Structured Review

Thermo Fisher puc19
The effect of histone H1 on DNA-end joining cannot be attributed to H1-induced DNA aggregation. Products of DNA-end joining reactions, carried out as described under ‘Materials and methods’ section in the presence of purified DNA Ligase IIIβ and histone H1.2, were analyzed for possible aggregation by gel filtration (Sephacryl S-1000 SF in HR 10/30, void volume 9.7 ml). ( A, B ) Calibration of the column with <t>pUC19</t> fragments, pSP65 and λ DNA. (A) shows a typical chromatogram, whereas (B) the DNA fragments found in the different fractions by agarose gel electrophoresis. The DNA mixture contained 0.45 µg λ DNA, 1 µg linearized pSP65 (3005 bp), 0.72 µg 943 bp and 0.4 µg 322 bp DNA fragments. High molecular weight λ DNA is found in early fractions 14–16, pSP65 substrate size DNA in fractions 14–26, and low molecular weight DNA in fractions 22–34, validating thus the separation potential of the column. ( C, D, E ) Analysis by gel filtration of substrate and products of DNA-end-joining reactions assembled with 20 ng DNA Ligase III and the indicated amounts of histone H1. Gel filtration was carried out in a buffer containing 80 mM NaCl. ( F, G, H ) Reactions similar to those shown in C, D and E were analyzed by gel filtration in a buffer containing 600 mM NaCl. Other reaction details as in Figure 2 C.
Puc19, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 111 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/puc19/product/Thermo Fisher
Average 95 stars, based on 111 article reviews
Price from $9.99 to $1999.99
puc19 - by Bioz Stars, 2020-02
95/100 stars

Images

1) Product Images from "Histone H1 functions as a stimulatory factor in backup pathways of NHEJ"

Article Title: Histone H1 functions as a stimulatory factor in backup pathways of NHEJ

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkn013

The effect of histone H1 on DNA-end joining cannot be attributed to H1-induced DNA aggregation. Products of DNA-end joining reactions, carried out as described under ‘Materials and methods’ section in the presence of purified DNA Ligase IIIβ and histone H1.2, were analyzed for possible aggregation by gel filtration (Sephacryl S-1000 SF in HR 10/30, void volume 9.7 ml). ( A, B ) Calibration of the column with pUC19 fragments, pSP65 and λ DNA. (A) shows a typical chromatogram, whereas (B) the DNA fragments found in the different fractions by agarose gel electrophoresis. The DNA mixture contained 0.45 µg λ DNA, 1 µg linearized pSP65 (3005 bp), 0.72 µg 943 bp and 0.4 µg 322 bp DNA fragments. High molecular weight λ DNA is found in early fractions 14–16, pSP65 substrate size DNA in fractions 14–26, and low molecular weight DNA in fractions 22–34, validating thus the separation potential of the column. ( C, D, E ) Analysis by gel filtration of substrate and products of DNA-end-joining reactions assembled with 20 ng DNA Ligase III and the indicated amounts of histone H1. Gel filtration was carried out in a buffer containing 80 mM NaCl. ( F, G, H ) Reactions similar to those shown in C, D and E were analyzed by gel filtration in a buffer containing 600 mM NaCl. Other reaction details as in Figure 2 C.
Figure Legend Snippet: The effect of histone H1 on DNA-end joining cannot be attributed to H1-induced DNA aggregation. Products of DNA-end joining reactions, carried out as described under ‘Materials and methods’ section in the presence of purified DNA Ligase IIIβ and histone H1.2, were analyzed for possible aggregation by gel filtration (Sephacryl S-1000 SF in HR 10/30, void volume 9.7 ml). ( A, B ) Calibration of the column with pUC19 fragments, pSP65 and λ DNA. (A) shows a typical chromatogram, whereas (B) the DNA fragments found in the different fractions by agarose gel electrophoresis. The DNA mixture contained 0.45 µg λ DNA, 1 µg linearized pSP65 (3005 bp), 0.72 µg 943 bp and 0.4 µg 322 bp DNA fragments. High molecular weight λ DNA is found in early fractions 14–16, pSP65 substrate size DNA in fractions 14–26, and low molecular weight DNA in fractions 22–34, validating thus the separation potential of the column. ( C, D, E ) Analysis by gel filtration of substrate and products of DNA-end-joining reactions assembled with 20 ng DNA Ligase III and the indicated amounts of histone H1. Gel filtration was carried out in a buffer containing 80 mM NaCl. ( F, G, H ) Reactions similar to those shown in C, D and E were analyzed by gel filtration in a buffer containing 600 mM NaCl. Other reaction details as in Figure 2 C.

Techniques Used: Purification, Filtration, Agarose Gel Electrophoresis, Molecular Weight

The effect of histone H1 on DNA-end joining depends upon the amount and the length of the DNA substrate. ( A ) Titration of the effect of histone H1 on DNA-end joining for reactions assembled with 10 ng DNA Ligase IIIβ and different amounts of Sal I digested substrate DNA as indicated. Other conditions as in Figure 2 C. ( B ) DNA-end joining in reactions assembled with 20 ng DNA Ligase IIIβ and 30 ng substrate DNA of different lengths as indicated. DNA fragments of 497 and 943 bp were prepared by digesting pUC19 with Alw44I . Other conditions as in Figure 2 C. Alw44I recognizes the sequence 5′-G|TGCAC-3′ and generates ends with 3′ 4-bp extensions. ( C ) The choice of solvent modulates the activity of H1.2 in DNA-end joining. The experiments described earlier were carried out with H1.2 dissolved in reaction buffer (see ‘Materials and methods’). Titration of end-joining reactions with H1.2 dissolved in water or reaction buffer and tested in the presence of 10 ng DNA Ligase IIIβ. Other details as in Figure 2 C. Note the shift in the maximum of DNA-end joining from 80 to 20 ng.
Figure Legend Snippet: The effect of histone H1 on DNA-end joining depends upon the amount and the length of the DNA substrate. ( A ) Titration of the effect of histone H1 on DNA-end joining for reactions assembled with 10 ng DNA Ligase IIIβ and different amounts of Sal I digested substrate DNA as indicated. Other conditions as in Figure 2 C. ( B ) DNA-end joining in reactions assembled with 20 ng DNA Ligase IIIβ and 30 ng substrate DNA of different lengths as indicated. DNA fragments of 497 and 943 bp were prepared by digesting pUC19 with Alw44I . Other conditions as in Figure 2 C. Alw44I recognizes the sequence 5′-G|TGCAC-3′ and generates ends with 3′ 4-bp extensions. ( C ) The choice of solvent modulates the activity of H1.2 in DNA-end joining. The experiments described earlier were carried out with H1.2 dissolved in reaction buffer (see ‘Materials and methods’). Titration of end-joining reactions with H1.2 dissolved in water or reaction buffer and tested in the presence of 10 ng DNA Ligase IIIβ. Other details as in Figure 2 C. Note the shift in the maximum of DNA-end joining from 80 to 20 ng.

Techniques Used: Titration, Sequencing, Activity Assay

2) Product Images from "Novel Type of Hepatitis B Virus Mutation: Replacement Mutation Involving a Hepatocyte Nuclear Factor 1 Binding Site Tandem Repeat in Chronic Hepatitis B Virus Genotype E"

Article Title: Novel Type of Hepatitis B Virus Mutation: Replacement Mutation Involving a Hepatocyte Nuclear Factor 1 Binding Site Tandem Repeat in Chronic Hepatitis B Virus Genotype E

Journal: Journal of Virology

doi: 10.1128/JVI.79.22.14404-14410.2005

Intracellular localization of HBcAg (magnification, ×400). Immunofluorescence staining of HBcAg in HuH-7 cells transfected with (a) pUC19-HBV/E wild-type replicon and (c) pUC19-HBV/E replacement replicon. (b and d) Nuclear staining for the same
Figure Legend Snippet: Intracellular localization of HBcAg (magnification, ×400). Immunofluorescence staining of HBcAg in HuH-7 cells transfected with (a) pUC19-HBV/E wild-type replicon and (c) pUC19-HBV/E replacement replicon. (b and d) Nuclear staining for the same

Techniques Used: Immunofluorescence, Staining, Transfection

(A) Southern blot analysis of intracellular replication competence of replacement mutation with HNF1 site. Double-stranded (DS) DNA and single-stranded (SS) DNA are indicated by arrows. The pUC19-HBV/E replacement replicon (lane 2) replicates at a much
Figure Legend Snippet: (A) Southern blot analysis of intracellular replication competence of replacement mutation with HNF1 site. Double-stranded (DS) DNA and single-stranded (SS) DNA are indicated by arrows. The pUC19-HBV/E replacement replicon (lane 2) replicates at a much

Techniques Used: Southern Blot, Mutagenesis

3) Product Images from "A simple and efficient method to visualize and quantify the efficiency of chromosomal mutations from genome editing"

Article Title: A simple and efficient method to visualize and quantify the efficiency of chromosomal mutations from genome editing

Journal: Scientific Reports

doi: 10.1038/srep35488

A construct containing mCherry and GFP coding regions separated by an in frame linker sequence allows the expression of a fusion protein in which the mCherry and GFP moieties fluoresce independently in bacteria. Top panel: Schematic representation of a plasmid construct for in-frame expression of mCherry and GFP (pmCherry-GFP). A sequence derived from pUC19 that contains multi-cloning sites (MCS) was inserted in between the mCherry and GFP coding regions under the control of the promoter of the bacterial lac operon (Plac). The inserted MCS sequence allows in frame translation of both mCherry and GFP separated by a linker peptide encoded by the MCS as shown. Bottom panel: When transfected into bacteria, pmCherry-GFP allows the expression of a fusion protein with both the mCherry and GFP moieties functioning independently. Bacteria were transformed with empty vector pUC19 (a), constructs expressing only mCherry (b) or GFP (c), or pmCherry-GFP (d), respectively. The transformed bacteria were plated and imaged in the bright field ( A ), or under a fluorescent microscope for red fluorescence ( B ) and green fluorescence ( C ), respectively. Red and green fluorescent imagines were merged in ( D ). Note that when transformed with pmCherry-GFP, both mCherry and GFP were functional, leading to a merged yellow image.
Figure Legend Snippet: A construct containing mCherry and GFP coding regions separated by an in frame linker sequence allows the expression of a fusion protein in which the mCherry and GFP moieties fluoresce independently in bacteria. Top panel: Schematic representation of a plasmid construct for in-frame expression of mCherry and GFP (pmCherry-GFP). A sequence derived from pUC19 that contains multi-cloning sites (MCS) was inserted in between the mCherry and GFP coding regions under the control of the promoter of the bacterial lac operon (Plac). The inserted MCS sequence allows in frame translation of both mCherry and GFP separated by a linker peptide encoded by the MCS as shown. Bottom panel: When transfected into bacteria, pmCherry-GFP allows the expression of a fusion protein with both the mCherry and GFP moieties functioning independently. Bacteria were transformed with empty vector pUC19 (a), constructs expressing only mCherry (b) or GFP (c), or pmCherry-GFP (d), respectively. The transformed bacteria were plated and imaged in the bright field ( A ), or under a fluorescent microscope for red fluorescence ( B ) and green fluorescence ( C ), respectively. Red and green fluorescent imagines were merged in ( D ). Note that when transformed with pmCherry-GFP, both mCherry and GFP were functional, leading to a merged yellow image.

Techniques Used: Construct, Sequencing, Expressing, Plasmid Preparation, Derivative Assay, Clone Assay, Transfection, Transformation Assay, Microscopy, Fluorescence, Functional Assay

4) Product Images from "The Frog Prince: a reconstructed transposon from Rana pipiens with high transpositional activity in vertebrate cells"

Article Title: The Frog Prince: a reconstructed transposon from Rana pipiens with high transpositional activity in vertebrate cells

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkg910

Frog Prince -mediated cut-and-paste transposition into human chromosomes. ( A ) Excision. On top, a schematic of the FP -neo element is shown. IRs are represented by black arrows, the SV40 promoter and the neomycin-resistance marker gene ( neo ) are indicated. pUC19 vector backbone sequences that flank the element in the donor construct are shown in italics. The transposon footprints are depicted in the white box. ( B ) Integration. Three regions of human genomic sequences that served as target sites for the transposase are illustrated below. Flanking TA target site duplications are typed in bold.
Figure Legend Snippet: Frog Prince -mediated cut-and-paste transposition into human chromosomes. ( A ) Excision. On top, a schematic of the FP -neo element is shown. IRs are represented by black arrows, the SV40 promoter and the neomycin-resistance marker gene ( neo ) are indicated. pUC19 vector backbone sequences that flank the element in the donor construct are shown in italics. The transposon footprints are depicted in the white box. ( B ) Integration. Three regions of human genomic sequences that served as target sites for the transposase are illustrated below. Flanking TA target site duplications are typed in bold.

Techniques Used: Marker, Plasmid Preparation, Construct, Genomic Sequencing

5) Product Images from "Engineering of a Single-Chain Variable-Fragment (scFv) Antibody Specific for the Stolbur Phytoplasma (Mollicute) and Its Expression in Escherichia coli and Tobacco Plants"

Article Title: Engineering of a Single-Chain Variable-Fragment (scFv) Antibody Specific for the Stolbur Phytoplasma (Mollicute) and Its Expression in Escherichia coli and Tobacco Plants

Journal: Applied and Environmental Microbiology

doi:

(A) Plasmid pUC19::scFv-Secr[2A10] used for expression of the scFv in E. coli . (B) Plasmid 35-pel-scFv[2A10] used to transform tobacco plants with A. tumefaciens . NOS terminator, nopaline synthase transcription terminator; Npt II, neomycin phosphotransferase II gene.
Figure Legend Snippet: (A) Plasmid pUC19::scFv-Secr[2A10] used for expression of the scFv in E. coli . (B) Plasmid 35-pel-scFv[2A10] used to transform tobacco plants with A. tumefaciens . NOS terminator, nopaline synthase transcription terminator; Npt II, neomycin phosphotransferase II gene.

Techniques Used: Plasmid Preparation, Expressing

Western blot analysis with antibody 9E10 of the periplasmic (lanes 1 through 3) and total (lanes 4 through 6) proteins of nontransformed E. coli cells (lanes 1 and 6), E. coli cells transformed with pINV::scFv-Secr[2A10] (lanes 2 and 5), and E. coli cells transformed with pUC19::scFv-Secr[2A10] (lanes 3 and 4). M, Rainbow protein molecular mass marker (Amersham).
Figure Legend Snippet: Western blot analysis with antibody 9E10 of the periplasmic (lanes 1 through 3) and total (lanes 4 through 6) proteins of nontransformed E. coli cells (lanes 1 and 6), E. coli cells transformed with pINV::scFv-Secr[2A10] (lanes 2 and 5), and E. coli cells transformed with pUC19::scFv-Secr[2A10] (lanes 3 and 4). M, Rainbow protein molecular mass marker (Amersham).

Techniques Used: Western Blot, Transformation Assay, Marker

6) Product Images from "Intrinsic Curvature in the VP1 Gene of SV40: Comparison of Solution and Gel Results"

Article Title: Intrinsic Curvature in the VP1 Gene of SV40: Comparison of Solution and Gel Results

Journal: Biophysical Journal

doi: 10.1529/biophysj.104.039834

Schematic diagram of the 199-bp fragment, constructs with inserts at various positions, control fragments with sequences offset from the apparent bend center, and a 345-bp fragment with 75 bp of unbent DNA from pUC19 replacing 70 bp containing the curvature
Figure Legend Snippet: Schematic diagram of the 199-bp fragment, constructs with inserts at various positions, control fragments with sequences offset from the apparent bend center, and a 345-bp fragment with 75 bp of unbent DNA from pUC19 replacing 70 bp containing the curvature

Techniques Used: Construct

7) Product Images from "A One-Step Miniprep for the Isolation of Plasmid DNA and Lambda Phage Particles"

Article Title: A One-Step Miniprep for the Isolation of Plasmid DNA and Lambda Phage Particles

Journal: PLoS ONE

doi: 10.1371/journal.pone.0023457

Elevated temperatures and osmolytes increase the efficiency of plasmid DNA extraction by NIDs. Extractions of either pUC19 (lanes 1–8 and 10–15) or pCYPAC3 plasmids (lane 9) were carried out. Transformed DH5α cells were grown in 1.5 ml LB cultures and resuspended in 150 µl 50 mM Tris pH 8, 10 mM EDTA with or without co-solutes. 500 µg/ml lysozyme was also added, and the cells were incubated as specified below. Salt concentrations were adjusted to 0.5 M NaCl in all extracts, except the ones loaded in lanes 10 and 12–15. Extracts were cleared by centrifugation, and precipitated with 150 µl isopropanol. DNA pellets were dissolved in 40 µl TE buffer, 40 µg/ml RNase A. 10 µl aliquots of the solutions containing either the pCYPAC3 (lane 9) or pUC19 plasmids (all other lanes) were loaded on the gel. Exposure times and temperatures of extraction are shown above the lanes. For lanes 1–9, extraction with the indicated NID was done in the absence of co-solutes. For lanes 10–15, the included co-solute is indicated. Lane 1: 0.5% IGEPAL CA-630. Lane 2: 0.5% TX-100. Lane 3: 0.5% IGEPAL CA-720. Lane 4: 0.5% Tween-80. Lane 5: 0.5% Tween-20. Lane 6: 2% IGEPAL CA-720. Lane 7: 4% IGEPAL CA-720. Lane 8: 0.5% Tween 80. Lane 9: 0.5% Tween 80. Lane 10: 0.5% Tween 20/0.5 M KCl. Lane 11: 0.5% Tween 20/22.5% sucrose. Lane 12: 0.5% IGEPAL CA-630/0.5 M NH 4 Cl. Lane 13: 0.5% TX-100/0.5 M NH 4 Cl. Lane 14: 0.5% TX-100/0.5 M NaCl. Lane 15: 0.5% TX-100/0.5 M NaAc.
Figure Legend Snippet: Elevated temperatures and osmolytes increase the efficiency of plasmid DNA extraction by NIDs. Extractions of either pUC19 (lanes 1–8 and 10–15) or pCYPAC3 plasmids (lane 9) were carried out. Transformed DH5α cells were grown in 1.5 ml LB cultures and resuspended in 150 µl 50 mM Tris pH 8, 10 mM EDTA with or without co-solutes. 500 µg/ml lysozyme was also added, and the cells were incubated as specified below. Salt concentrations were adjusted to 0.5 M NaCl in all extracts, except the ones loaded in lanes 10 and 12–15. Extracts were cleared by centrifugation, and precipitated with 150 µl isopropanol. DNA pellets were dissolved in 40 µl TE buffer, 40 µg/ml RNase A. 10 µl aliquots of the solutions containing either the pCYPAC3 (lane 9) or pUC19 plasmids (all other lanes) were loaded on the gel. Exposure times and temperatures of extraction are shown above the lanes. For lanes 1–9, extraction with the indicated NID was done in the absence of co-solutes. For lanes 10–15, the included co-solute is indicated. Lane 1: 0.5% IGEPAL CA-630. Lane 2: 0.5% TX-100. Lane 3: 0.5% IGEPAL CA-720. Lane 4: 0.5% Tween-80. Lane 5: 0.5% Tween-20. Lane 6: 2% IGEPAL CA-720. Lane 7: 4% IGEPAL CA-720. Lane 8: 0.5% Tween 80. Lane 9: 0.5% Tween 80. Lane 10: 0.5% Tween 20/0.5 M KCl. Lane 11: 0.5% Tween 20/22.5% sucrose. Lane 12: 0.5% IGEPAL CA-630/0.5 M NH 4 Cl. Lane 13: 0.5% TX-100/0.5 M NH 4 Cl. Lane 14: 0.5% TX-100/0.5 M NaCl. Lane 15: 0.5% TX-100/0.5 M NaAc.

Techniques Used: Plasmid Preparation, DNA Extraction, Transformation Assay, Incubation, Centrifugation

Related Articles

Clone Assay:

Article Title: Engineering of a Single-Chain Variable-Fragment (scFv) Antibody Specific for the Stolbur Phytoplasma (Mollicute) and Its Expression in Escherichia coli and Tobacco Plants
Article Snippet: .. The following E. coli strains and vectors were used: E. coli XL1-Blue and plasmid BluescriptSK+ (pBS; Stratagene, La Jolla, Calif.), for cloning variable heavy (VH) and variable light (VL) sequences, and E. coli JM109 (Promega, Madison, Wis.) and plasmids pUC18 and pUC19 (MBI Fermentas, Vilnius, Lithuania), for scFv expression. .. Plasmid pS8 ( ) was also used for scFv constructions.

Article Title: The basic N-terminal domain of TRF2 limits recombination endonuclease action at human telomeres
Article Snippet: .. The non-replicative telomeric plasmids derived from pUC19 (Fermentas) in which the Geneticin gene (G418) is cloned with or without 700 bp stretch of T2 AG3 or 280 bp stretch of TG1–3 . .. The genes encoding the proteins to be tested were cloned on a plasmid, fused to the Gal4 activation domain.

Article Title: The Frog Prince: a reconstructed transposon from Rana pipiens with high transpositional activity in vertebrate cells
Article Snippet: .. The PCR products were cloned into the HincII site of pUC19 resulting in pE5 containing the left IR, and pV3 containing the right IR, respectively. pE5-neo was constructed by cloning the EcoRI/BamHI fragment of pRc/CMV (Invitrogen) containing an SV40 promoter/enhancer, the neomycin phosphotransferase ( neo ) gene and the SV40 poly-A signal into the MunI site of pE5. .. The EcoRI/HindIII fragment of pE5-neo was subsequently cloned into the HindIII site of pV3 resulting in pTxr-neo.

Article Title: Reducing persistent polyomavirus infection increases functionality of virus-specific memory CD8 T cells
Article Snippet: .. The loxP-containing pUC19-SF was digested with BamHI and EcoRI, ligated with large BamHI-EcoRI fragment of A2 DNA cloned into pUC19, and transfected into NMuMGs with lipofectamine 2000 (Invitrogen). .. Viruses with a single loxP inserted at Bgl I site (A2_Bgl I) or the STIN (A2_STIN), or at both the Bgl I site and STIN (A2-Flx) were harvested by cell lysates of transfected NMuMG cells, and the loxP inserts confirmed by sequencing.

Article Title: Novel Type of Hepatitis B Virus Mutation: Replacement Mutation Involving a Hepatocyte Nuclear Factor 1 Binding Site Tandem Repeat in Chronic Hepatitis B Virus Genotype E
Article Snippet: .. Finally, the fragments C-B-HindIII-AvrII and pGEM-fragA-C, cut with AvrII and SacI, were cloned into pUC19 without promoters (Invitrogen) cut with HindIII and SacI, and a pUC19-HBV/E wild-type replicon encoding a replication-competent 1.35-unit-length HBV genome was produced. .. In addition, the pUC19-HBV/E wild-type replicon was digested by RsrIII and XbaI, the fragment with the replacement mutation from patient 2 (strain UK2), cut with RsrIII and XbalI, was ligated, and a pUC19-HBV/E replacement replicon was produced.

Article Title: Site-Specific Recombination System Encoded by Toluene Catabolic Transposon Tn4651
Article Snippet: .. The DNA fragments cloned on pUC18 and pUC19 were sequenced with an ABI 310 automated DNA sequencer (Applied Biosystems) according to the protocols recommended by the manufacturer. .. The nucleotide sequence reported here has been deposited in the DDBJ-EMBL-GenBank database under accession number .

Article Title: Serial Analysis of rRNA Genes and the Unexpected Dominance of Rare Members of Microbial Communities ▿
Article Snippet: Approximately 600 bp of the bacterial 16S rRNA genes were PCR amplified with the same primers used for SARD profiling (TX9 and 1391R), except that neither primer had a biotin modification and both primers possessed 5′ phosphate groups to facilitate cloning. .. PCR products were ligated nondirectionally into the SmaI site of pUC19 and were transformed into E. coli DH10B cells (Invitrogen, Carlsbad, CA).

Amplification:

Article Title: Membrane-type 1 Matrix Metalloprotease (MT1-MMP) Enables Invasive Migration of Glioma Cells in Central Nervous System White Matter
Article Snippet: The first amplification was performed for 30 cycles at an annealing temperature of 45°C using the oligonucleotide pair CC GTCGAC AAAGGCGCCCCGAGGGA and AA TCTAGA GGTAGGTGAGGCAGAGG with a human placenta cDNA library as template ( Clontech ). .. The resulting 2.5-kb cDNA fragment was reamplified with the oligonucleotides CCG GTCGAC TCGGACCATGTCTC and TT TCTAGA GCGTCAGACCTTGTCC for 40 cycles with annealing at 45°C, resulting in a 1.75-kb cDNA fragment containing the whole open reading frame of MT1-MMP that was blunt end–cloned in pUC19 (Invitrogen).

Article Title: A simple and efficient method to visualize and quantify the efficiency of chromosomal mutations from genome editing
Article Snippet: Construction of plasmids The plasmid expressing a fusion protein of mCherry and GFP (pmCherry-GFP) was constructed from pUC19 (Invitrogen, Waltham, MA, USA) by inserting the mCherry coding sequence between the SalI and HindIII sites of the multi-cloning sites (MCS) of the pUC19 to allow in-frame expression of mCherry and the LacZα gene in pUC19, and then replacing the LacZα coding region with super folding green fluorescent gene (sfGFP, GenBank # HQ873313). .. Briefly, mCherry coding sequences were PCR amplified from plasmid Nanog-2A-mCherry (a gift from Dr. Rudolf Jaenisch (Addgene plasmid # 59995) with primers 5′-cggcgcagaGTCGACttgtacagctcgtccatgcc-3′ (Sal I site capitalized) and 5′-gattacgccAAGCTTgatggtgagcaagggcgaggaggata-3′ (Hind III site capitalized).

Article Title: The Frog Prince: a reconstructed transposon from Rana pipiens with high transpositional activity in vertebrate cells
Article Snippet: Left and right IRs were amplified from R.pipiens genomic DNA using the primer Txr-1R (5′-TACAGTGGTGTGAAAAACTATTTGCCC) specific for the ends of the Txr transposon in X.laevis at GeneBank locus XLRIBSIG, and either Txr-F3 (5′-AAGACTTTGGAGTGGCCTAG) or 5′-GGAACTCTGCCATGCAGGCC, pointing towards the start or the stop codons of the R.pipiens transposase genes, respectively. .. The PCR products were cloned into the HincII site of pUC19 resulting in pE5 containing the left IR, and pV3 containing the right IR, respectively. pE5-neo was constructed by cloning the EcoRI/BamHI fragment of pRc/CMV (Invitrogen) containing an SV40 promoter/enhancer, the neomycin phosphotransferase ( neo ) gene and the SV40 poly-A signal into the MunI site of pE5.

Article Title: Reducing persistent polyomavirus infection increases functionality of virus-specific memory CD8 T cells
Article Snippet: The loxP sequence (ATAACTTCGTATAATGTATGCTATACGAAGTTAT) was inserted in the A2 MuPyV strain genomic DNA at the Bgl I restriction enzyme site and/or in the intronic region shared by LT, MT, and ST (STIN) ( ) by PCR amplification with primer sets (BglI-For, BglI-Rev, STIN-For, and STIN-Rev), as listed in . .. The loxP-containing pUC19-SF was digested with BamHI and EcoRI, ligated with large BamHI-EcoRI fragment of A2 DNA cloned into pUC19, and transfected into NMuMGs with lipofectamine 2000 (Invitrogen).

Article Title: Amylases without known homologues discovered in an acid mine drainage: significance and impact
Article Snippet: PCRs were performed using the iProof DNA polymerase (Biorad) with the following conditions: 35 amplification cycles of 98°C for 10 s, 68°C for 30 s, 72°C for 3 min, followed by a final elongation cycle (72°C for 10 min). .. Amplicons and purified pUC19 were digested with Hin dIII and Xba I primers (Fermentas), ligated and transformed into electrocompetent DH5α cells (Invitrogen).

Article Title: Novel Type of Hepatitis B Virus Mutation: Replacement Mutation Involving a Hepatocyte Nuclear Factor 1 Binding Site Tandem Repeat in Chronic Hepatitis B Virus Genotype E
Article Snippet: To produce fragment C, pGEM-fragA-3 and pGEM-fragB-2 were mixed and amplified with primers E1039F-HindIII and E2168R. .. Finally, the fragments C-B-HindIII-AvrII and pGEM-fragA-C, cut with AvrII and SacI, were cloned into pUC19 without promoters (Invitrogen) cut with HindIII and SacI, and a pUC19-HBV/E wild-type replicon encoding a replication-competent 1.35-unit-length HBV genome was produced.

Article Title: Serial Analysis of rRNA Genes and the Unexpected Dominance of Rare Members of Microbial Communities ▿
Article Snippet: The number of PCR cycles was kept to 20 to 22 cycles to minimize amplification-dependent biases. .. PCR products were ligated nondirectionally into the SmaI site of pUC19 and were transformed into E. coli DH10B cells (Invitrogen, Carlsbad, CA).

Filtration:

Article Title: Histone H1 functions as a stimulatory factor in backup pathways of NHEJ
Article Snippet: Digestion (500 µl) for 1 h of pUC19 (25 µg) with 50 U Alw 44I/Apa LI (MBI Fermentas) generates three fragments (497, 943 and 1246 bp), which were separated in preparative agarose gels after staining with ethidium bromide and collected by electro elution (Biorad, Munique, Germany). .. Typically, 40 ng of the 943-bp fragment were used in 20 µl end-joining reactions (1 h, 25°C) and products of 25 such reactions were pooled and analyzed by gel filtration.

Construct:

Article Title: The basic N-terminal domain of TRF2 limits recombination endonuclease action at human telomeres
Article Snippet: The plasmids pLC3, pLC10, pLC11, pLC16, pK1, pMK3, pMK4, pMK5, pMK6 were constructed by cloning proteins ORF in pESC-W plasmid (StratageneTM ) and leads to the expression of, respectively, TRF2∆B , TRF2∆M , TRF2∆B∆M , TRF2, TRF1 proteins detectable by western blot upon galactose induction. .. The non-replicative telomeric plasmids derived from pUC19 (Fermentas) in which the Geneticin gene (G418) is cloned with or without 700 bp stretch of T2 AG3 or 280 bp stretch of TG1–3 .

Article Title: A simple and efficient method to visualize and quantify the efficiency of chromosomal mutations from genome editing
Article Snippet: .. Construction of plasmids The plasmid expressing a fusion protein of mCherry and GFP (pmCherry-GFP) was constructed from pUC19 (Invitrogen, Waltham, MA, USA) by inserting the mCherry coding sequence between the SalI and HindIII sites of the multi-cloning sites (MCS) of the pUC19 to allow in-frame expression of mCherry and the LacZα gene in pUC19, and then replacing the LacZα coding region with super folding green fluorescent gene (sfGFP, GenBank # HQ873313). .. Briefly, mCherry coding sequences were PCR amplified from plasmid Nanog-2A-mCherry (a gift from Dr. Rudolf Jaenisch (Addgene plasmid # 59995) with primers 5′-cggcgcagaGTCGACttgtacagctcgtccatgcc-3′ (Sal I site capitalized) and 5′-gattacgccAAGCTTgatggtgagcaagggcgaggaggata-3′ (Hind III site capitalized).

Article Title: The Frog Prince: a reconstructed transposon from Rana pipiens with high transpositional activity in vertebrate cells
Article Snippet: .. The PCR products were cloned into the HincII site of pUC19 resulting in pE5 containing the left IR, and pV3 containing the right IR, respectively. pE5-neo was constructed by cloning the EcoRI/BamHI fragment of pRc/CMV (Invitrogen) containing an SV40 promoter/enhancer, the neomycin phosphotransferase ( neo ) gene and the SV40 poly-A signal into the MunI site of pE5. .. The EcoRI/HindIII fragment of pE5-neo was subsequently cloned into the HindIII site of pV3 resulting in pTxr-neo.

Article Title: Novel Type of Hepatitis B Virus Mutation: Replacement Mutation Involving a Hepatocyte Nuclear Factor 1 Binding Site Tandem Repeat in Chronic Hepatitis B Virus Genotype E
Article Snippet: Of these, pGEM-fragA-3 and pGEM-fragB-2, with consensus sequences and without core deletion or replacement mutation (not major clones), were used as templates to construct HBV replicons. .. Finally, the fragments C-B-HindIII-AvrII and pGEM-fragA-C, cut with AvrII and SacI, were cloned into pUC19 without promoters (Invitrogen) cut with HindIII and SacI, and a pUC19-HBV/E wild-type replicon encoding a replication-competent 1.35-unit-length HBV genome was produced.

Adsorption:

Article Title: Intrinsic Curvature in the VP1 Gene of SV40: Comparison of Solution and Gel Results
Article Snippet: To obtain the relatively large quantities of DNA needed for the TEB experiments, SV40 DNA was digested by suitable restriction enzymes and the desired fragments isolated by agarose gel electrophoresis, subcloned into the polylinker of pUC19, transformed into Escherichia coli strain DH5 (Life Technologies) via the heat shock method, plated on Luria broth media containing ampicillin, isopropylthio- d -galactoside and 5-bromo-4-chloro-3-indolyl- β - d -galactoside (X-Gal), and incubated at 37°C overnight, using standard methods ( ). .. The agarose was dissolved with a chaotropic salt (QIAquick gel extraction kit, Qiagen, Valencia, CA), and the DNA was concentrated and desalted by adsorption on small diethylaminoethyl cellulose columns, as described previously ( ).

Electrophoresis:

Article Title: Intrinsic Curvature in the VP1 Gene of SV40: Comparison of Solution and Gel Results
Article Snippet: To obtain the relatively large quantities of DNA needed for the TEB experiments, SV40 DNA was digested by suitable restriction enzymes and the desired fragments isolated by agarose gel electrophoresis, subcloned into the polylinker of pUC19, transformed into Escherichia coli strain DH5 (Life Technologies) via the heat shock method, plated on Luria broth media containing ampicillin, isopropylthio- d -galactoside and 5-bromo-4-chloro-3-indolyl- β - d -galactoside (X-Gal), and incubated at 37°C overnight, using standard methods ( ). .. After suitable restriction enzyme digestion, the desired fragment(s) were isolated by electrophoresis in 1% agarose gels and the desired band(s) excised from the gel.

Nested PCR:

Article Title: Membrane-type 1 Matrix Metalloprotease (MT1-MMP) Enables Invasive Migration of Glioma Cells in Central Nervous System White Matter
Article Snippet: Transfection of 3T3 Cells The cDNA encoding human MT1-MMP (GenBank/EMBL/DDBJ accession number D26512 ) was isolated by nested polymerase chain reaction (PCR). .. The resulting 2.5-kb cDNA fragment was reamplified with the oligonucleotides CCG GTCGAC TCGGACCATGTCTC and TT TCTAGA GCGTCAGACCTTGTCC for 40 cycles with annealing at 45°C, resulting in a 1.75-kb cDNA fragment containing the whole open reading frame of MT1-MMP that was blunt end–cloned in pUC19 (Invitrogen).

Article Title: The Frog Prince: a reconstructed transposon from Rana pipiens with high transpositional activity in vertebrate cells
Article Snippet: The PCR products were cloned into the HincII site of pUC19 resulting in pE5 containing the left IR, and pV3 containing the right IR, respectively. pE5-neo was constructed by cloning the EcoRI/BamHI fragment of pRc/CMV (Invitrogen) containing an SV40 promoter/enhancer, the neomycin phosphotransferase ( neo ) gene and the SV40 poly-A signal into the MunI site of pE5. .. The primers for the nested PCR specific for the transposase gene were Txr-F3 and Txr-C/R.

Article Title: Panhandle PCR for cDNA: A rapid method for isolation of MLL fusion transcripts involving unknown partner genes
Article Snippet: One microliter of the products was used in nested PCR with primers 3 (5′-GGAAAAGAGTGAAGAAGGGAATGTCTCGG-3′) and 4 (5′-GTGGTCATCCCGCCTCAGCCAC-3′) corresponding to MLL bcr cDNA positions 55–83 and 159–179 in exon 5 ( , ). .. PCR-amplified, purified pUC19 (2.5 μl) and 2.5 μl of purified cDNA panhandle PCR products were mixed and added to 50 μl of MAX efficiency DH5α cells (Life Technologies) to recombine in vivo .

Incubation:

Article Title: Histone H1 functions as a stimulatory factor in backup pathways of NHEJ
Article Snippet: Reactions were terminated by adding 2 µl of 0.5% SDS, 2 µl of 0.5 M EDTA and 1 µl of proteinase E (10 mg/ml), then incubated for 1 h at 37°C. .. Digestion (500 µl) for 1 h of pUC19 (25 µg) with 50 U Alw 44I/Apa LI (MBI Fermentas) generates three fragments (497, 943 and 1246 bp), which were separated in preparative agarose gels after staining with ethidium bromide and collected by electro elution (Biorad, Munique, Germany).

Article Title: Intrinsic Curvature in the VP1 Gene of SV40: Comparison of Solution and Gel Results
Article Snippet: .. To obtain the relatively large quantities of DNA needed for the TEB experiments, SV40 DNA was digested by suitable restriction enzymes and the desired fragments isolated by agarose gel electrophoresis, subcloned into the polylinker of pUC19, transformed into Escherichia coli strain DH5 (Life Technologies) via the heat shock method, plated on Luria broth media containing ampicillin, isopropylthio- d -galactoside and 5-bromo-4-chloro-3-indolyl- β - d -galactoside (X-Gal), and incubated at 37°C overnight, using standard methods ( ). .. White colonies were cultured and large-scale plasmid preparations were carried out using methods described previously ( ).

Expressing:

Article Title: Engineering of a Single-Chain Variable-Fragment (scFv) Antibody Specific for the Stolbur Phytoplasma (Mollicute) and Its Expression in Escherichia coli and Tobacco Plants
Article Snippet: .. The following E. coli strains and vectors were used: E. coli XL1-Blue and plasmid BluescriptSK+ (pBS; Stratagene, La Jolla, Calif.), for cloning variable heavy (VH) and variable light (VL) sequences, and E. coli JM109 (Promega, Madison, Wis.) and plasmids pUC18 and pUC19 (MBI Fermentas, Vilnius, Lithuania), for scFv expression. .. Plasmid pS8 ( ) was also used for scFv constructions.

Article Title: The basic N-terminal domain of TRF2 limits recombination endonuclease action at human telomeres
Article Snippet: The plasmids pLC3, pLC10, pLC11, pLC16, pK1, pMK3, pMK4, pMK5, pMK6 were constructed by cloning proteins ORF in pESC-W plasmid (StratageneTM ) and leads to the expression of, respectively, TRF2∆B , TRF2∆M , TRF2∆B∆M , TRF2, TRF1 proteins detectable by western blot upon galactose induction. .. The non-replicative telomeric plasmids derived from pUC19 (Fermentas) in which the Geneticin gene (G418) is cloned with or without 700 bp stretch of T2 AG3 or 280 bp stretch of TG1–3 .

Article Title: A simple and efficient method to visualize and quantify the efficiency of chromosomal mutations from genome editing
Article Snippet: .. Construction of plasmids The plasmid expressing a fusion protein of mCherry and GFP (pmCherry-GFP) was constructed from pUC19 (Invitrogen, Waltham, MA, USA) by inserting the mCherry coding sequence between the SalI and HindIII sites of the multi-cloning sites (MCS) of the pUC19 to allow in-frame expression of mCherry and the LacZα gene in pUC19, and then replacing the LacZα coding region with super folding green fluorescent gene (sfGFP, GenBank # HQ873313). .. Briefly, mCherry coding sequences were PCR amplified from plasmid Nanog-2A-mCherry (a gift from Dr. Rudolf Jaenisch (Addgene plasmid # 59995) with primers 5′-cggcgcagaGTCGACttgtacagctcgtccatgcc-3′ (Sal I site capitalized) and 5′-gattacgccAAGCTTgatggtgagcaagggcgaggaggata-3′ (Hind III site capitalized).

Article Title: Amylases without known homologues discovered in an acid mine drainage: significance and impact
Article Snippet: Amplicons and purified pUC19 were digested with Hin dIII and Xba I primers (Fermentas), ligated and transformed into electrocompetent DH5α cells (Invitrogen). .. The amplicon and the expression vector pET30a+ were digested with Xho I and Nco I for CARN4_1025 and ligated together.

Modification:

Article Title: The basic N-terminal domain of TRF2 limits recombination endonuclease action at human telomeres
Article Snippet: The one hybrid test is performed in humanized cells transformed with the SphI / NotI fragment from the modified pHumaTel plasmid, containing a portion of ADH4 , the full-length HIS3 gene, the URA3 selective marker and a T2 AG3 stretch of 60 bp. .. The non-replicative telomeric plasmids derived from pUC19 (Fermentas) in which the Geneticin gene (G418) is cloned with or without 700 bp stretch of T2 AG3 or 280 bp stretch of TG1–3 .

Western Blot:

Article Title: The basic N-terminal domain of TRF2 limits recombination endonuclease action at human telomeres
Article Snippet: The plasmids pLC3, pLC10, pLC11, pLC16, pK1, pMK3, pMK4, pMK5, pMK6 were constructed by cloning proteins ORF in pESC-W plasmid (StratageneTM ) and leads to the expression of, respectively, TRF2∆B , TRF2∆M , TRF2∆B∆M , TRF2, TRF1 proteins detectable by western blot upon galactose induction. .. The non-replicative telomeric plasmids derived from pUC19 (Fermentas) in which the Geneticin gene (G418) is cloned with or without 700 bp stretch of T2 AG3 or 280 bp stretch of TG1–3 .

Transformation Assay:

Article Title: The basic N-terminal domain of TRF2 limits recombination endonuclease action at human telomeres
Article Snippet: At chromosome VII-L, the HIS3 gene has been used as a reporter gene in the “one-hybrid” system. pRS415 is used to normalized the integration rate to the transformation efficiency. .. The non-replicative telomeric plasmids derived from pUC19 (Fermentas) in which the Geneticin gene (G418) is cloned with or without 700 bp stretch of T2 AG3 or 280 bp stretch of TG1–3 .

Article Title: Intrinsic Curvature in the VP1 Gene of SV40: Comparison of Solution and Gel Results
Article Snippet: .. To obtain the relatively large quantities of DNA needed for the TEB experiments, SV40 DNA was digested by suitable restriction enzymes and the desired fragments isolated by agarose gel electrophoresis, subcloned into the polylinker of pUC19, transformed into Escherichia coli strain DH5 (Life Technologies) via the heat shock method, plated on Luria broth media containing ampicillin, isopropylthio- d -galactoside and 5-bromo-4-chloro-3-indolyl- β - d -galactoside (X-Gal), and incubated at 37°C overnight, using standard methods ( ). .. White colonies were cultured and large-scale plasmid preparations were carried out using methods described previously ( ).

Article Title: Amylases without known homologues discovered in an acid mine drainage: significance and impact
Article Snippet: .. Amplicons and purified pUC19 were digested with Hin dIII and Xba I primers (Fermentas), ligated and transformed into electrocompetent DH5α cells (Invitrogen). ..

Article Title: Serial Analysis of rRNA Genes and the Unexpected Dominance of Rare Members of Microbial Communities ▿
Article Snippet: .. PCR products were ligated nondirectionally into the SmaI site of pUC19 and were transformed into E. coli DH10B cells (Invitrogen, Carlsbad, CA). ..

Derivative Assay:

Article Title: The basic N-terminal domain of TRF2 limits recombination endonuclease action at human telomeres
Article Snippet: .. The non-replicative telomeric plasmids derived from pUC19 (Fermentas) in which the Geneticin gene (G418) is cloned with or without 700 bp stretch of T2 AG3 or 280 bp stretch of TG1–3 . .. The genes encoding the proteins to be tested were cloned on a plasmid, fused to the Gal4 activation domain.

Gel Purification:

Article Title: A simple and efficient method to visualize and quantify the efficiency of chromosomal mutations from genome editing
Article Snippet: Construction of plasmids The plasmid expressing a fusion protein of mCherry and GFP (pmCherry-GFP) was constructed from pUC19 (Invitrogen, Waltham, MA, USA) by inserting the mCherry coding sequence between the SalI and HindIII sites of the multi-cloning sites (MCS) of the pUC19 to allow in-frame expression of mCherry and the LacZα gene in pUC19, and then replacing the LacZα coding region with super folding green fluorescent gene (sfGFP, GenBank # HQ873313). .. The amplified DNA was double digested with Sal I and Hind III followed by gel-purification and inserted into pUC19 vector linearized with the same two restriction enzymes.

Article Title: Serial Analysis of rRNA Genes and the Unexpected Dominance of Rare Members of Microbial Communities ▿
Article Snippet: Amplicons were purified on agarose gels with a QIAquick gel purification kit (QIAGEN, Valencia, CA). .. PCR products were ligated nondirectionally into the SmaI site of pUC19 and were transformed into E. coli DH10B cells (Invitrogen, Carlsbad, CA).

Transfection:

Article Title: Membrane-type 1 Matrix Metalloprotease (MT1-MMP) Enables Invasive Migration of Glioma Cells in Central Nervous System White Matter
Article Snippet: Paragraph title: Transfection of 3T3 Cells ... The resulting 2.5-kb cDNA fragment was reamplified with the oligonucleotides CCG GTCGAC TCGGACCATGTCTC and TT TCTAGA GCGTCAGACCTTGTCC for 40 cycles with annealing at 45°C, resulting in a 1.75-kb cDNA fragment containing the whole open reading frame of MT1-MMP that was blunt end–cloned in pUC19 (Invitrogen).

Article Title: Reducing persistent polyomavirus infection increases functionality of virus-specific memory CD8 T cells
Article Snippet: .. The loxP-containing pUC19-SF was digested with BamHI and EcoRI, ligated with large BamHI-EcoRI fragment of A2 DNA cloned into pUC19, and transfected into NMuMGs with lipofectamine 2000 (Invitrogen). .. Viruses with a single loxP inserted at Bgl I site (A2_Bgl I) or the STIN (A2_STIN), or at both the Bgl I site and STIN (A2-Flx) were harvested by cell lysates of transfected NMuMG cells, and the loxP inserts confirmed by sequencing.

Chromatography:

Article Title: Histone H1 functions as a stimulatory factor in backup pathways of NHEJ
Article Snippet: For analysis of reaction products by gel-filtration chromatography DNA-end-joining reactions were performed with a 943-bp fragment of pUC19 as substrate. .. Digestion (500 µl) for 1 h of pUC19 (25 µg) with 50 U Alw 44I/Apa LI (MBI Fermentas) generates three fragments (497, 943 and 1246 bp), which were separated in preparative agarose gels after staining with ethidium bromide and collected by electro elution (Biorad, Munique, Germany).

Activation Assay:

Article Title: The basic N-terminal domain of TRF2 limits recombination endonuclease action at human telomeres
Article Snippet: The non-replicative telomeric plasmids derived from pUC19 (Fermentas) in which the Geneticin gene (G418) is cloned with or without 700 bp stretch of T2 AG3 or 280 bp stretch of TG1–3 . .. The genes encoding the proteins to be tested were cloned on a plasmid, fused to the Gal4 activation domain.

Low Copy Number:

Article Title: A One-Step Miniprep for the Isolation of Plasmid DNA and Lambda Phage Particles
Article Snippet: .. The following high copy number plasmids were used: 1) pUC19 (2.7 Kb), purchased from Invitrogen (Carlsbad, CA); 2) pCYPAC3 (18.8 Kb) , a pUC-based plasmid, kindly provided by S. O′Brien (NCI, Frederick, MD); 3) pLTM330 (6.5 Kb), a pBluescript-based plasmid, kindly provided by L. Tessarollo (NCI, Frederick, MD); and 4) B254 (6.06 Kb), a pBluescript-based plasmid, kindly provided by E. Leibold (University of Utah, Salt Lake City, UT). pEL04 (5.07 Kb, ts pSC101 oriR), a low copy number plasmid (Qiagen® Plasmid Purification Handbook 3rd Edition, Nov 2005, pg. ..

Cell Culture:

Article Title: Membrane-type 1 Matrix Metalloprotease (MT1-MMP) Enables Invasive Migration of Glioma Cells in Central Nervous System White Matter
Article Snippet: The resulting 2.5-kb cDNA fragment was reamplified with the oligonucleotides CCG GTCGAC TCGGACCATGTCTC and TT TCTAGA GCGTCAGACCTTGTCC for 40 cycles with annealing at 45°C, resulting in a 1.75-kb cDNA fragment containing the whole open reading frame of MT1-MMP that was blunt end–cloned in pUC19 (Invitrogen). .. C6 cells and 3T3 cells were cultured as described.

Article Title: Intrinsic Curvature in the VP1 Gene of SV40: Comparison of Solution and Gel Results
Article Snippet: To obtain the relatively large quantities of DNA needed for the TEB experiments, SV40 DNA was digested by suitable restriction enzymes and the desired fragments isolated by agarose gel electrophoresis, subcloned into the polylinker of pUC19, transformed into Escherichia coli strain DH5 (Life Technologies) via the heat shock method, plated on Luria broth media containing ampicillin, isopropylthio- d -galactoside and 5-bromo-4-chloro-3-indolyl- β - d -galactoside (X-Gal), and incubated at 37°C overnight, using standard methods ( ). .. White colonies were cultured and large-scale plasmid preparations were carried out using methods described previously ( ).

Polymerase Chain Reaction:

Article Title: Membrane-type 1 Matrix Metalloprotease (MT1-MMP) Enables Invasive Migration of Glioma Cells in Central Nervous System White Matter
Article Snippet: Transfection of 3T3 Cells The cDNA encoding human MT1-MMP (GenBank/EMBL/DDBJ accession number D26512 ) was isolated by nested polymerase chain reaction (PCR). .. The resulting 2.5-kb cDNA fragment was reamplified with the oligonucleotides CCG GTCGAC TCGGACCATGTCTC and TT TCTAGA GCGTCAGACCTTGTCC for 40 cycles with annealing at 45°C, resulting in a 1.75-kb cDNA fragment containing the whole open reading frame of MT1-MMP that was blunt end–cloned in pUC19 (Invitrogen).

Article Title: The basic N-terminal domain of TRF2 limits recombination endonuclease action at human telomeres
Article Snippet: Gene disruptions are performed in the humanized strain by replacing the entire ORF to be deleted by a cassette containing the NAT1 gene screening for nourseothricin sensitivity and checking for the correct chromosomal insertion by PCR. .. The non-replicative telomeric plasmids derived from pUC19 (Fermentas) in which the Geneticin gene (G418) is cloned with or without 700 bp stretch of T2 AG3 or 280 bp stretch of TG1–3 .

Article Title: A simple and efficient method to visualize and quantify the efficiency of chromosomal mutations from genome editing
Article Snippet: Construction of plasmids The plasmid expressing a fusion protein of mCherry and GFP (pmCherry-GFP) was constructed from pUC19 (Invitrogen, Waltham, MA, USA) by inserting the mCherry coding sequence between the SalI and HindIII sites of the multi-cloning sites (MCS) of the pUC19 to allow in-frame expression of mCherry and the LacZα gene in pUC19, and then replacing the LacZα coding region with super folding green fluorescent gene (sfGFP, GenBank # HQ873313). .. Briefly, mCherry coding sequences were PCR amplified from plasmid Nanog-2A-mCherry (a gift from Dr. Rudolf Jaenisch (Addgene plasmid # 59995) with primers 5′-cggcgcagaGTCGACttgtacagctcgtccatgcc-3′ (Sal I site capitalized) and 5′-gattacgccAAGCTTgatggtgagcaagggcgaggaggata-3′ (Hind III site capitalized).

Article Title: The Frog Prince: a reconstructed transposon from Rana pipiens with high transpositional activity in vertebrate cells
Article Snippet: .. The PCR products were cloned into the HincII site of pUC19 resulting in pE5 containing the left IR, and pV3 containing the right IR, respectively. pE5-neo was constructed by cloning the EcoRI/BamHI fragment of pRc/CMV (Invitrogen) containing an SV40 promoter/enhancer, the neomycin phosphotransferase ( neo ) gene and the SV40 poly-A signal into the MunI site of pE5. .. The EcoRI/HindIII fragment of pE5-neo was subsequently cloned into the HindIII site of pV3 resulting in pTxr-neo.

Article Title: Reducing persistent polyomavirus infection increases functionality of virus-specific memory CD8 T cells
Article Snippet: The small BamHI-EcoRI fragment of the A2 genome cloned into pUC19 (designated “pUC19-SF”) was used as the PCR template to insert one or two loxP sequences. .. The loxP-containing pUC19-SF was digested with BamHI and EcoRI, ligated with large BamHI-EcoRI fragment of A2 DNA cloned into pUC19, and transfected into NMuMGs with lipofectamine 2000 (Invitrogen).

Article Title: Novel Type of Hepatitis B Virus Mutation: Replacement Mutation Involving a Hepatocyte Nuclear Factor 1 Binding Site Tandem Repeat in Chronic Hepatitis B Virus Genotype E
Article Snippet: The PCR product was also cloned, and pGEM-fragA-C was produced. .. Finally, the fragments C-B-HindIII-AvrII and pGEM-fragA-C, cut with AvrII and SacI, were cloned into pUC19 without promoters (Invitrogen) cut with HindIII and SacI, and a pUC19-HBV/E wild-type replicon encoding a replication-competent 1.35-unit-length HBV genome was produced.

Article Title: Serial Analysis of rRNA Genes and the Unexpected Dominance of Rare Members of Microbial Communities ▿
Article Snippet: .. PCR products were ligated nondirectionally into the SmaI site of pUC19 and were transformed into E. coli DH10B cells (Invitrogen, Carlsbad, CA). ..

Article Title: Panhandle PCR for cDNA: A rapid method for isolation of MLL fusion transcripts involving unknown partner genes
Article Snippet: .. PCR-amplified, purified pUC19 (2.5 μl) and 2.5 μl of purified cDNA panhandle PCR products were mixed and added to 50 μl of MAX efficiency DH5α cells (Life Technologies) to recombine in vivo . .. Subclones containing cDNA panhandle PCR products were identified by PCR with primers 3 and 4 ( ).

In Vivo:

Article Title: Panhandle PCR for cDNA: A rapid method for isolation of MLL fusion transcripts involving unknown partner genes
Article Snippet: .. PCR-amplified, purified pUC19 (2.5 μl) and 2.5 μl of purified cDNA panhandle PCR products were mixed and added to 50 μl of MAX efficiency DH5α cells (Life Technologies) to recombine in vivo . .. Subclones containing cDNA panhandle PCR products were identified by PCR with primers 3 and 4 ( ).

Mutagenesis:

Article Title: The Frog Prince: a reconstructed transposon from Rana pipiens with high transpositional activity in vertebrate cells
Article Snippet: Site-specific mutagenesis with ligase chain reaction was done to obtain the consensus Rana -type transposase. .. The PCR products were cloned into the HincII site of pUC19 resulting in pE5 containing the left IR, and pV3 containing the right IR, respectively. pE5-neo was constructed by cloning the EcoRI/BamHI fragment of pRc/CMV (Invitrogen) containing an SV40 promoter/enhancer, the neomycin phosphotransferase ( neo ) gene and the SV40 poly-A signal into the MunI site of pE5.

Article Title: Novel Type of Hepatitis B Virus Mutation: Replacement Mutation Involving a Hepatocyte Nuclear Factor 1 Binding Site Tandem Repeat in Chronic Hepatitis B Virus Genotype E
Article Snippet: Of these, pGEM-fragA-3 and pGEM-fragB-2, with consensus sequences and without core deletion or replacement mutation (not major clones), were used as templates to construct HBV replicons. .. Finally, the fragments C-B-HindIII-AvrII and pGEM-fragA-C, cut with AvrII and SacI, were cloned into pUC19 without promoters (Invitrogen) cut with HindIII and SacI, and a pUC19-HBV/E wild-type replicon encoding a replication-competent 1.35-unit-length HBV genome was produced.

Isolation:

Article Title: Membrane-type 1 Matrix Metalloprotease (MT1-MMP) Enables Invasive Migration of Glioma Cells in Central Nervous System White Matter
Article Snippet: Transfection of 3T3 Cells The cDNA encoding human MT1-MMP (GenBank/EMBL/DDBJ accession number D26512 ) was isolated by nested polymerase chain reaction (PCR). .. The resulting 2.5-kb cDNA fragment was reamplified with the oligonucleotides CCG GTCGAC TCGGACCATGTCTC and TT TCTAGA GCGTCAGACCTTGTCC for 40 cycles with annealing at 45°C, resulting in a 1.75-kb cDNA fragment containing the whole open reading frame of MT1-MMP that was blunt end–cloned in pUC19 (Invitrogen).

Article Title: Intrinsic Curvature in the VP1 Gene of SV40: Comparison of Solution and Gel Results
Article Snippet: .. To obtain the relatively large quantities of DNA needed for the TEB experiments, SV40 DNA was digested by suitable restriction enzymes and the desired fragments isolated by agarose gel electrophoresis, subcloned into the polylinker of pUC19, transformed into Escherichia coli strain DH5 (Life Technologies) via the heat shock method, plated on Luria broth media containing ampicillin, isopropylthio- d -galactoside and 5-bromo-4-chloro-3-indolyl- β - d -galactoside (X-Gal), and incubated at 37°C overnight, using standard methods ( ). .. White colonies were cultured and large-scale plasmid preparations were carried out using methods described previously ( ).

Article Title: Novel Pathway of Salicylate Degradation by Streptomyces sp. Strain WA46
Article Snippet: Streptomyces sp. strain WA46 was isolated from a cornfield in Ohio. .. Competent cells of Escherichia coli DH5α and DH10B and plasmids pUC18, pUC19, and pZErO-2 were purchased from Invitrogen.

Subcloning:

Article Title: Membrane-type 1 Matrix Metalloprotease (MT1-MMP) Enables Invasive Migration of Glioma Cells in Central Nervous System White Matter
Article Snippet: The resulting 2.5-kb cDNA fragment was reamplified with the oligonucleotides CCG GTCGAC TCGGACCATGTCTC and TT TCTAGA GCGTCAGACCTTGTCC for 40 cycles with annealing at 45°C, resulting in a 1.75-kb cDNA fragment containing the whole open reading frame of MT1-MMP that was blunt end–cloned in pUC19 (Invitrogen). .. The restriction sites XbaI and SalI present in the oligonucleotides (underlined sequences) were used for subcloning in the pRK vector ( ).

Article Title: Amylases without known homologues discovered in an acid mine drainage: significance and impact
Article Snippet: Paragraph title: Sequencing and subcloning of the DNA sequences ... Amplicons and purified pUC19 were digested with Hin dIII and Xba I primers (Fermentas), ligated and transformed into electrocompetent DH5α cells (Invitrogen).

Size-exclusion Chromatography:

Article Title: Amylases without known homologues discovered in an acid mine drainage: significance and impact
Article Snippet: Amplicons and purified pUC19 were digested with Hin dIII and Xba I primers (Fermentas), ligated and transformed into electrocompetent DH5α cells (Invitrogen). .. Full CDS were amplified using the following primers: 1025-NcoI and 1025-XhoI for CARN4_1025 (479aa) and 2759-5 and 2759-3 for CARN7_2759 (843aa) using iProof DNA polymerase (BioRad) with the following conditions: 30 amplification cycles of 98°C for 10 s, 70°C for 30 s, 72°C for 50 sec, followed by a final elongation cycle (72°C for 10 min) for CARN4_1025; 30 amplification cycles of 98°C for 10 s, 57°C for 30 s, 72°C for 2 min, followed by a final elongation cycle (72°C for 10 min) for CARN7_2759.

Purification:

Article Title: A One-Step Miniprep for the Isolation of Plasmid DNA and Lambda Phage Particles
Article Snippet: .. The following high copy number plasmids were used: 1) pUC19 (2.7 Kb), purchased from Invitrogen (Carlsbad, CA); 2) pCYPAC3 (18.8 Kb) , a pUC-based plasmid, kindly provided by S. O′Brien (NCI, Frederick, MD); 3) pLTM330 (6.5 Kb), a pBluescript-based plasmid, kindly provided by L. Tessarollo (NCI, Frederick, MD); and 4) B254 (6.06 Kb), a pBluescript-based plasmid, kindly provided by E. Leibold (University of Utah, Salt Lake City, UT). pEL04 (5.07 Kb, ts pSC101 oriR), a low copy number plasmid (Qiagen® Plasmid Purification Handbook 3rd Edition, Nov 2005, pg. ..

Article Title: Histone H1 functions as a stimulatory factor in backup pathways of NHEJ
Article Snippet: End-joining reactions were performed in 20 mM Hepes–KOH (pH 7.5), 10 mM MgCl2 , 80 mM KCl, 1 mM ATP, 1 mM DTT, 25–250 ng of DNA (as indicated) and 0–20 μg of HeLa NE, fractions, purified DNA ligase 3β or purified DNA ligase IV/XRCC4 in a final volume of 20 µl at 25°C for 30 min. .. Digestion (500 µl) for 1 h of pUC19 (25 µg) with 50 U Alw 44I/Apa LI (MBI Fermentas) generates three fragments (497, 943 and 1246 bp), which were separated in preparative agarose gels after staining with ethidium bromide and collected by electro elution (Biorad, Munique, Germany).

Article Title: Amylases without known homologues discovered in an acid mine drainage: significance and impact
Article Snippet: .. Amplicons and purified pUC19 were digested with Hin dIII and Xba I primers (Fermentas), ligated and transformed into electrocompetent DH5α cells (Invitrogen). ..

Article Title: Serial Analysis of rRNA Genes and the Unexpected Dominance of Rare Members of Microbial Communities ▿
Article Snippet: Amplicons were purified on agarose gels with a QIAquick gel purification kit (QIAGEN, Valencia, CA). .. PCR products were ligated nondirectionally into the SmaI site of pUC19 and were transformed into E. coli DH10B cells (Invitrogen, Carlsbad, CA).

Article Title: Panhandle PCR for cDNA: A rapid method for isolation of MLL fusion transcripts involving unknown partner genes
Article Snippet: .. PCR-amplified, purified pUC19 (2.5 μl) and 2.5 μl of purified cDNA panhandle PCR products were mixed and added to 50 μl of MAX efficiency DH5α cells (Life Technologies) to recombine in vivo . .. Subclones containing cDNA panhandle PCR products were identified by PCR with primers 3 and 4 ( ).

Sequencing:

Article Title: A simple and efficient method to visualize and quantify the efficiency of chromosomal mutations from genome editing
Article Snippet: .. Construction of plasmids The plasmid expressing a fusion protein of mCherry and GFP (pmCherry-GFP) was constructed from pUC19 (Invitrogen, Waltham, MA, USA) by inserting the mCherry coding sequence between the SalI and HindIII sites of the multi-cloning sites (MCS) of the pUC19 to allow in-frame expression of mCherry and the LacZα gene in pUC19, and then replacing the LacZα coding region with super folding green fluorescent gene (sfGFP, GenBank # HQ873313). .. Briefly, mCherry coding sequences were PCR amplified from plasmid Nanog-2A-mCherry (a gift from Dr. Rudolf Jaenisch (Addgene plasmid # 59995) with primers 5′-cggcgcagaGTCGACttgtacagctcgtccatgcc-3′ (Sal I site capitalized) and 5′-gattacgccAAGCTTgatggtgagcaagggcgaggaggata-3′ (Hind III site capitalized).

Article Title: Reducing persistent polyomavirus infection increases functionality of virus-specific memory CD8 T cells
Article Snippet: The loxP sequence (ATAACTTCGTATAATGTATGCTATACGAAGTTAT) was inserted in the A2 MuPyV strain genomic DNA at the Bgl I restriction enzyme site and/or in the intronic region shared by LT, MT, and ST (STIN) ( ) by PCR amplification with primer sets (BglI-For, BglI-Rev, STIN-For, and STIN-Rev), as listed in . .. The loxP-containing pUC19-SF was digested with BamHI and EcoRI, ligated with large BamHI-EcoRI fragment of A2 DNA cloned into pUC19, and transfected into NMuMGs with lipofectamine 2000 (Invitrogen).

Article Title: Amylases without known homologues discovered in an acid mine drainage: significance and impact
Article Snippet: Paragraph title: Sequencing and subcloning of the DNA sequences ... Amplicons and purified pUC19 were digested with Hin dIII and Xba I primers (Fermentas), ligated and transformed into electrocompetent DH5α cells (Invitrogen).

Article Title: Site-Specific Recombination System Encoded by Toluene Catabolic Transposon Tn4651
Article Snippet: Paragraph title: Determination and analysis of nucleotide sequence. ... The DNA fragments cloned on pUC18 and pUC19 were sequenced with an ABI 310 automated DNA sequencer (Applied Biosystems) according to the protocols recommended by the manufacturer.

Transactivation Assay:

Article Title: The basic N-terminal domain of TRF2 limits recombination endonuclease action at human telomeres
Article Snippet: The non-replicative telomeric plasmids derived from pUC19 (Fermentas) in which the Geneticin gene (G418) is cloned with or without 700 bp stretch of T2 AG3 or 280 bp stretch of TG1–3 . .. The transactivation assay is performed on DS-URA-HIS + 3-amino-1,2,4-triazole (3-AT) (30 mM) (3-AT is a competitive inhibitor of the HIS3 gene product, so that a higher level of HIS3 expression is required for growth when 3-AT is present in the medium).

Staining:

Article Title: Histone H1 functions as a stimulatory factor in backup pathways of NHEJ
Article Snippet: .. Digestion (500 µl) for 1 h of pUC19 (25 µg) with 50 U Alw 44I/Apa LI (MBI Fermentas) generates three fragments (497, 943 and 1246 bp), which were separated in preparative agarose gels after staining with ethidium bromide and collected by electro elution (Biorad, Munique, Germany). .. Electroeluates were ethanol precipitated, pellets dissolved in TE buffer and the DNA concentration measured in a spectrophotometer (NanoDrop Technologies, Inc., Rockland, USA).

cDNA Library Assay:

Article Title: Membrane-type 1 Matrix Metalloprotease (MT1-MMP) Enables Invasive Migration of Glioma Cells in Central Nervous System White Matter
Article Snippet: The first amplification was performed for 30 cycles at an annealing temperature of 45°C using the oligonucleotide pair CC GTCGAC AAAGGCGCCCCGAGGGA and AA TCTAGA GGTAGGTGAGGCAGAGG with a human placenta cDNA library as template ( Clontech ). .. The resulting 2.5-kb cDNA fragment was reamplified with the oligonucleotides CCG GTCGAC TCGGACCATGTCTC and TT TCTAGA GCGTCAGACCTTGTCC for 40 cycles with annealing at 45°C, resulting in a 1.75-kb cDNA fragment containing the whole open reading frame of MT1-MMP that was blunt end–cloned in pUC19 (Invitrogen).

Plasmid Preparation:

Article Title: Membrane-type 1 Matrix Metalloprotease (MT1-MMP) Enables Invasive Migration of Glioma Cells in Central Nervous System White Matter
Article Snippet: The resulting 2.5-kb cDNA fragment was reamplified with the oligonucleotides CCG GTCGAC TCGGACCATGTCTC and TT TCTAGA GCGTCAGACCTTGTCC for 40 cycles with annealing at 45°C, resulting in a 1.75-kb cDNA fragment containing the whole open reading frame of MT1-MMP that was blunt end–cloned in pUC19 (Invitrogen). .. The restriction sites XbaI and SalI present in the oligonucleotides (underlined sequences) were used for subcloning in the pRK vector ( ).

Article Title: Engineering of a Single-Chain Variable-Fragment (scFv) Antibody Specific for the Stolbur Phytoplasma (Mollicute) and Its Expression in Escherichia coli and Tobacco Plants
Article Snippet: .. The following E. coli strains and vectors were used: E. coli XL1-Blue and plasmid BluescriptSK+ (pBS; Stratagene, La Jolla, Calif.), for cloning variable heavy (VH) and variable light (VL) sequences, and E. coli JM109 (Promega, Madison, Wis.) and plasmids pUC18 and pUC19 (MBI Fermentas, Vilnius, Lithuania), for scFv expression. .. Plasmid pS8 ( ) was also used for scFv constructions.

Article Title: A One-Step Miniprep for the Isolation of Plasmid DNA and Lambda Phage Particles
Article Snippet: .. The following high copy number plasmids were used: 1) pUC19 (2.7 Kb), purchased from Invitrogen (Carlsbad, CA); 2) pCYPAC3 (18.8 Kb) , a pUC-based plasmid, kindly provided by S. O′Brien (NCI, Frederick, MD); 3) pLTM330 (6.5 Kb), a pBluescript-based plasmid, kindly provided by L. Tessarollo (NCI, Frederick, MD); and 4) B254 (6.06 Kb), a pBluescript-based plasmid, kindly provided by E. Leibold (University of Utah, Salt Lake City, UT). pEL04 (5.07 Kb, ts pSC101 oriR), a low copy number plasmid (Qiagen® Plasmid Purification Handbook 3rd Edition, Nov 2005, pg. ..

Article Title: The basic N-terminal domain of TRF2 limits recombination endonuclease action at human telomeres
Article Snippet: Paragraph title: Plasmid and yeast procedures ... The non-replicative telomeric plasmids derived from pUC19 (Fermentas) in which the Geneticin gene (G418) is cloned with or without 700 bp stretch of T2 AG3 or 280 bp stretch of TG1–3 .

Article Title: A simple and efficient method to visualize and quantify the efficiency of chromosomal mutations from genome editing
Article Snippet: .. Construction of plasmids The plasmid expressing a fusion protein of mCherry and GFP (pmCherry-GFP) was constructed from pUC19 (Invitrogen, Waltham, MA, USA) by inserting the mCherry coding sequence between the SalI and HindIII sites of the multi-cloning sites (MCS) of the pUC19 to allow in-frame expression of mCherry and the LacZα gene in pUC19, and then replacing the LacZα coding region with super folding green fluorescent gene (sfGFP, GenBank # HQ873313). .. Briefly, mCherry coding sequences were PCR amplified from plasmid Nanog-2A-mCherry (a gift from Dr. Rudolf Jaenisch (Addgene plasmid # 59995) with primers 5′-cggcgcagaGTCGACttgtacagctcgtccatgcc-3′ (Sal I site capitalized) and 5′-gattacgccAAGCTTgatggtgagcaagggcgaggaggata-3′ (Hind III site capitalized).

Article Title: Histone H1 functions as a stimulatory factor in backup pathways of NHEJ
Article Snippet: For quantification of rejoining the ImageQuant software (Molecular Dynamics) was used to calculate the percent of input plasmid found in dimers and other higher order polymers. .. Digestion (500 µl) for 1 h of pUC19 (25 µg) with 50 U Alw 44I/Apa LI (MBI Fermentas) generates three fragments (497, 943 and 1246 bp), which were separated in preparative agarose gels after staining with ethidium bromide and collected by electro elution (Biorad, Munique, Germany).

Article Title: Intrinsic Curvature in the VP1 Gene of SV40: Comparison of Solution and Gel Results
Article Snippet: To obtain the relatively large quantities of DNA needed for the TEB experiments, SV40 DNA was digested by suitable restriction enzymes and the desired fragments isolated by agarose gel electrophoresis, subcloned into the polylinker of pUC19, transformed into Escherichia coli strain DH5 (Life Technologies) via the heat shock method, plated on Luria broth media containing ampicillin, isopropylthio- d -galactoside and 5-bromo-4-chloro-3-indolyl- β - d -galactoside (X-Gal), and incubated at 37°C overnight, using standard methods ( ). .. White colonies were cultured and large-scale plasmid preparations were carried out using methods described previously ( ).

Article Title: Novel Pathway of Salicylate Degradation by Streptomyces sp. Strain WA46
Article Snippet: Competent cells of Escherichia coli DH5α and DH10B and plasmids pUC18, pUC19, and pZErO-2 were purchased from Invitrogen. .. The plasmids used are listed in Table . pWHM601, a Streptomyces / E. coli shuttle vector, was provided by C. R. Hutchinson.

Article Title: Amylases without known homologues discovered in an acid mine drainage: significance and impact
Article Snippet: Sequencing and subcloning of the DNA sequences Plasmid DNAs were extracted using the QIAprep Spin Miniprep kit (Qiagen) and the inserts were sequenced (Millegen) using the primers AHM and FM ( ). .. Amplicons and purified pUC19 were digested with Hin dIII and Xba I primers (Fermentas), ligated and transformed into electrocompetent DH5α cells (Invitrogen).

Article Title: Novel Type of Hepatitis B Virus Mutation: Replacement Mutation Involving a Hepatocyte Nuclear Factor 1 Binding Site Tandem Repeat in Chronic Hepatitis B Virus Genotype E
Article Snippet: Paragraph title: Plasmid construction for replication model (replicon). ... Finally, the fragments C-B-HindIII-AvrII and pGEM-fragA-C, cut with AvrII and SacI, were cloned into pUC19 without promoters (Invitrogen) cut with HindIII and SacI, and a pUC19-HBV/E wild-type replicon encoding a replication-competent 1.35-unit-length HBV genome was produced.

Article Title: Serial Analysis of rRNA Genes and the Unexpected Dominance of Rare Members of Microbial Communities ▿
Article Snippet: PCR products were ligated nondirectionally into the SmaI site of pUC19 and were transformed into E. coli DH10B cells (Invitrogen, Carlsbad, CA). .. Plasmid template DNA was prepared by a modified alkaline lysis method.

Article Title: Panhandle PCR for cDNA: A rapid method for isolation of MLL fusion transcripts involving unknown partner genes
Article Snippet: MLL ends complementary to the ends of the cDNA panhandle PCR products that were to be inserted were added to the vector during PCR using primers 5′-ACATTCCCTTCTTCACTCTTTTCCTGGCGTAATCATGGTCATAGC-3′ and 5′-GTGGCTGAGGCGGGATGACCACCATGCCTGCAGGTCGACTC-3′ ( ) and described conditions ( ). .. PCR-amplified, purified pUC19 (2.5 μl) and 2.5 μl of purified cDNA panhandle PCR products were mixed and added to 50 μl of MAX efficiency DH5α cells (Life Technologies) to recombine in vivo .

Software:

Article Title: Histone H1 functions as a stimulatory factor in backup pathways of NHEJ
Article Snippet: For quantification of rejoining the ImageQuant software (Molecular Dynamics) was used to calculate the percent of input plasmid found in dimers and other higher order polymers. .. Digestion (500 µl) for 1 h of pUC19 (25 µg) with 50 U Alw 44I/Apa LI (MBI Fermentas) generates three fragments (497, 943 and 1246 bp), which were separated in preparative agarose gels after staining with ethidium bromide and collected by electro elution (Biorad, Munique, Germany).

Article Title: Site-Specific Recombination System Encoded by Toluene Catabolic Transposon Tn4651
Article Snippet: The DNA fragments cloned on pUC18 and pUC19 were sequenced with an ABI 310 automated DNA sequencer (Applied Biosystems) according to the protocols recommended by the manufacturer. .. The computer analysis of the sequence was performed with the software programs GENETYX 10 (SDC, Inc., Tokyo, Japan) and BLAST 2 (National Institute of Genetics, Mishima, Japan).

Agarose Gel Electrophoresis:

Article Title: Histone H1 functions as a stimulatory factor in backup pathways of NHEJ
Article Snippet: DNA from the reaction was loaded on a 0.7% agarose gel and run at 45 V (2 V/cm) for 5 h. Gels were stained in SYBR Gold (Molecular Probes) and scanned in a FluorImager (Typhoon, Molecular Dynamics). .. Digestion (500 µl) for 1 h of pUC19 (25 µg) with 50 U Alw 44I/Apa LI (MBI Fermentas) generates three fragments (497, 943 and 1246 bp), which were separated in preparative agarose gels after staining with ethidium bromide and collected by electro elution (Biorad, Munique, Germany).

Article Title: Intrinsic Curvature in the VP1 Gene of SV40: Comparison of Solution and Gel Results
Article Snippet: .. To obtain the relatively large quantities of DNA needed for the TEB experiments, SV40 DNA was digested by suitable restriction enzymes and the desired fragments isolated by agarose gel electrophoresis, subcloned into the polylinker of pUC19, transformed into Escherichia coli strain DH5 (Life Technologies) via the heat shock method, plated on Luria broth media containing ampicillin, isopropylthio- d -galactoside and 5-bromo-4-chloro-3-indolyl- β - d -galactoside (X-Gal), and incubated at 37°C overnight, using standard methods ( ). .. White colonies were cultured and large-scale plasmid preparations were carried out using methods described previously ( ).

Ethanol Precipitation:

Article Title: Intrinsic Curvature in the VP1 Gene of SV40: Comparison of Solution and Gel Results
Article Snippet: Control experiments showed that identical results were obtained with and without phenol extracting the denatured restriction enzymes before ethanol precipitation; therefore, the phenol extraction step was usually omitted. .. To obtain the relatively large quantities of DNA needed for the TEB experiments, SV40 DNA was digested by suitable restriction enzymes and the desired fragments isolated by agarose gel electrophoresis, subcloned into the polylinker of pUC19, transformed into Escherichia coli strain DH5 (Life Technologies) via the heat shock method, plated on Luria broth media containing ampicillin, isopropylthio- d -galactoside and 5-bromo-4-chloro-3-indolyl- β - d -galactoside (X-Gal), and incubated at 37°C overnight, using standard methods ( ).

Spectrophotometry:

Article Title: Histone H1 functions as a stimulatory factor in backup pathways of NHEJ
Article Snippet: Digestion (500 µl) for 1 h of pUC19 (25 µg) with 50 U Alw 44I/Apa LI (MBI Fermentas) generates three fragments (497, 943 and 1246 bp), which were separated in preparative agarose gels after staining with ethidium bromide and collected by electro elution (Biorad, Munique, Germany). .. Electroeluates were ethanol precipitated, pellets dissolved in TE buffer and the DNA concentration measured in a spectrophotometer (NanoDrop Technologies, Inc., Rockland, USA).

Produced:

Article Title: Novel Type of Hepatitis B Virus Mutation: Replacement Mutation Involving a Hepatocyte Nuclear Factor 1 Binding Site Tandem Repeat in Chronic Hepatitis B Virus Genotype E
Article Snippet: .. Finally, the fragments C-B-HindIII-AvrII and pGEM-fragA-C, cut with AvrII and SacI, were cloned into pUC19 without promoters (Invitrogen) cut with HindIII and SacI, and a pUC19-HBV/E wild-type replicon encoding a replication-competent 1.35-unit-length HBV genome was produced. .. In addition, the pUC19-HBV/E wild-type replicon was digested by RsrIII and XbaI, the fragment with the replacement mutation from patient 2 (strain UK2), cut with RsrIII and XbalI, was ligated, and a pUC19-HBV/E replacement replicon was produced.

Concentration Assay:

Article Title: Histone H1 functions as a stimulatory factor in backup pathways of NHEJ
Article Snippet: Digestion (500 µl) for 1 h of pUC19 (25 µg) with 50 U Alw 44I/Apa LI (MBI Fermentas) generates three fragments (497, 943 and 1246 bp), which were separated in preparative agarose gels after staining with ethidium bromide and collected by electro elution (Biorad, Munique, Germany). .. Electroeluates were ethanol precipitated, pellets dissolved in TE buffer and the DNA concentration measured in a spectrophotometer (NanoDrop Technologies, Inc., Rockland, USA).

Alkaline Lysis:

Article Title: Serial Analysis of rRNA Genes and the Unexpected Dominance of Rare Members of Microbial Communities ▿
Article Snippet: PCR products were ligated nondirectionally into the SmaI site of pUC19 and were transformed into E. coli DH10B cells (Invitrogen, Carlsbad, CA). .. Plasmid template DNA was prepared by a modified alkaline lysis method.

Marker:

Article Title: The basic N-terminal domain of TRF2 limits recombination endonuclease action at human telomeres
Article Snippet: The one hybrid test is performed in humanized cells transformed with the SphI / NotI fragment from the modified pHumaTel plasmid, containing a portion of ADH4 , the full-length HIS3 gene, the URA3 selective marker and a T2 AG3 stretch of 60 bp. .. The non-replicative telomeric plasmids derived from pUC19 (Fermentas) in which the Geneticin gene (G418) is cloned with or without 700 bp stretch of T2 AG3 or 280 bp stretch of TG1–3 .

Gel Extraction:

Article Title: Intrinsic Curvature in the VP1 Gene of SV40: Comparison of Solution and Gel Results
Article Snippet: To obtain the relatively large quantities of DNA needed for the TEB experiments, SV40 DNA was digested by suitable restriction enzymes and the desired fragments isolated by agarose gel electrophoresis, subcloned into the polylinker of pUC19, transformed into Escherichia coli strain DH5 (Life Technologies) via the heat shock method, plated on Luria broth media containing ampicillin, isopropylthio- d -galactoside and 5-bromo-4-chloro-3-indolyl- β - d -galactoside (X-Gal), and incubated at 37°C overnight, using standard methods ( ). .. The agarose was dissolved with a chaotropic salt (QIAquick gel extraction kit, Qiagen, Valencia, CA), and the DNA was concentrated and desalted by adsorption on small diethylaminoethyl cellulose columns, as described previously ( ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher marker puc19 dna mspi hpall
    Detection of AMPAR subunits in the mouse sciatic nerve. A , cDNA for GluA1–GluA4 subunits obtained after the second round of PCR was analyzed with electrophoresis in agarose gel. An example gel is shown. The predicted size of the PCR products was as follows: 632 bp for GluA1, 628 bp for GluA2, 630 bp for GluA3, and 626 bp for GluA4. A1, A2, A3, and A4 represent GluA1, GluA2, GluA3, and GluA4, respectively. M denotes the φX174 <t>DNA/HaeIII</t> molecular weight marker. Band size for the marker is indicated on the left. B , Products of GluA1, GluA2, GluA3, and GluA4 obtained after the second round of PCR were digested with restriction enzymes specific for each subunit : PstI (275 and 357 bp) for GluA1 , SduI (270 and 358 bp) for GluA2, Eco47III (229 and 401 bp) for GluA3, and EcoRI (289 and 337 bp) for GluA4. An example gel is shown. cDNA for each subunits was cut into two fragments of the predicted size. A1, A2, A3, and A4 represent GluA1, GluA2, GluA3, and GluA4, respectively. M denotes the <t>pUC19</t> <t>DNA/MspI</t> (Hpall) molecular weight marker. Band size for the marker is indicated on the left. Throughout the figure, for positive controls, total RNA was extracted from HEK293 cells transfected with a plasmid encoding GluA1, GluA2, GluA3, or GluA4; this RNA was used as a template. For a negative control, the template was omitted. During RT-PCR, second-round PCR, and digestion, the samples of positive and negative control were always processed in parallel with the samples of RNA extracted from the sciatic nerves.
    Marker Puc19 Dna Mspi Hpall, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/marker puc19 dna mspi hpall/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    marker puc19 dna mspi hpall - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    80
    Thermo Fisher plasmids puc19
    Intracellular UBP replication a , Structure of pACS and pINF. d X and d Y correspond to d NaM and a d 5SICS analog 22 that facilitated plasmid construction (see Methods). cloDF = origin of replication; Sm = streptomycin resistance gene; AmpR = ampicillin resistance gene; ori = ColE1 origin of replication; MCS = multiple cloning site; lacZα = β-galactosidase fragment gene. b , Overview of pINF construction. A DNA fragment containing the unnatural nucleotide was synthesized via solid phase DNA synthesis and then used to assemble synthetic pINF via circular-extension PCR 29 . X = d NaM , Y’ = d TPT3 (an analog of d 5SICS 22 ), and Y = d 5SICS (see text). Color indicates regions of homology. The doubly-nicked product was used directly to transform E. coli harboring pACS. c , The addition of d 5SICS TP and d NaM TP eliminates a growth lag of cells harboring pINF. EP=electroporation. Errors represent s.d. of the mean, n =3. d , LC-MS/MS total ion chromatogram of global nucleoside content in pINF and <t>pUC19</t> recorded in Dynamic Multiple Reaction Monitoring (DMRM) mode. pINF and pUC19 (control) were propagated in E. coli in the presence or absence of unnatural triphosphates, and with or without Pt NTT2 induction. The inset shows a 100× expansion of the mass count axis in the d 5SICS region. e , Biotinylation only occurs in the presence of the UBP, the unnatural triphosphates, and transporter induction. After growth, pINF was recovered, and a 194 nt region containing the site of UBP incorporation (nt 437–630) was amplified and biotinylated. B=biotin; SA=streptavidin. The natural pUC19 control plasmid was prepared identically to pINF. 50-bp DNA ladder is shown to the left. f , Sequencing analysis demonstrates retention of the UBP. An abrupt termination in the Sanger sequencing reaction indicates the presence of UBP incorporation (site indicated with arrow).
    Plasmids Puc19, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 80/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmids puc19/product/Thermo Fisher
    Average 80 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    plasmids puc19 - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    86
    Thermo Fisher puc19 for
    DNA gyrase behavior depends on a DNA substrate gyrase binding score. ( A ) EMSA analysis of DNA gyrase binding with 133 bp fragments; fragments scores are showed above the pictures; molar gyrase/DNA ratio is indicated under the lanes. SC—scrambled consensus, C—consensus. ( B ) Time-course of gyrase supercoiling of <t>pUC19</t> plasmids harboring indicated 133 bp fragments; RE—relaxed plasmid, NSC—negatively supercoiled plasmid. 1—scrambled consensus, 2—Mu SGS, 3—consensus. ( C ) Time-course of ATP-independent relaxation of pUC19 plasmids harbouring indicated 133 bp fragments. ( D ) Time-course of ATP-dependent relaxation of the same plasmids by truncated GyrA59 2 GyrB 2 gyrase lacking CTD.
    Puc19 For, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/puc19 for/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    puc19 for - by Bioz Stars, 2020-02
    86/100 stars
      Buy from Supplier

    Image Search Results


    Detection of AMPAR subunits in the mouse sciatic nerve. A , cDNA for GluA1–GluA4 subunits obtained after the second round of PCR was analyzed with electrophoresis in agarose gel. An example gel is shown. The predicted size of the PCR products was as follows: 632 bp for GluA1, 628 bp for GluA2, 630 bp for GluA3, and 626 bp for GluA4. A1, A2, A3, and A4 represent GluA1, GluA2, GluA3, and GluA4, respectively. M denotes the φX174 DNA/HaeIII molecular weight marker. Band size for the marker is indicated on the left. B , Products of GluA1, GluA2, GluA3, and GluA4 obtained after the second round of PCR were digested with restriction enzymes specific for each subunit : PstI (275 and 357 bp) for GluA1 , SduI (270 and 358 bp) for GluA2, Eco47III (229 and 401 bp) for GluA3, and EcoRI (289 and 337 bp) for GluA4. An example gel is shown. cDNA for each subunits was cut into two fragments of the predicted size. A1, A2, A3, and A4 represent GluA1, GluA2, GluA3, and GluA4, respectively. M denotes the pUC19 DNA/MspI (Hpall) molecular weight marker. Band size for the marker is indicated on the left. Throughout the figure, for positive controls, total RNA was extracted from HEK293 cells transfected with a plasmid encoding GluA1, GluA2, GluA3, or GluA4; this RNA was used as a template. For a negative control, the template was omitted. During RT-PCR, second-round PCR, and digestion, the samples of positive and negative control were always processed in parallel with the samples of RNA extracted from the sciatic nerves.

    Journal: The Journal of Neuroscience

    Article Title: Glutamate Activates AMPA Receptor Conductance in the Developing Schwann Cells of the Mammalian Peripheral Nerves

    doi: 10.1523/JNEUROSCI.1168-17.2017

    Figure Lengend Snippet: Detection of AMPAR subunits in the mouse sciatic nerve. A , cDNA for GluA1–GluA4 subunits obtained after the second round of PCR was analyzed with electrophoresis in agarose gel. An example gel is shown. The predicted size of the PCR products was as follows: 632 bp for GluA1, 628 bp for GluA2, 630 bp for GluA3, and 626 bp for GluA4. A1, A2, A3, and A4 represent GluA1, GluA2, GluA3, and GluA4, respectively. M denotes the φX174 DNA/HaeIII molecular weight marker. Band size for the marker is indicated on the left. B , Products of GluA1, GluA2, GluA3, and GluA4 obtained after the second round of PCR were digested with restriction enzymes specific for each subunit : PstI (275 and 357 bp) for GluA1 , SduI (270 and 358 bp) for GluA2, Eco47III (229 and 401 bp) for GluA3, and EcoRI (289 and 337 bp) for GluA4. An example gel is shown. cDNA for each subunits was cut into two fragments of the predicted size. A1, A2, A3, and A4 represent GluA1, GluA2, GluA3, and GluA4, respectively. M denotes the pUC19 DNA/MspI (Hpall) molecular weight marker. Band size for the marker is indicated on the left. Throughout the figure, for positive controls, total RNA was extracted from HEK293 cells transfected with a plasmid encoding GluA1, GluA2, GluA3, or GluA4; this RNA was used as a template. For a negative control, the template was omitted. During RT-PCR, second-round PCR, and digestion, the samples of positive and negative control were always processed in parallel with the samples of RNA extracted from the sciatic nerves.

    Article Snippet: The digestion products were analyzed by agarose gel electrophoresis (stained with GelRel) with the marker pUC19 DNA/MspI (Hpall) (Thermo Scientific).

    Techniques: Polymerase Chain Reaction, Electrophoresis, Agarose Gel Electrophoresis, Molecular Weight, Marker, Transfection, Plasmid Preparation, Negative Control, Reverse Transcription Polymerase Chain Reaction

    Intracellular UBP replication a , Structure of pACS and pINF. d X and d Y correspond to d NaM and a d 5SICS analog 22 that facilitated plasmid construction (see Methods). cloDF = origin of replication; Sm = streptomycin resistance gene; AmpR = ampicillin resistance gene; ori = ColE1 origin of replication; MCS = multiple cloning site; lacZα = β-galactosidase fragment gene. b , Overview of pINF construction. A DNA fragment containing the unnatural nucleotide was synthesized via solid phase DNA synthesis and then used to assemble synthetic pINF via circular-extension PCR 29 . X = d NaM , Y’ = d TPT3 (an analog of d 5SICS 22 ), and Y = d 5SICS (see text). Color indicates regions of homology. The doubly-nicked product was used directly to transform E. coli harboring pACS. c , The addition of d 5SICS TP and d NaM TP eliminates a growth lag of cells harboring pINF. EP=electroporation. Errors represent s.d. of the mean, n =3. d , LC-MS/MS total ion chromatogram of global nucleoside content in pINF and pUC19 recorded in Dynamic Multiple Reaction Monitoring (DMRM) mode. pINF and pUC19 (control) were propagated in E. coli in the presence or absence of unnatural triphosphates, and with or without Pt NTT2 induction. The inset shows a 100× expansion of the mass count axis in the d 5SICS region. e , Biotinylation only occurs in the presence of the UBP, the unnatural triphosphates, and transporter induction. After growth, pINF was recovered, and a 194 nt region containing the site of UBP incorporation (nt 437–630) was amplified and biotinylated. B=biotin; SA=streptavidin. The natural pUC19 control plasmid was prepared identically to pINF. 50-bp DNA ladder is shown to the left. f , Sequencing analysis demonstrates retention of the UBP. An abrupt termination in the Sanger sequencing reaction indicates the presence of UBP incorporation (site indicated with arrow).

    Journal: Nature

    Article Title: A Semi-Synthetic Organism with an Expanded Genetic Alphabet

    doi: 10.1038/nature13314

    Figure Lengend Snippet: Intracellular UBP replication a , Structure of pACS and pINF. d X and d Y correspond to d NaM and a d 5SICS analog 22 that facilitated plasmid construction (see Methods). cloDF = origin of replication; Sm = streptomycin resistance gene; AmpR = ampicillin resistance gene; ori = ColE1 origin of replication; MCS = multiple cloning site; lacZα = β-galactosidase fragment gene. b , Overview of pINF construction. A DNA fragment containing the unnatural nucleotide was synthesized via solid phase DNA synthesis and then used to assemble synthetic pINF via circular-extension PCR 29 . X = d NaM , Y’ = d TPT3 (an analog of d 5SICS 22 ), and Y = d 5SICS (see text). Color indicates regions of homology. The doubly-nicked product was used directly to transform E. coli harboring pACS. c , The addition of d 5SICS TP and d NaM TP eliminates a growth lag of cells harboring pINF. EP=electroporation. Errors represent s.d. of the mean, n =3. d , LC-MS/MS total ion chromatogram of global nucleoside content in pINF and pUC19 recorded in Dynamic Multiple Reaction Monitoring (DMRM) mode. pINF and pUC19 (control) were propagated in E. coli in the presence or absence of unnatural triphosphates, and with or without Pt NTT2 induction. The inset shows a 100× expansion of the mass count axis in the d 5SICS region. e , Biotinylation only occurs in the presence of the UBP, the unnatural triphosphates, and transporter induction. After growth, pINF was recovered, and a 194 nt region containing the site of UBP incorporation (nt 437–630) was amplified and biotinylated. B=biotin; SA=streptavidin. The natural pUC19 control plasmid was prepared identically to pINF. 50-bp DNA ladder is shown to the left. f , Sequencing analysis demonstrates retention of the UBP. An abrupt termination in the Sanger sequencing reaction indicates the presence of UBP incorporation (site indicated with arrow).

    Article Snippet: Plasmids pUC19 and pCDF-1b were obtained from Thermo Scientific and EMD Millipore, respectively.

    Techniques: Plasmid Preparation, Clone Assay, Synthesized, DNA Synthesis, Polymerase Chain Reaction, Electroporation, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Amplification, Sequencing

    DNA gyrase behavior depends on a DNA substrate gyrase binding score. ( A ) EMSA analysis of DNA gyrase binding with 133 bp fragments; fragments scores are showed above the pictures; molar gyrase/DNA ratio is indicated under the lanes. SC—scrambled consensus, C—consensus. ( B ) Time-course of gyrase supercoiling of pUC19 plasmids harboring indicated 133 bp fragments; RE—relaxed plasmid, NSC—negatively supercoiled plasmid. 1—scrambled consensus, 2—Mu SGS, 3—consensus. ( C ) Time-course of ATP-independent relaxation of pUC19 plasmids harbouring indicated 133 bp fragments. ( D ) Time-course of ATP-dependent relaxation of the same plasmids by truncated GyrA59 2 GyrB 2 gyrase lacking CTD.

    Journal: Nucleic Acids Research

    Article Title: Single-nucleotide-resolution mapping of DNA gyrase cleavage sites across the Escherichia coli genome

    doi: 10.1093/nar/gky1222

    Figure Lengend Snippet: DNA gyrase behavior depends on a DNA substrate gyrase binding score. ( A ) EMSA analysis of DNA gyrase binding with 133 bp fragments; fragments scores are showed above the pictures; molar gyrase/DNA ratio is indicated under the lanes. SC—scrambled consensus, C—consensus. ( B ) Time-course of gyrase supercoiling of pUC19 plasmids harboring indicated 133 bp fragments; RE—relaxed plasmid, NSC—negatively supercoiled plasmid. 1—scrambled consensus, 2—Mu SGS, 3—consensus. ( C ) Time-course of ATP-independent relaxation of pUC19 plasmids harbouring indicated 133 bp fragments. ( D ) Time-course of ATP-dependent relaxation of the same plasmids by truncated GyrA59 2 GyrB 2 gyrase lacking CTD.

    Article Snippet: For EMSA and competition assays DNA fragments were PCR amplified using pUC19_for and pUC19_rev primers ( ) and purified with Gel Extraction and DNA Cleanup Micro Kit (Thermo Scientific).

    Techniques: Binding Assay, Plasmid Preparation