively 1169740), optimized for expression in E . coli (using Genome Compiler software v. 2.2.55 (Genome Compiler Corporation 2015), considering the frequency of codon usage and GC content, eliminating unwanted restriction sequences), synthesized de novo (GenScript) and ligated into pET-28a(+) vector which was first double digested with NcoI and XhoI restriction enzymes. .. For the simultaneous expression of Nampt and PRPP synthetase a bicistronic vector was constructed by PCR amplifying the baPrs sequence (Q5 High-Fidelity 2X Master Mix, NEB) from pUC57-Kan plasmid with M13 forward and reverse primers, double digestion with XbaI and NcoI restriction enzymes (NEB) of PCR product and pET28a-hdNAdV plasmid, followed by the separation of the desired DNA fragments on 1.5% agarose gel electrophoresis , purification from gel (using Wizard SV Gel and PCR Clean-Up System, Promega, Madison, USA) of desired bands (pET28a-hdNadV and baPrs) followed by ligation with T4 DNA ligase (NEB) (as shown in Fig. ).

    RNA Extraction:

    Article Title: Proteasomal degradation of NOD2 by NLRP12 in monocytes promotes bacterial tolerance and colonization by enteropathogens
    Article Snippet: RNA extraction from PBMCs was performed using the RNeasy Mini Kit (Qiagen) including DNase treatment according to the manufacturer’s instructions. .. 75 ng of cDNAs were amplified using Q5 High-Fidelity 2X Master Mix (New England BioLabs).

    Positron Emission Tomography:

    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli
    Article Snippet: Three such plasmids, carrying expression DNA corresponding to each of the amino acid sequences compared in Fig. were produced as follows: Nampt-PET28a vector containing Nampt gene from Mus musculus strain C57BL/6 J, a gift from dr. Cynthia Wolberger (Addgene plasmid # 25630), was cloned in E . coli DH5α and maintained (as a glycerol stock) at −80 °C. pET28a-hdNadV and pET28a-soNadV plasmids carrying the nucleotide sequence corresponding to nadV gene from Haemophilus ducreyi (strain: ATCC 27722), respectively Shewanella oneidensis (strain: MR-1) were constructed as follows: The gene sequences were selected from the GenBank database (Gene ID: 2716561 respectively 1169740), optimized for expression in E . coli (using Genome Compiler software v. 2.2.55 (Genome Compiler Corporation 2015), considering the frequency of codon usage and GC content, eliminating unwanted restriction sequences), synthesized de novo (GenScript) and ligated into pET-28a(+) vector which was first double digested with NcoI and XhoI restriction enzymes. .. For the simultaneous expression of Nampt and PRPP synthetase a bicistronic vector was constructed by PCR amplifying the baPrs sequence (Q5 High-Fidelity 2X Master Mix, NEB) from pUC57-Kan plasmid with M13 forward and reverse primers, double digestion with XbaI and NcoI restriction enzymes (NEB) of PCR product and pET28a-hdNAdV plasmid, followed by the separation of the desired DNA fragments on 1.5% agarose gel electrophoresis , purification from gel (using Wizard SV Gel and PCR Clean-Up System, Promega, Madison, USA) of desired bands (pET28a-hdNadV and baPrs) followed by ligation with T4 DNA ligase (NEB) (as shown in Fig. ).

    Ribosomal Intergenic Spacer Analysis:

    Article Title: Microplastics Reduce Short-Term Effects of Environmental Contaminants. Part II: Polyethylene Particles Decrease the Effect of Polycyclic Aromatic Hydrocarbons on Microorganisms
    Article Snippet: Automated Ribosomal Intergenic Spacer Analysis (ARISA) was performed by PCR amplification of the bacterial internal transcribed spacer (ITS) gene region. .. For PCR amplification, the Q5® High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA) was used in 50 µL volumes with 20 ng of DNA per reaction.


    Article Title: Microplastics Reduce Short-Term Effects of Environmental Contaminants. Part II: Polyethylene Particles Decrease the Effect of Polycyclic Aromatic Hydrocarbons on Microorganisms
    Article Snippet: The DNA yield was measured with a NanoDropTM Spectrophotometer ND-1000 (Thermo Fisher Scientific, Waltham, MA, USA). .. For PCR amplification, the Q5® High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA) was used in 50 µL volumes with 20 ng of DNA per reaction.


    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli
    Article Snippet: Three such plasmids, carrying expression DNA corresponding to each of the amino acid sequences compared in Fig. were produced as follows: Nampt-PET28a vector containing Nampt gene from Mus musculus strain C57BL/6 J, a gift from dr. Cynthia Wolberger (Addgene plasmid # 25630), was cloned in E . coli DH5α and maintained (as a glycerol stock) at −80 °C. pET28a-hdNadV and pET28a-soNadV plasmids carrying the nucleotide sequence corresponding to nadV gene from Haemophilus ducreyi (strain: ATCC 27722), respectively Shewanella oneidensis (strain: MR-1) were constructed as follows: The gene sequences were selected from the GenBank database (Gene ID: 2716561 respectively 1169740), optimized for expression in E . coli (using Genome Compiler software v. 2.2.55 (Genome Compiler Corporation 2015), considering the frequency of codon usage and GC content, eliminating unwanted restriction sequences), synthesized de novo (GenScript) and ligated into pET-28a(+) vector which was first double digested with NcoI and XhoI restriction enzymes. .. For the simultaneous expression of Nampt and PRPP synthetase a bicistronic vector was constructed by PCR amplifying the baPrs sequence (Q5 High-Fidelity 2X Master Mix, NEB) from pUC57-Kan plasmid with M13 forward and reverse primers, double digestion with XbaI and NcoI restriction enzymes (NEB) of PCR product and pET28a-hdNAdV plasmid, followed by the separation of the desired DNA fragments on 1.5% agarose gel electrophoresis , purification from gel (using Wizard SV Gel and PCR Clean-Up System, Promega, Madison, USA) of desired bands (pET28a-hdNadV and baPrs) followed by ligation with T4 DNA ligase (NEB) (as shown in Fig. ).

    Concentration Assay:

    Article Title: Microplastics Reduce Short-Term Effects of Environmental Contaminants. Part II: Polyethylene Particles Decrease the Effect of Polycyclic Aromatic Hydrocarbons on Microorganisms
    Article Snippet: The primers S-D-Bact-1522-b-S-20 labelled at the 5’ end with the FAM fluorochrome and L-D-Bact-132-a-A-18 (Eurofins Genomics, Ebersberg, Germany). described by Ranjard et al. [ ] were used in a final concentration of 500 nM. .. For PCR amplification, the Q5® High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA) was used in 50 µL volumes with 20 ng of DNA per reaction.

    BAC Assay:

    Article Title: The microbiome composition of Aedes aegypti is not critical for Wolbachia-mediated inhibition of dengue virus
    Article Snippet: .. Samples were amplified (25 cycles) using Q5 HotStart 2X Master Mix (New England BioLabs) with a primer pair for the V3 and V4 regions of bacterial small subunit (SSU) ribosomal gene (16s) (Australian Centre for Ecogenomics primer pair Bac_SSU_341F-806wR: 341F CCTACGGGNGGCWGCAG; 806R GACTACHVGGGTATCTAATCC). ..


    Article Title: Grazing livestock are exposed to terrestrial cyanobacteria
    Article Snippet: Before bead beating, samples were heated at 65 °C for 10 min to increase cell lysis. .. All PCR steps used the Q5 High-Fidelity 2X Master Mix (New England Biolabs).

    Article Title: Microplastics Reduce Short-Term Effects of Environmental Contaminants. Part II: Polyethylene Particles Decrease the Effect of Polycyclic Aromatic Hydrocarbons on Microorganisms
    Article Snippet: To achieve better cell lysis, samples were incubated at 70 °C for 10 min at 350 rpm (Eppendorf Thermomixer Comfort, Hamburg, Germany). .. For PCR amplification, the Q5® High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA) was used in 50 µL volumes with 20 ng of DNA per reaction.


    Article Title: Novel oncolytic chimeric orthopoxvirus causes regression of pancreatic cancer xenografts and exhibits abscopal effect at a single low dose
    Article Snippet: Generation of recombinant chimeric orthopoxvirus expressing firefly luciferase To construct thymidine kinase (TK) shuttle vector, the left and right flanking sequences of the TK gene were PCR-amplified from CF33 genomic DNA using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGCATATGATCTATGGATTACCATG GATGACAACTC-3′ and 5′-CGTTTAACTCGTCTAATTAATTCTGTAC-3′ (left flank), 5′-CAGGTAAAAGTACA GAATTAATTAGACGAGTTAAACGAGC CGTCGACGGATCCGCTAGCGGCCGCGGAGG TAATGATATGTATCAATCGGTGTGTAG-3′ and 5′-GCGGAATTCGTAATTACTTAGTA AATCCGCCGTACTAGG-3′ (right flank). .. The flanking sequences of TK in the shuttle vector were confirmed by sequencing. p33NC-TK contains the left and right flanking sequences of TK separated by Sac I, Sal I, BamH I, Nhe I and Not I, and Escherichia coli guanine phosphoribosyltransferase (gpt) gene driven by the VACV early promoter p7.5E as a transient dominant selectable marker.

    Article Title: Novel oncolytic chimeric orthopoxvirus causes regression of pancreatic cancer xenografts and exhibits abscopal effect at a single low dose
    Article Snippet: The flanking sequences of TK in the shuttle vector were confirmed by sequencing. p33NC-TK contains the left and right flanking sequences of TK separated by Sac I, Sal I, BamH I, Nhe I and Not I, and Escherichia coli guanine phosphoribosyltransferase (gpt) gene driven by the VACV early promoter p7.5E as a transient dominant selectable marker. .. The Emerald expression cassette with the VACV H5 early/late promoter was PCR-amplified from the plasmid Emerald-pBAD (Addgene, Cambridge, MA) using Q5 High-Fidelity 2X Master Mix (New England Biolabs Inc., Ipswich, MA) and the primers: 5′-GCGAAGCTTGAGCTCAAAAATTGAAAATAAATACAAAGGTTCTTGAGG GTTGTGTTAAATTGAAAGCGAGAAATAATCATAAATAGTCGACCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACC-3′ and 5′-GCGGGATCCATAAAAATT AATTAATCAGTACAGCTCGTCCATGCCGAGAGTGATC-3′.


    Article Title: PCR-based detection of composite transposons and translocatable units from oral metagenomic DNA
    Article Snippet: Q5 PCR reaction consisted of 12.5 μL Q5 high-fidelity 2X master mix (NEB, Hitchin, UK), 0.2 μM of each primer, 50–100 ng of DNA template and molecular grade water up to a total of 25 μL. .. PCR amplicons were visualized by gel electrophoresis on 1% agarose gel stained with GelRed nucleic acid stain (Biotium, Cambridge, UK).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs q5 high fidelity dna polymerase master mix
    Q5 High Fidelity Dna Polymerase Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 high fidelity dna polymerase master mix/product/New England Biolabs
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    q5 high fidelity dna polymerase master mix - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    New England Biolabs q5 hot start high fidelity 2x master mix
    Q5 Hot Start High Fidelity 2x Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 104 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 hot start high fidelity 2x master mix/product/New England Biolabs
    Average 99 stars, based on 104 article reviews
    Price from $9.99 to $1999.99
    q5 hot start high fidelity 2x master mix - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results