puc19  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    pUC19 DNA
    Description:
    Ambion pUC 19 DNA is digested to completion with Sau3A I yielding fragments of 955, 585, 341, 258, 141, 105, 78, 75, 46, 36, 18, 17, 12, 11, and 8 bp. The markers are visualized by staining with ethidium bromide. Alternatively, they may be radioactively end-labeled with Exo- Klenow or T4 Polynucleotide Kinase. One tube containing 50 μg is provided.
    Catalog Number:
    AM7760
    Price:
    None
    Applications:
    Agarose Gel Electrophoresis|DNA & RNA Purification & Analysis|Pour Your Own Agarose Gels|Nucleic Acid Gel Electrophoresis & Blotting
    Size:
    50 µg
    Category:
    Standards, Ladders & Controls, DNA⁄RNA Ladders, DNA Ladders
    Score:
    85
    Buy from Supplier
    Name:
    pUC19 DNA/MspI (HpaII) Marker
    Description:
    Thermo Scientific pUC19 DNA/MspI (HpaII) Marker is recommended for sizing and approximate quantification of small linear double-stranded DNA fragments in agarose and non-denaturing polyacrylamide gels. pUC19 DNA is digested to completion with the appropriate Thermo Scientific restriction enzyme, then purified and dissolved in storage buffer. The DNA fragments contain blunt or sticky ends, depending on the restriction enzyme used for the markers preparation.Highlights• Sizing and approximate quantification of small DNA fragments• Sharp bands• Supplied with loading dye for sample DNANoteBands at 501 bp and 489 bp form an anomalous pattern on polyacrylamide gels. The shortest fragments (oblique) are not visible in standard electrophoresis. Fragment lengths are predicted by computer analysis of the respective DNA sequences.
    Catalog Number:
    SM0221
    Price:
    None
    Applications:
    Agarose Gel Electrophoresis|DNA & RNA Purification & Analysis|Nucleic Acid Gel Electrophoresis & Blotting
    Size:
    50 µg
    Category:
    Standards, Ladders & Controls, DNA⁄RNA Ladders, DNA Ladders
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher puc19
    (A) Methylation of 5′-GATC-3′ sequence in the DNA of various strains of S. suis . Total DNAs from the following strains were treated with two complementary restriction endonucleases and analyzed by agarose gel electrophoresis: Lane 1, NCTC10234; lane 2, DAT1; lane 3, 204; lane 4, 205; lane 5, 207; lane 6, 211; lane 7, 213; lane 8, 220. D, digested with Dpn I (specific for methylated sequence); M, digested with Mbo I (specific for unmethylated sequence). S, 1-kb ladder DNA size standards (GIBCO/BRL). (B) DNA cleavage activities of S. suis crude extracts using the total DNAs of S. suis NCTC10234 (N, unmethylated DNA) and DAT1 (D, methylated DNA) as substrates. Lane numbers for the strains from which the crude extracts were prepared are the same as in panel A. S, 1-kb ladder size standards (GIBCO/BRL). (C) Restriction cleavage activities of the crude extracts using unmethylated <t>pUC19</t> as the substrate. The lane numbers of the strains from which the crude extracts were prepared match those in panel B. M, pUC19 digested with Mbo I; S, 100-bp ladder size standards (GIBCO/BRL); Chr, contaminating chromosomal DNA.
    Thermo Scientific pUC19 DNA/MspI (HpaII) Marker is recommended for sizing and approximate quantification of small linear double-stranded DNA fragments in agarose and non-denaturing polyacrylamide gels. pUC19 DNA is digested to completion with the appropriate Thermo Scientific restriction enzyme, then purified and dissolved in storage buffer. The DNA fragments contain blunt or sticky ends, depending on the restriction enzyme used for the markers preparation.Highlights• Sizing and approximate quantification of small DNA fragments• Sharp bands• Supplied with loading dye for sample DNANoteBands at 501 bp and 489 bp form an anomalous pattern on polyacrylamide gels. The shortest fragments (oblique) are not visible in standard electrophoresis. Fragment lengths are predicted by computer analysis of the respective DNA sequences.
    https://www.bioz.com/result/puc19/product/Thermo Fisher
    Average 99 stars, based on 38 article reviews
    Price from $9.99 to $1999.99
    puc19 - by Bioz Stars, 2019-10
    99/100 stars

    Images

    1) Product Images from "Evidence for Horizontal Transfer of SsuDAT1I Restriction-Modification Genes to the Streptococcus suis Genome"

    Article Title: Evidence for Horizontal Transfer of SsuDAT1I Restriction-Modification Genes to the Streptococcus suis Genome

    Journal:

    doi: 10.1128/JB.183.2.500-511.2001

    (A) Methylation of 5′-GATC-3′ sequence in the DNA of various strains of S. suis . Total DNAs from the following strains were treated with two complementary restriction endonucleases and analyzed by agarose gel electrophoresis: Lane 1, NCTC10234; lane 2, DAT1; lane 3, 204; lane 4, 205; lane 5, 207; lane 6, 211; lane 7, 213; lane 8, 220. D, digested with Dpn I (specific for methylated sequence); M, digested with Mbo I (specific for unmethylated sequence). S, 1-kb ladder DNA size standards (GIBCO/BRL). (B) DNA cleavage activities of S. suis crude extracts using the total DNAs of S. suis NCTC10234 (N, unmethylated DNA) and DAT1 (D, methylated DNA) as substrates. Lane numbers for the strains from which the crude extracts were prepared are the same as in panel A. S, 1-kb ladder size standards (GIBCO/BRL). (C) Restriction cleavage activities of the crude extracts using unmethylated pUC19 as the substrate. The lane numbers of the strains from which the crude extracts were prepared match those in panel B. M, pUC19 digested with Mbo I; S, 100-bp ladder size standards (GIBCO/BRL); Chr, contaminating chromosomal DNA.
    Figure Legend Snippet: (A) Methylation of 5′-GATC-3′ sequence in the DNA of various strains of S. suis . Total DNAs from the following strains were treated with two complementary restriction endonucleases and analyzed by agarose gel electrophoresis: Lane 1, NCTC10234; lane 2, DAT1; lane 3, 204; lane 4, 205; lane 5, 207; lane 6, 211; lane 7, 213; lane 8, 220. D, digested with Dpn I (specific for methylated sequence); M, digested with Mbo I (specific for unmethylated sequence). S, 1-kb ladder DNA size standards (GIBCO/BRL). (B) DNA cleavage activities of S. suis crude extracts using the total DNAs of S. suis NCTC10234 (N, unmethylated DNA) and DAT1 (D, methylated DNA) as substrates. Lane numbers for the strains from which the crude extracts were prepared are the same as in panel A. S, 1-kb ladder size standards (GIBCO/BRL). (C) Restriction cleavage activities of the crude extracts using unmethylated pUC19 as the substrate. The lane numbers of the strains from which the crude extracts were prepared match those in panel B. M, pUC19 digested with Mbo I; S, 100-bp ladder size standards (GIBCO/BRL); Chr, contaminating chromosomal DNA.

    Techniques Used: Methylation, Sequencing, Agarose Gel Electrophoresis

    2) Product Images from "Novel Type of Hepatitis B Virus Mutation: Replacement Mutation Involving a Hepatocyte Nuclear Factor 1 Binding Site Tandem Repeat in Chronic Hepatitis B Virus Genotype E"

    Article Title: Novel Type of Hepatitis B Virus Mutation: Replacement Mutation Involving a Hepatocyte Nuclear Factor 1 Binding Site Tandem Repeat in Chronic Hepatitis B Virus Genotype E

    Journal:

    doi: 10.1128/JVI.79.22.14404-14410.2005

    Intracellular localization of HBcAg (magnification, ×400). Immunofluorescence staining of HBcAg in HuH-7 cells transfected with (a) pUC19-HBV/E wild-type replicon and (c) pUC19-HBV/E replacement replicon. (b and d) Nuclear staining for the same
    Figure Legend Snippet: Intracellular localization of HBcAg (magnification, ×400). Immunofluorescence staining of HBcAg in HuH-7 cells transfected with (a) pUC19-HBV/E wild-type replicon and (c) pUC19-HBV/E replacement replicon. (b and d) Nuclear staining for the same

    Techniques Used: Immunofluorescence, Staining, Transfection

    (A) Southern blot analysis of intracellular replication competence of replacement mutation with HNF1 site. Double-stranded (DS) DNA and single-stranded (SS) DNA are indicated by arrows. The pUC19-HBV/E replacement replicon (lane 2) replicates at a much
    Figure Legend Snippet: (A) Southern blot analysis of intracellular replication competence of replacement mutation with HNF1 site. Double-stranded (DS) DNA and single-stranded (SS) DNA are indicated by arrows. The pUC19-HBV/E replacement replicon (lane 2) replicates at a much

    Techniques Used: Southern Blot, Mutagenesis

    3) Product Images from "Mlh1-Mlh3, a Meiotic Crossover and DNA Mismatch Repair Factor, Is a Msh2-Msh3-stimulated Endonuclease"

    Article Title: Mlh1-Mlh3, a Meiotic Crossover and DNA Mismatch Repair Factor, Is a Msh2-Msh3-stimulated Endonuclease

    Journal:

    doi: 10.1074/jbc.M113.534644

    Mlh1-Mlh3 displays an endonuclease activity on supercoiled DNA substrates. See “Experimental Procedures” for details. A , Mlh1-Mlh3 (100, 150, 200, 250, and 300 n m ) was incubated with linearized pUC19 DNA, resolved, and analyzed as described under “Experimental Procedures.” Ladder , 1 kb of DNA ladder (New England Biolabs). B , comparison of the nicking activity of Mlh1-Mlh3 ( wt ) and Mlh1-mlh3-D523N ( D523N ) in the presence of 1 m m Mn2+ on supercoiled pUC19. Mlh1-Mlh3 is at 150 n m in lanes 3 and 4 . In lanes 5–9 , Mlh1-Mlh3 is at 50, 150, 200, 250, and 300 n m , respectively. In lanes 10 and 11 Mlh1-Mlh3 D523N is at 150 and 300 n m , respectively. Migration of supercoiled ( sc ) and nicked ( n ) DNA is indicated. The linear product is indicated by a black triangle. C , immunodepletion analysis of Mlh1(FLAG)-Mlh3(HA). Mlh1(FLAG)-Mlh3(HA) was incubated with either Protein A-linked mouse anti-FLAG antibodies ( anti-FLAG ) or control mouse IgG ( Control ). The immunodepleted supernatants were then assayed for endonuclease activity. D , Mlh1-Mlh3 endonuclease activity is stimulated by a variety of divalent cations. Nicking activity of Mlh1-Mlh3 (150 n m ) in the presence of 1 m m Mg2+ , Mn2+ , Zn2+ , Cd2+ , Co2+ , Ca2+ , or Ni2+ is indicated ( left ). Stimulation of the Mlh1-Mlh3 endonuclease activity in the presence of 1 m m Mn2+ by a second divalent metal ion (1 m m ) ( right ) is shown.
    Figure Legend Snippet: Mlh1-Mlh3 displays an endonuclease activity on supercoiled DNA substrates. See “Experimental Procedures” for details. A , Mlh1-Mlh3 (100, 150, 200, 250, and 300 n m ) was incubated with linearized pUC19 DNA, resolved, and analyzed as described under “Experimental Procedures.” Ladder , 1 kb of DNA ladder (New England Biolabs). B , comparison of the nicking activity of Mlh1-Mlh3 ( wt ) and Mlh1-mlh3-D523N ( D523N ) in the presence of 1 m m Mn2+ on supercoiled pUC19. Mlh1-Mlh3 is at 150 n m in lanes 3 and 4 . In lanes 5–9 , Mlh1-Mlh3 is at 50, 150, 200, 250, and 300 n m , respectively. In lanes 10 and 11 Mlh1-Mlh3 D523N is at 150 and 300 n m , respectively. Migration of supercoiled ( sc ) and nicked ( n ) DNA is indicated. The linear product is indicated by a black triangle. C , immunodepletion analysis of Mlh1(FLAG)-Mlh3(HA). Mlh1(FLAG)-Mlh3(HA) was incubated with either Protein A-linked mouse anti-FLAG antibodies ( anti-FLAG ) or control mouse IgG ( Control ). The immunodepleted supernatants were then assayed for endonuclease activity. D , Mlh1-Mlh3 endonuclease activity is stimulated by a variety of divalent cations. Nicking activity of Mlh1-Mlh3 (150 n m ) in the presence of 1 m m Mg2+ , Mn2+ , Zn2+ , Cd2+ , Co2+ , Ca2+ , or Ni2+ is indicated ( left ). Stimulation of the Mlh1-Mlh3 endonuclease activity in the presence of 1 m m Mn2+ by a second divalent metal ion (1 m m ) ( right ) is shown.

    Techniques Used: Activity Assay, Incubation, Migration

    Mlh1-Mlh3 endonuclease activity is unaffected by ATP. A, endonuclease activity of Mlh1-Mlh3 (120 n m ) on supercoiled ( sc ) pUC19 DNA in the presence of various concentrations of ATP. + indicates an ATP concentration of 500 μ m , and in lanes 8–10 ATP concentrations were 30, 100, 500 μ m , respectively. Mg2+ and Mn2+ are present at 1 m m as indicated. The % of supercoiled substrate that was cleaved is indicated. n , nicked. B , endonuclease assays were performed in the same reactions as in A but contained 1 m m Mg2+ (Mn2+ is not present) and 0.5 m m ATP or GTP. nt , nucleotide. C , ATPase activity of Mlh1-Mlh3 in the presence of a 10-fold excess of single-stranded ( ssDNA ) and double-stranded ( dsDNA ) oligonucleotides or supercoiled plasmid. See “Experimental Procedures” for details. D , endonuclease activity of yMlh1-Mlh3 was not stimulated by yeast RFC ( yRFC ) or yeast PCNA ( yPCNA ). Lanes are from 1–17 , left to right . In lanes 1–8 , hMlh1-Pms2 (60 n m ) was incubated with RFC (100 n m ) and PCNA (100 n m ) with and without 500 μ m ATP. In lanes 9–16 , yMlh1-Mlh3 (120 n m ) was incubated with RFC (200 n m ) and PCNA (200 n m ) as indicated with and without 500 μ m ATP. Lane 17 contains 200 n m RFC, 200 n m PCNA, and 500 μ m ATP in the absence of yMlh1-Mlh3.
    Figure Legend Snippet: Mlh1-Mlh3 endonuclease activity is unaffected by ATP. A, endonuclease activity of Mlh1-Mlh3 (120 n m ) on supercoiled ( sc ) pUC19 DNA in the presence of various concentrations of ATP. + indicates an ATP concentration of 500 μ m , and in lanes 8–10 ATP concentrations were 30, 100, 500 μ m , respectively. Mg2+ and Mn2+ are present at 1 m m as indicated. The % of supercoiled substrate that was cleaved is indicated. n , nicked. B , endonuclease assays were performed in the same reactions as in A but contained 1 m m Mg2+ (Mn2+ is not present) and 0.5 m m ATP or GTP. nt , nucleotide. C , ATPase activity of Mlh1-Mlh3 in the presence of a 10-fold excess of single-stranded ( ssDNA ) and double-stranded ( dsDNA ) oligonucleotides or supercoiled plasmid. See “Experimental Procedures” for details. D , endonuclease activity of yMlh1-Mlh3 was not stimulated by yeast RFC ( yRFC ) or yeast PCNA ( yPCNA ). Lanes are from 1–17 , left to right . In lanes 1–8 , hMlh1-Pms2 (60 n m ) was incubated with RFC (100 n m ) and PCNA (100 n m ) with and without 500 μ m ATP. In lanes 9–16 , yMlh1-Mlh3 (120 n m ) was incubated with RFC (200 n m ) and PCNA (200 n m ) as indicated with and without 500 μ m ATP. Lane 17 contains 200 n m RFC, 200 n m PCNA, and 500 μ m ATP in the absence of yMlh1-Mlh3.

    Techniques Used: Activity Assay, Concentration Assay, Plasmid Preparation, Incubation

    4) Product Images from "Folding of Hepatitis C Virus E1 Glycoprotein in a Cell-Free System"

    Article Title: Folding of Hepatitis C Virus E1 Glycoprotein in a Cell-Free System

    Journal:

    doi: 10.1128/JVI.75.22.11205-11217.2001

    Recombinant plasmids and DNA templates. Plasmids pUC19.HCV1 and pTM E1–1615 were used as templates for DNA amplification and subsequent RNA synthesis. Amplified products are diagrammed, their designations are given on the right. IC, plasmid pUC-HCV-1PC. Numbers in designations correspond to the last amino acid of the HCV polypeptide (HCV-1 strain) included in the construct and followed by a stop codon. nt, 341-bp nontranslated region of HCV; EMCV, internal ribosomal entry site sequence carried by the pTM1 vector . Oligonucleotides used for the amplification procedure are described in Materials and Methods. RNA was synthesized by using a T7 polymerase kit.
    Figure Legend Snippet: Recombinant plasmids and DNA templates. Plasmids pUC19.HCV1 and pTM E1–1615 were used as templates for DNA amplification and subsequent RNA synthesis. Amplified products are diagrammed, their designations are given on the right. IC, plasmid pUC-HCV-1PC. Numbers in designations correspond to the last amino acid of the HCV polypeptide (HCV-1 strain) included in the construct and followed by a stop codon. nt, 341-bp nontranslated region of HCV; EMCV, internal ribosomal entry site sequence carried by the pTM1 vector . Oligonucleotides used for the amplification procedure are described in Materials and Methods. RNA was synthesized by using a T7 polymerase kit.

    Techniques Used: Recombinant, Amplification, Plasmid Preparation, Construct, Sequencing, Synthesized

    5) Product Images from "Comparative Analysis of the Recently Discovered hAT Transposon TcBuster in Human Cells"

    Article Title: Comparative Analysis of the Recently Discovered hAT Transposon TcBuster in Human Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0042666

    Comparison of piggyBac , TcBuster , and Tol2 at varying transposase: transposon ratios. HEK-293 cells in 6-well plates were transfected in triplicate with the indicated amount of transposase helper plasmid (+) or pUC19 (−) and plasmids carrying the neomycin-resistance transposon for each system. The amount of transposon plasmid transfected was 200 ng ( a ), 500 ng ( b ), or 900 ng ( c ). In c , the piggyBac (+) transposase plates had approximately 1000 colonies, too many to count (TMTC). Cells were diluted 1∶750 onto 10 cm plates in media containing geneticin for selection and incubated for two weeks to allow drug-resistant cells to form colonies that were fixed, stained and counted. Error bars represent the SEM (n = 3).
    Figure Legend Snippet: Comparison of piggyBac , TcBuster , and Tol2 at varying transposase: transposon ratios. HEK-293 cells in 6-well plates were transfected in triplicate with the indicated amount of transposase helper plasmid (+) or pUC19 (−) and plasmids carrying the neomycin-resistance transposon for each system. The amount of transposon plasmid transfected was 200 ng ( a ), 500 ng ( b ), or 900 ng ( c ). In c , the piggyBac (+) transposase plates had approximately 1000 colonies, too many to count (TMTC). Cells were diluted 1∶750 onto 10 cm plates in media containing geneticin for selection and incubated for two weeks to allow drug-resistant cells to form colonies that were fixed, stained and counted. Error bars represent the SEM (n = 3).

    Techniques Used: Transfection, Plasmid Preparation, Selection, Incubation, Staining

    The effect of transposon and transposase plasmid dose on the number of drug-resistant colonies formed. ( a ) HEK-293 cells in 6-well plates were transfected in triplicate with either 12.5 ng (light grey bars), 50 ng (dark grey bars), or 500 ng (black bars) of pTcBNeo carrying the neomycin-resistance transposon and 0 ng, 100 ng, 250 ng, or 500 ng of pCMV- TcBuster expressing the transposase. ( b ) HEK-293 cells in 6-well plates were transfected in triplicate with 500 ng of pTcBNeo plasmid carrying the neomycin-resistance transposon and the indicated amount of pCMV- TcBuster (0.5 ng, 1 ng, 5 ng, 10 ng, 25 ng, 50 ng, 100 ng, 250 ng, or 500 ng). In both a and b , pUC19 was used as filler DNA to increase the total amount of DNA transfected to 1 µg. Cells were diluted 1∶750 in selection media and grown for two weeks to allow drug-resistant cells to multiply and form colonies. The colonies were fixed, stained, and counted. The mean and standard error of the mean (SEM; n = 3) are shown.
    Figure Legend Snippet: The effect of transposon and transposase plasmid dose on the number of drug-resistant colonies formed. ( a ) HEK-293 cells in 6-well plates were transfected in triplicate with either 12.5 ng (light grey bars), 50 ng (dark grey bars), or 500 ng (black bars) of pTcBNeo carrying the neomycin-resistance transposon and 0 ng, 100 ng, 250 ng, or 500 ng of pCMV- TcBuster expressing the transposase. ( b ) HEK-293 cells in 6-well plates were transfected in triplicate with 500 ng of pTcBNeo plasmid carrying the neomycin-resistance transposon and the indicated amount of pCMV- TcBuster (0.5 ng, 1 ng, 5 ng, 10 ng, 25 ng, 50 ng, 100 ng, 250 ng, or 500 ng). In both a and b , pUC19 was used as filler DNA to increase the total amount of DNA transfected to 1 µg. Cells were diluted 1∶750 in selection media and grown for two weeks to allow drug-resistant cells to multiply and form colonies. The colonies were fixed, stained, and counted. The mean and standard error of the mean (SEM; n = 3) are shown.

    Techniques Used: Plasmid Preparation, Transfection, Expressing, Selection, Staining

    6) Product Images from "Structural and Functional Analysis of the Symmetrical Type I Restriction Endonuclease R.EcoR124INT"

    Article Title: Structural and Functional Analysis of the Symmetrical Type I Restriction Endonuclease R.EcoR124INT

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0035263

    DNA cleavage of supercoiled and linear DNA with one or two R.EcoR124I NT recognition sites. (a) Diagrammatic representation of the DNA substrates used: pUC19 (left) and pTK-neo (right). (b) Restriction assay. The endonuclease was incubated with DNA substrates containing either one or two recognition sites, both supercoiled and linear. Reactions were carried at 37°C and stopped with the addition of 0.5 M EDTA at 1, 5, 15 and 120 minutes. Reactions were run on a 0.8% TBE agarose gel with a 1kb DNA marker (NEB). (c) Densitometry scan of the reaction product of R.EcoR124I NT incubated with two-site linear DNA. (d) Kinetics of cleavage of supercoiled DNA with two recognition sites (pUC19). Reaction products were analysed on a 0.8% TBE agarose gel. Reactions were carried at 37°C and stopped with the addition of 0.5 M EDTA at the time points shown over the range 10–300 secs. M represents a 1kb DNA marker (NEB). (e) Quantitation of supercoiled DNA (blue), nicked circle (red) and linear DNA (green) over the time-course of the reaction, by analysis of the data shown in (d).
    Figure Legend Snippet: DNA cleavage of supercoiled and linear DNA with one or two R.EcoR124I NT recognition sites. (a) Diagrammatic representation of the DNA substrates used: pUC19 (left) and pTK-neo (right). (b) Restriction assay. The endonuclease was incubated with DNA substrates containing either one or two recognition sites, both supercoiled and linear. Reactions were carried at 37°C and stopped with the addition of 0.5 M EDTA at 1, 5, 15 and 120 minutes. Reactions were run on a 0.8% TBE agarose gel with a 1kb DNA marker (NEB). (c) Densitometry scan of the reaction product of R.EcoR124I NT incubated with two-site linear DNA. (d) Kinetics of cleavage of supercoiled DNA with two recognition sites (pUC19). Reaction products were analysed on a 0.8% TBE agarose gel. Reactions were carried at 37°C and stopped with the addition of 0.5 M EDTA at the time points shown over the range 10–300 secs. M represents a 1kb DNA marker (NEB). (e) Quantitation of supercoiled DNA (blue), nicked circle (red) and linear DNA (green) over the time-course of the reaction, by analysis of the data shown in (d).

    Techniques Used: Restriction Assay, Incubation, Agarose Gel Electrophoresis, Marker, Quantitation Assay

    7) Product Images from "A simple and efficient method to visualize and quantify the efficiency of chromosomal mutations from genome editing"

    Article Title: A simple and efficient method to visualize and quantify the efficiency of chromosomal mutations from genome editing

    Journal: Scientific Reports

    doi: 10.1038/srep35488

    A construct containing mCherry and GFP coding regions separated by an in frame linker sequence allows the expression of a fusion protein in which the mCherry and GFP moieties fluoresce independently in bacteria. Top panel: Schematic representation of a plasmid construct for in-frame expression of mCherry and GFP (pmCherry-GFP). A sequence derived from pUC19 that contains multi-cloning sites (MCS) was inserted in between the mCherry and GFP coding regions under the control of the promoter of the bacterial lac operon (Plac). The inserted MCS sequence allows in frame translation of both mCherry and GFP separated by a linker peptide encoded by the MCS as shown. Bottom panel: When transfected into bacteria, pmCherry-GFP allows the expression of a fusion protein with both the mCherry and GFP moieties functioning independently. Bacteria were transformed with empty vector pUC19 (a), constructs expressing only mCherry (b) or GFP (c), or pmCherry-GFP (d), respectively. The transformed bacteria were plated and imaged in the bright field ( A ), or under a fluorescent microscope for red fluorescence ( B ) and green fluorescence ( C ), respectively. Red and green fluorescent imagines were merged in ( D ). Note that when transformed with pmCherry-GFP, both mCherry and GFP were functional, leading to a merged yellow image.
    Figure Legend Snippet: A construct containing mCherry and GFP coding regions separated by an in frame linker sequence allows the expression of a fusion protein in which the mCherry and GFP moieties fluoresce independently in bacteria. Top panel: Schematic representation of a plasmid construct for in-frame expression of mCherry and GFP (pmCherry-GFP). A sequence derived from pUC19 that contains multi-cloning sites (MCS) was inserted in between the mCherry and GFP coding regions under the control of the promoter of the bacterial lac operon (Plac). The inserted MCS sequence allows in frame translation of both mCherry and GFP separated by a linker peptide encoded by the MCS as shown. Bottom panel: When transfected into bacteria, pmCherry-GFP allows the expression of a fusion protein with both the mCherry and GFP moieties functioning independently. Bacteria were transformed with empty vector pUC19 (a), constructs expressing only mCherry (b) or GFP (c), or pmCherry-GFP (d), respectively. The transformed bacteria were plated and imaged in the bright field ( A ), or under a fluorescent microscope for red fluorescence ( B ) and green fluorescence ( C ), respectively. Red and green fluorescent imagines were merged in ( D ). Note that when transformed with pmCherry-GFP, both mCherry and GFP were functional, leading to a merged yellow image.

    Techniques Used: Construct, Sequencing, Expressing, Plasmid Preparation, Derivative Assay, Clone Assay, Transfection, Transformation Assay, Microscopy, Fluorescence, Functional Assay

    8) Product Images from "A One-Step Miniprep for the Isolation of Plasmid DNA and Lambda Phage Particles"

    Article Title: A One-Step Miniprep for the Isolation of Plasmid DNA and Lambda Phage Particles

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0023457

    Elevated temperatures and osmolytes increase the efficiency of plasmid DNA extraction by NIDs. Extractions of either pUC19 (lanes 1–8 and 10–15) or pCYPAC3 plasmids (lane 9) were carried out. Transformed DH5α cells were grown in 1.5 ml LB cultures and resuspended in 150 µl 50 mM Tris pH 8, 10 mM EDTA with or without co-solutes. 500 µg/ml lysozyme was also added, and the cells were incubated as specified below. Salt concentrations were adjusted to 0.5 M NaCl in all extracts, except the ones loaded in lanes 10 and 12–15. Extracts were cleared by centrifugation, and precipitated with 150 µl isopropanol. DNA pellets were dissolved in 40 µl TE buffer, 40 µg/ml RNase A. 10 µl aliquots of the solutions containing either the pCYPAC3 (lane 9) or pUC19 plasmids (all other lanes) were loaded on the gel. Exposure times and temperatures of extraction are shown above the lanes. For lanes 1–9, extraction with the indicated NID was done in the absence of co-solutes. For lanes 10–15, the included co-solute is indicated. Lane 1: 0.5% IGEPAL CA-630. Lane 2: 0.5% TX-100. Lane 3: 0.5% IGEPAL CA-720. Lane 4: 0.5% Tween-80. Lane 5: 0.5% Tween-20. Lane 6: 2% IGEPAL CA-720. Lane 7: 4% IGEPAL CA-720. Lane 8: 0.5% Tween 80. Lane 9: 0.5% Tween 80. Lane 10: 0.5% Tween 20/0.5 M KCl. Lane 11: 0.5% Tween 20/22.5% sucrose. Lane 12: 0.5% IGEPAL CA-630/0.5 M NH 4 Cl. Lane 13: 0.5% TX-100/0.5 M NH 4 Cl. Lane 14: 0.5% TX-100/0.5 M NaCl. Lane 15: 0.5% TX-100/0.5 M NaAc.
    Figure Legend Snippet: Elevated temperatures and osmolytes increase the efficiency of plasmid DNA extraction by NIDs. Extractions of either pUC19 (lanes 1–8 and 10–15) or pCYPAC3 plasmids (lane 9) were carried out. Transformed DH5α cells were grown in 1.5 ml LB cultures and resuspended in 150 µl 50 mM Tris pH 8, 10 mM EDTA with or without co-solutes. 500 µg/ml lysozyme was also added, and the cells were incubated as specified below. Salt concentrations were adjusted to 0.5 M NaCl in all extracts, except the ones loaded in lanes 10 and 12–15. Extracts were cleared by centrifugation, and precipitated with 150 µl isopropanol. DNA pellets were dissolved in 40 µl TE buffer, 40 µg/ml RNase A. 10 µl aliquots of the solutions containing either the pCYPAC3 (lane 9) or pUC19 plasmids (all other lanes) were loaded on the gel. Exposure times and temperatures of extraction are shown above the lanes. For lanes 1–9, extraction with the indicated NID was done in the absence of co-solutes. For lanes 10–15, the included co-solute is indicated. Lane 1: 0.5% IGEPAL CA-630. Lane 2: 0.5% TX-100. Lane 3: 0.5% IGEPAL CA-720. Lane 4: 0.5% Tween-80. Lane 5: 0.5% Tween-20. Lane 6: 2% IGEPAL CA-720. Lane 7: 4% IGEPAL CA-720. Lane 8: 0.5% Tween 80. Lane 9: 0.5% Tween 80. Lane 10: 0.5% Tween 20/0.5 M KCl. Lane 11: 0.5% Tween 20/22.5% sucrose. Lane 12: 0.5% IGEPAL CA-630/0.5 M NH 4 Cl. Lane 13: 0.5% TX-100/0.5 M NH 4 Cl. Lane 14: 0.5% TX-100/0.5 M NaCl. Lane 15: 0.5% TX-100/0.5 M NaAc.

    Techniques Used: Plasmid Preparation, DNA Extraction, Transformation Assay, Incubation, Centrifugation

    Related Articles

    Acetylene Reduction Assay:

    Article Title: Evidence for Horizontal Transfer of SsuDAT1I Restriction-Modification Genes to the Streptococcus suis Genome
    Article Snippet: E. coli strains used were SCS110 ( thr leu endA thi-1 lacY galK galT ara tonA tsx dam dcm supE44 rpsL Δ( lac-proAB ) [F′ traD36 proAB lacI q Z ΔM15]) (Stratagene, La Jolla, Calif.), C600 (F− thr-1 thi-1 leuB6 lacY1 tonA21 supE44 ) , XL-1 blue MRF′ [Δ( mcrA ) 183 Δ( mcrCB-hsdSMR-mrr ) 173 endA1 supE44 thi-1 recA1 gyrA96 relA1 lac [F′ proAB lacI q Z ΔM15 Tn 10 ]) (Stratagene), XLOLR {Δ( mcrA ) 183 Δ( mcrCB-hsdSMR-mrr ) 173 endA1 thi-1 recA1 gyrA96 relA1 lac [F′ proAB lacI q Z ΔM15 Tn 10 ] Su− λ− } (Stratagene), and DH5α (F− endA1 recA1 hsdR17 (rK − mK + ) supE44 thi-1 gyrA relA1 φ80 lacZ ΔM15 Δ( lacZYA-argF ) deoR + ) ( ). .. The plasmid vectors used for gene cloning were pUC19 , pCR2.1 (Invitrogen, Groningen, The Netherlands), and pHSG576 ( ).

    Centrifugation:

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: The genes were cloned into the EcoRI and HindIII (New England BioLabs GmbH, Frankfurt am Main, Germany) sites in pUC19 (T4 ligase; Thermo Fisher Scientific). .. The genes were cloned into the EcoRI and HindIII (New England BioLabs GmbH, Frankfurt am Main, Germany) sites in pUC19 (T4 ligase; Thermo Fisher Scientific).

    Amplification:

    Article Title: Comparative Analysis of the Recently Discovered hAT Transposon TcBuster in Human Cells
    Article Snippet: All plasmids were prepared for assays by endotoxin-free maxiprep (Qiagen, Valencia, CA). pUC19 (Invitrogen, Carlsbad, CA) was used as filler plasmid DNA for the FuGene6 transfections. .. The helper plasmids are based on pcDNA3.1/myc-HisA (Invitrogen) and contain the CMV promoter controlling transposase coding sequence.

    Article Title: Novel Type of Hepatitis B Virus Mutation: Replacement Mutation Involving a Hepatocyte Nuclear Factor 1 Binding Site Tandem Repeat in Chronic Hepatitis B Virus Genotype E
    Article Snippet: To produce fragment C, pGEM-fragA-3 and pGEM-fragB-2 were mixed and amplified with primers E1039F-HindIII and E2168R. .. Finally, the fragments C-B-HindIII-AvrII and pGEM-fragA-C, cut with AvrII and SacI, were cloned into pUC19 without promoters (Invitrogen) cut with HindIII and SacI, and a pUC19-HBV/E wild-type replicon encoding a replication-competent 1.35-unit-length HBV genome was produced.

    Article Title: A simple and efficient method to visualize and quantify the efficiency of chromosomal mutations from genome editing
    Article Snippet: The plasmid expressing a fusion protein of mCherry and GFP (pmCherry-GFP) was constructed from pUC19 (Invitrogen, Waltham, MA, USA) by inserting the mCherry coding sequence between the SalI and HindIII sites of the multi-cloning sites (MCS) of the pUC19 to allow in-frame expression of mCherry and the LacZα gene in pUC19, and then replacing the LacZα coding region with super folding green fluorescent gene (sfGFP, GenBank # HQ873313). .. Briefly, mCherry coding sequences were PCR amplified from plasmid Nanog-2A-mCherry (a gift from Dr. Rudolf Jaenisch (Addgene plasmid # 59995) with primers 5′-cggcgcagaGTCGACttgtacagctcgtccatgcc-3′ (Sal I site capitalized) and 5′-gattacgccAAGCTTgatggtgagcaagggcgaggaggata-3′ (Hind III site capitalized).

    Article Title: Folding of Hepatitis C Virus E1 Glycoprotein in a Cell-Free System
    Article Snippet: The full-length consensus sequence of HCV type 1 (HCV-1) was cloned into the Hin dIII- Xba I site of pUC19 (Invitrogen), resulting in the pUC-HCV-1PC clone (A. J. Weiner, unpublished data). .. DNA templates for RNA synthesis were generated by amplification of this recombinant plasmid with the appropriate pair of primers.

    Article Title: Francisella tularensis IglG Belongs to a Novel Family of PAAR-Like T6SS Proteins and Harbors a Unique N-terminal Extension Required for Virulence
    Article Snippet: The latter plasmid was also used to create TEM fusion after removal of the plasmid encoded β-lactamase gene. .. E . coli TEM-1 amplified from pUC19 (ThermoFisher Scientific) was then cloned under the Gro promoter using Nhe I/Bam HI sites. .. FPI and controls genes were cloned in frame with TEM-1 using Eco RI and Nhe I sites.

    Article Title: A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells
    Article Snippet: Fragments for CPEC were generated by PCR amplification of a guide RNA expression vector with oligonucleotides cpec-assembly-for-spec2 and cpec assembly-rev. .. The specR fragment was generated by PCR amplification of the SpecR gene via the oligonucleotides cpec-assembly-for-spec and cpec-assembly-rev-spec. pUC19 (ThermoFisher Scientific, Waltham, MA, USA) was similarly modified. .. HEK293T cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

    Article Title: The α-Crystallin Domain Containing Genes: Identification, Phylogeny and Expression Profiling in Abiotic Stress, Phytohormone Response and Development in Tomato (Solanum lycopersicum)
    Article Snippet: The expression was computed in form of heat maps for abiotic stress conditions. .. The open reading frame (ORF) sequences for SlHsp17.6C-CI, SlHsp24.5-CI, SlHsp26.5-PX , and SlAcd15.7-CI were amplified using cDNA synthesized from total RNA isolated from acclimated high temperature stressed tomato leaf tissue (4 h), cloned into Sma I linearized pUC19 (Thermo Scientific, USA) and confirmed by sequencing. .. The ORFs were then introduced into the pET28a vector between the Nde I and Xho I sites for recombinant protein expression.

    Article Title: Transmitted/Founder Hepatitis C Viruses Induce Cell-Type- and Genotype-Specific Differences in Innate Signaling within the Liver
    Article Snippet: Full-genome-length T/F genomic sequences were generated by single-genome amplification chemically synthesized in 4 to 5 fragments (Blue Heron, Inc.), and ligated into low-copy-number pBR322 plasmids under control of the T7 promoter, which was added to the 5′ end of the HCV genome in five overlapping fragments, and these sequences were used to enable in vitro transcription. .. T/F and pUC19 (Invitrogen) DNA plasmids were transformed into Max Efficiency Stbl2 competent cells (Invitrogen), and bacteria were plated on Luria-Bertani (LB) agar plates supplemented with ampicillin and incubated overnight at 30°C.

    Article Title: Indole Biodegradation in Acinetobacter sp. Strain O153: Genetic and Biochemical Characterization
    Article Snippet: The 16S rRNA gene of the isolate strain was amplified with universal bacterial primers 27F and 1492R ( ) according to the method of Frank et al. ( ) and sequenced. .. Genomic DNA of strain O153 was extracted as described previously , digested with HindIII (ThermoFisher Scientific) to obtain 5- to 20-kb DNA fragments, which were cloned into pUC19 (ThermoFisher Scientific).

    Article Title: Different Stress-Induced Calcium Signatures Are Reported by Aequorin-Mediated Calcium Measurements in Living Cells of Aspergillus fumigatus
    Article Snippet: To generate pAEQ(I), the aeqS gene was amplified by PCR from the plasmid pAEQ1-15 using the primers AeqF and AeqR. .. The plasmid pAEQ(II) was assembled using GeneArt technology and pUC19 (both from Invitrogen).

    Clone Assay:

    Article Title: Novel Type of Hepatitis B Virus Mutation: Replacement Mutation Involving a Hepatocyte Nuclear Factor 1 Binding Site Tandem Repeat in Chronic Hepatitis B Virus Genotype E
    Article Snippet: The PCR product was also cloned, and pGEM-fragA-C was produced. .. Finally, the fragments C-B-HindIII-AvrII and pGEM-fragA-C, cut with AvrII and SacI, were cloned into pUC19 without promoters (Invitrogen) cut with HindIII and SacI, and a pUC19-HBV/E wild-type replicon encoding a replication-competent 1.35-unit-length HBV genome was produced. .. In addition, the pUC19-HBV/E wild-type replicon was digested by RsrIII and XbaI, the fragment with the replacement mutation from patient 2 (strain UK2), cut with RsrIII and XbalI, was ligated, and a pUC19-HBV/E replacement replicon was produced.

    Article Title: Folding of Hepatitis C Virus E1 Glycoprotein in a Cell-Free System
    Article Snippet: All other reagents were purchased from Sigma Biochemicals (St. Louis, Mo.). .. The full-length consensus sequence of HCV type 1 (HCV-1) was cloned into the Hin dIII- Xba I site of pUC19 (Invitrogen), resulting in the pUC-HCV-1PC clone (A. J. Weiner, unpublished data). .. DNA templates for RNA synthesis were generated by amplification of this recombinant plasmid with the appropriate pair of primers.

    Article Title: Evidence for Horizontal Transfer of SsuDAT1I Restriction-Modification Genes to the Streptococcus suis Genome
    Article Snippet: E. coli strains used were SCS110 ( thr leu endA thi-1 lacY galK galT ara tonA tsx dam dcm supE44 rpsL Δ( lac-proAB ) [F′ traD36 proAB lacI q Z ΔM15]) (Stratagene, La Jolla, Calif.), C600 (F− thr-1 thi-1 leuB6 lacY1 tonA21 supE44 ) , XL-1 blue MRF′ [Δ( mcrA ) 183 Δ( mcrCB-hsdSMR-mrr ) 173 endA1 supE44 thi-1 recA1 gyrA96 relA1 lac [F′ proAB lacI q Z ΔM15 Tn 10 ]) (Stratagene), XLOLR {Δ( mcrA ) 183 Δ( mcrCB-hsdSMR-mrr ) 173 endA1 thi-1 recA1 gyrA96 relA1 lac [F′ proAB lacI q Z ΔM15 Tn 10 ] Su− λ− } (Stratagene), and DH5α (F− endA1 recA1 hsdR17 (rK − mK + ) supE44 thi-1 gyrA relA1 φ80 lacZ ΔM15 Δ( lacZYA-argF ) deoR + ) ( ). .. The plasmid vectors used for gene cloning were pUC19 , pCR2.1 (Invitrogen, Groningen, The Netherlands), and pHSG576 ( ). .. Phagemid vector λZAP Express (Stratagene) was used for the construction of the genomic library.

    Article Title: Francisella tularensis IglG Belongs to a Novel Family of PAAR-Like T6SS Proteins and Harbors a Unique N-terminal Extension Required for Virulence
    Article Snippet: The latter plasmid was also used to create TEM fusion after removal of the plasmid encoded β-lactamase gene. .. E . coli TEM-1 amplified from pUC19 (ThermoFisher Scientific) was then cloned under the Gro promoter using Nhe I/Bam HI sites. .. FPI and controls genes were cloned in frame with TEM-1 using Eco RI and Nhe I sites.

    Article Title: The α-Crystallin Domain Containing Genes: Identification, Phylogeny and Expression Profiling in Abiotic Stress, Phytohormone Response and Development in Tomato (Solanum lycopersicum)
    Article Snippet: The expression was computed in form of heat maps for abiotic stress conditions. .. The open reading frame (ORF) sequences for SlHsp17.6C-CI, SlHsp24.5-CI, SlHsp26.5-PX , and SlAcd15.7-CI were amplified using cDNA synthesized from total RNA isolated from acclimated high temperature stressed tomato leaf tissue (4 h), cloned into Sma I linearized pUC19 (Thermo Scientific, USA) and confirmed by sequencing. .. The ORFs were then introduced into the pET28a vector between the Nde I and Xho I sites for recombinant protein expression.

    Article Title: Transmitted/Founder Hepatitis C Viruses Induce Cell-Type- and Genotype-Specific Differences in Innate Signaling within the Liver
    Article Snippet: T/F clones include 9.6-kb full-length HCV genotypes 1a (pBR322.10025TF.UC1), 1b (pBR322.10051TF.UC1), and 3a (pBR322.9055TF.UC1), with sequences contributed to GenBank (with accession numbers listed in the accompanying article by Stoddard et al. [ ]). .. T/F and pUC19 (Invitrogen) DNA plasmids were transformed into Max Efficiency Stbl2 competent cells (Invitrogen), and bacteria were plated on Luria-Bertani (LB) agar plates supplemented with ampicillin and incubated overnight at 30°C.

    Article Title: The Borrelia burgdorferi Glycosaminoglycan Binding Protein Bgp in the B31 Strain Is Not Essential for Infectivity despite Facilitating Adherence and Tissue Colonization
    Article Snippet: The bgp gene is disrupted by a gentamicin-containing transposon from pMarGentKan ( ). .. Genomic DNA from the bgp mutant strain was isolated by standard genomic DNA purification, digested with the restriction enzyme Spe1 (New England BioLabs, Ipswich, MA), and cloned in pUC19 (Thermo Scientific, Waltham, MA). .. Transformation of Top10 competent E. coli cells was followed by selection on gentamicin (15 μg/ml)-containing Luria-Bertani plates to select for the DNA fragment containing the resistance cassette of the transposon.

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: The cDNA sequences of S. apiospermum CYP51 ( SapioCYP51 ; allele type 1, CBS 11740T ) and S. cerevisiae ERG11 ( ScereERG11 ; strain S288c) were optimized for expression in S. cerevisiae by GeneArt gene synthesis and synthesized by Invitrogen. .. The genes were cloned into the EcoRI and HindIII (New England BioLabs GmbH, Frankfurt am Main, Germany) sites in pUC19 (T4 ligase; Thermo Fisher Scientific). .. The URA3-loxP marker was excised from pUG72 (Swiss-Prot accession no. ; Euroscarf, Frankfurt am Main, Germany), using SpeI and PstI, and was ligated in all pUC19(CYP51/ERG11) constructs.

    Article Title: Indole Biodegradation in Acinetobacter sp. Strain O153: Genetic and Biochemical Characterization
    Article Snippet: Phylogenetic analysis was performed with the blastn algorithm ( ) ( ) against the database of 16S rRNA sequences. .. Genomic DNA of strain O153 was extracted as described previously , digested with HindIII (ThermoFisher Scientific) to obtain 5- to 20-kb DNA fragments, which were cloned into pUC19 (ThermoFisher Scientific). .. The resulting library was transformed into E. coli DH5α; cells were plated on LB agar with 5-bromoindoline, incubated overnight at 37°C, and screened for purple pigment-producing colonies.

    Article Title: Differences in codon bias and GC content contribute to the balanced expression of TLR7 and TLR9
    Article Snippet: Individual hygromycin-B (Life Technologies)–resistant colonies were isolated and tested for protein expression after the addition of doxycycline (Sigma). .. To generate RAW Cas9 Lines, tdTomato and Tlr7 sequences lacking the ATG translation start codon were cloned into pUC19 (Life Technologies) flanked by homology arms derived from the genomic sequence adjacent to exon 3 of Tlr7 (741 bp upstream, 845 bp downstream). .. Guide RNAs were designed and synthesized as gBlocks as previously described ( ) and then were subcloned into pUC19.

    Construct:

    Article Title: Comparative Analysis of the Recently Discovered hAT Transposon TcBuster in Human Cells
    Article Snippet: Paragraph title: Plasmid constructs ... All plasmids were prepared for assays by endotoxin-free maxiprep (Qiagen, Valencia, CA). pUC19 (Invitrogen, Carlsbad, CA) was used as filler plasmid DNA for the FuGene6 transfections.

    Article Title: Novel Type of Hepatitis B Virus Mutation: Replacement Mutation Involving a Hepatocyte Nuclear Factor 1 Binding Site Tandem Repeat in Chronic Hepatitis B Virus Genotype E
    Article Snippet: Of these, pGEM-fragA-3 and pGEM-fragB-2, with consensus sequences and without core deletion or replacement mutation (not major clones), were used as templates to construct HBV replicons. .. Finally, the fragments C-B-HindIII-AvrII and pGEM-fragA-C, cut with AvrII and SacI, were cloned into pUC19 without promoters (Invitrogen) cut with HindIII and SacI, and a pUC19-HBV/E wild-type replicon encoding a replication-competent 1.35-unit-length HBV genome was produced.

    Article Title: A simple and efficient method to visualize and quantify the efficiency of chromosomal mutations from genome editing
    Article Snippet: For TALEN mRNA injection, equal amounts of the TALEN-L (left) and -R (right) arm mRNAs were mixed and injected into the fertilized egg at 400 pg for each mRNA/egg. .. The plasmid expressing a fusion protein of mCherry and GFP (pmCherry-GFP) was constructed from pUC19 (Invitrogen, Waltham, MA, USA) by inserting the mCherry coding sequence between the SalI and HindIII sites of the multi-cloning sites (MCS) of the pUC19 to allow in-frame expression of mCherry and the LacZα gene in pUC19, and then replacing the LacZα coding region with super folding green fluorescent gene (sfGFP, GenBank # HQ873313). .. Briefly, mCherry coding sequences were PCR amplified from plasmid Nanog-2A-mCherry (a gift from Dr. Rudolf Jaenisch (Addgene plasmid # 59995) with primers 5′-cggcgcagaGTCGACttgtacagctcgtccatgcc-3′ (Sal I site capitalized) and 5′-gattacgccAAGCTTgatggtgagcaagggcgaggaggata-3′ (Hind III site capitalized).

    Article Title: Folding of Hepatitis C Virus E1 Glycoprotein in a Cell-Free System
    Article Snippet: The full-length consensus sequence of HCV type 1 (HCV-1) was cloned into the Hin dIII- Xba I site of pUC19 (Invitrogen), resulting in the pUC-HCV-1PC clone (A. J. Weiner, unpublished data). .. DNA templates for RNA synthesis were generated by amplification of this recombinant plasmid with the appropriate pair of primers.

    Article Title: Francisella tularensis IglG Belongs to a Novel Family of PAAR-Like T6SS Proteins and Harbors a Unique N-terminal Extension Required for Virulence
    Article Snippet: Plasmids used for complementation of ΔiglG in trans were constructed by introducing C-terminally 6xHis-tagged or 2xHA-tagged wild-type or mutated versions of iglG into the Nde I/Eco RI sites of pKK289Km [ ] or into a cyaA-containing pFNLTP6 derivative [ , ] respectively. .. E . coli TEM-1 amplified from pUC19 (ThermoFisher Scientific) was then cloned under the Gro promoter using Nhe I/Bam HI sites.

    Article Title: A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells
    Article Snippet: Spectinomycin resistance was initially introduced into guide RNA expression vectors via CPEC essentially as described ( , ) and guide RNA plasmids were then constructed by PCR amplification of the vector, as described above. .. The specR fragment was generated by PCR amplification of the SpecR gene via the oligonucleotides cpec-assembly-for-spec and cpec-assembly-rev-spec. pUC19 (ThermoFisher Scientific, Waltham, MA, USA) was similarly modified.

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: The genes were cloned into the EcoRI and HindIII (New England BioLabs GmbH, Frankfurt am Main, Germany) sites in pUC19 (T4 ligase; Thermo Fisher Scientific). .. The genes were cloned into the EcoRI and HindIII (New England BioLabs GmbH, Frankfurt am Main, Germany) sites in pUC19 (T4 ligase; Thermo Fisher Scientific).

    Article Title: Differences in codon bias and GC content contribute to the balanced expression of TLR7 and TLR9
    Article Snippet: For generation of Flp-In T-REx 293 Lines, C-terminally HA-tagged constructs were subcloned into pcDNA5/FRT/TO (Life Technologies) and then cotransfected with pOG44 using Lipofectamine LTX. .. To generate RAW Cas9 Lines, tdTomato and Tlr7 sequences lacking the ATG translation start codon were cloned into pUC19 (Life Technologies) flanked by homology arms derived from the genomic sequence adjacent to exon 3 of Tlr7 (741 bp upstream, 845 bp downstream).

    Article Title: Creation of a type IIS restriction endonuclease with a long recognition sequence
    Article Snippet: Fractions eluted from the column at the volume corresponding to the expected molecular weight (approximately 38 kDa for the Sce7 mutant and 52 kDa for the chimeric endonucleases) were pooled, concentrated using Amicon Ultra-4 centrifugal concentrators (10 kDa MWCO) at 2000g , 4°C (to 160 μg/ml for Sce7 and between 100 and 300 μg/ml for the chimeric endonucleases, and stored at –20°C in 10 mM HEPES, pH 8.0, 0.25 M NaCl, 0.5 mM DTT, 0.05 mM EDTA and 50% glycerol. .. To construct a DNA substrate for I-SceI and the chimeric endonucleases, two complementary oligonucleotides containing the I-SceI target site (5′-AATTCTGGTTCCGAA GCCTGTCCTGCACGC TAGGGATAACAGGGTAAT AATATATGAATCCAAACTAGAGCGGGGCTCTT GACGTTTGGCTCAAAACGTCGTGAGACAGTTTG GTCAGTTGTAAATATCTAATATTCCAATG-3′ and 5′-GATCCATTGGAATATTAGATATTTACAACTGA CCAAACTGTCTCACGACGTTTTGAGCCAAACGT CAAGAGCCCCGCTCTAGTTTGGATTCATATATT ATTACCCTGTTATCCCTA GCGT GCAGGACAGGCTTCGGAACCAG-3′; the I-SceI target site is underlined) were annealed, phosphorylated, and ligated between the EcoRI and BamHI restriction sites of pUC19 (Invitrogen). .. The plasmid, named pSCI, was propagated in and extracted from E. coli OneShot Top 10 (Invitrogen), linearized by cleavage with AlwNI (New England Biolabs, Ipswich, MA) and purified using standard isopropanol/acetate precipitation.

    Incubation:

    Article Title: Mlh1-Mlh3, a Meiotic Crossover and DNA Mismatch Repair Factor, Is a Msh2-Msh3-stimulated Endonuclease
    Article Snippet: Mlh1-Mlh3 nicking activity was assayed on supercoiled or nicked pUC19 (Thermo Scientific). .. Mlh1-Mlh3 nicking activity was assayed on supercoiled or nicked pUC19 (Thermo Scientific).

    Article Title: Structural and Functional Analysis of the Symmetrical Type I Restriction Endonuclease R.EcoR124INT
    Article Snippet: The plasmids: pUC19 (Invitrogen, 2686bp) containing two recognition sites at positions 1126 bp and 2294 bp ( GAACCCCCCGTTC and GAAAACGTTCTTC , respectively), and pTK-neo (Novagen, 2872 bp) containing one site at position 2535 bp ( GAACGGGGGGTTC ) were used as the DNA substrates. .. The plasmids: pUC19 (Invitrogen, 2686bp) containing two recognition sites at positions 1126 bp and 2294 bp ( GAACCCCCCGTTC and GAAAACGTTCTTC , respectively), and pTK-neo (Novagen, 2872 bp) containing one site at position 2535 bp ( GAACGGGGGGTTC ) were used as the DNA substrates.

    Article Title: A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells
    Article Snippet: Reactions were incubated overnight at 37°C with 40 U of DpnI, purified and transformed. .. The specR fragment was generated by PCR amplification of the SpecR gene via the oligonucleotides cpec-assembly-for-spec and cpec-assembly-rev-spec. pUC19 (ThermoFisher Scientific, Waltham, MA, USA) was similarly modified.

    Article Title: Transmitted/Founder Hepatitis C Viruses Induce Cell-Type- and Genotype-Specific Differences in Innate Signaling within the Liver
    Article Snippet: This strategy was required in order to obtain faithful representations of the 5′ and 3′ termini of the HCV genomes. .. T/F and pUC19 (Invitrogen) DNA plasmids were transformed into Max Efficiency Stbl2 competent cells (Invitrogen), and bacteria were plated on Luria-Bertani (LB) agar plates supplemented with ampicillin and incubated overnight at 30°C. .. Single colonies were selected and grown overnight in LB broth at 30°C with 225-rpm shaking.

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: The genes were cloned into the EcoRI and HindIII (New England BioLabs GmbH, Frankfurt am Main, Germany) sites in pUC19 (T4 ligase; Thermo Fisher Scientific). .. The genes were cloned into the EcoRI and HindIII (New England BioLabs GmbH, Frankfurt am Main, Germany) sites in pUC19 (T4 ligase; Thermo Fisher Scientific).

    Article Title: Indole Biodegradation in Acinetobacter sp. Strain O153: Genetic and Biochemical Characterization
    Article Snippet: Following an overnight incubation at 30°C, purple pigment-forming colonies were isolated and maintained as pure cultures. .. Genomic DNA of strain O153 was extracted as described previously , digested with HindIII (ThermoFisher Scientific) to obtain 5- to 20-kb DNA fragments, which were cloned into pUC19 (ThermoFisher Scientific).

    Article Title: Creation of a type IIS restriction endonuclease with a long recognition sequence
    Article Snippet: To construct a DNA substrate for I-SceI and the chimeric endonucleases, two complementary oligonucleotides containing the I-SceI target site (5′-AATTCTGGTTCCGAA GCCTGTCCTGCACGC TAGGGATAACAGGGTAAT AATATATGAATCCAAACTAGAGCGGGGCTCTT GACGTTTGGCTCAAAACGTCGTGAGACAGTTTG GTCAGTTGTAAATATCTAATATTCCAATG-3′ and 5′-GATCCATTGGAATATTAGATATTTACAACTGA CCAAACTGTCTCACGACGTTTTGAGCCAAACGT CAAGAGCCCCGCTCTAGTTTGGATTCATATATT ATTACCCTGTTATCCCTA GCGT GCAGGACAGGCTTCGGAACCAG-3′; the I-SceI target site is underlined) were annealed, phosphorylated, and ligated between the EcoRI and BamHI restriction sites of pUC19 (Invitrogen). .. To construct a DNA substrate for I-SceI and the chimeric endonucleases, two complementary oligonucleotides containing the I-SceI target site (5′-AATTCTGGTTCCGAA GCCTGTCCTGCACGC TAGGGATAACAGGGTAAT AATATATGAATCCAAACTAGAGCGGGGCTCTT GACGTTTGGCTCAAAACGTCGTGAGACAGTTTG GTCAGTTGTAAATATCTAATATTCCAATG-3′ and 5′-GATCCATTGGAATATTAGATATTTACAACTGA CCAAACTGTCTCACGACGTTTTGAGCCAAACGT CAAGAGCCCCGCTCTAGTTTGGATTCATATATT ATTACCCTGTTATCCCTA GCGT GCAGGACAGGCTTCGGAACCAG-3′; the I-SceI target site is underlined) were annealed, phosphorylated, and ligated between the EcoRI and BamHI restriction sites of pUC19 (Invitrogen).

    Activity Assay:

    Article Title: Mlh1-Mlh3, a Meiotic Crossover and DNA Mismatch Repair Factor, Is a Msh2-Msh3-stimulated Endonuclease
    Article Snippet: Protein concentrations were determined by the Bradford assay ( ) using BSA standards. .. Mlh1-Mlh3 nicking activity was assayed on supercoiled or nicked pUC19 (Thermo Scientific). .. Nicked substrate was prepared by digesting supercoiled pUC19 with Nt.BstNBI (New England Biolabs) and desalting by P-30 spin column (Bio-Rad).

    Article Title: The α-Crystallin Domain Containing Genes: Identification, Phylogeny and Expression Profiling in Abiotic Stress, Phytohormone Response and Development in Tomato (Solanum lycopersicum)
    Article Snippet: The open reading frame (ORF) sequences for SlHsp17.6C-CI, SlHsp24.5-CI, SlHsp26.5-PX , and SlAcd15.7-CI were amplified using cDNA synthesized from total RNA isolated from acclimated high temperature stressed tomato leaf tissue (4 h), cloned into Sma I linearized pUC19 (Thermo Scientific, USA) and confirmed by sequencing. .. The pET28a-His-Hsp17.6C-CI, pET28a-His-Hsp24.5-CI, pET28a-His-Hsp26.5-PX , and pET28a-His-Acd15.7-CI plasmids were transformed into E. coli BL21, BL21 (DE3), BL21 (DE3) pLys, and BL21 Rosetta cells, respectively.

    Infection:

    Article Title: Transmitted/Founder Hepatitis C Viruses Induce Cell-Type- and Genotype-Specific Differences in Innate Signaling within the Liver
    Article Snippet: Full-length HCV T/F sequences were determined from acute infection plasma vRNA by single-genome sequencing, phylogenetic inference, and a mathematical model of random early virus diversification, as described previously ( , ). .. T/F and pUC19 (Invitrogen) DNA plasmids were transformed into Max Efficiency Stbl2 competent cells (Invitrogen), and bacteria were plated on Luria-Bertani (LB) agar plates supplemented with ampicillin and incubated overnight at 30°C.

    Expressing:

    Article Title: A simple and efficient method to visualize and quantify the efficiency of chromosomal mutations from genome editing
    Article Snippet: For TALEN mRNA injection, equal amounts of the TALEN-L (left) and -R (right) arm mRNAs were mixed and injected into the fertilized egg at 400 pg for each mRNA/egg. .. The plasmid expressing a fusion protein of mCherry and GFP (pmCherry-GFP) was constructed from pUC19 (Invitrogen, Waltham, MA, USA) by inserting the mCherry coding sequence between the SalI and HindIII sites of the multi-cloning sites (MCS) of the pUC19 to allow in-frame expression of mCherry and the LacZα gene in pUC19, and then replacing the LacZα coding region with super folding green fluorescent gene (sfGFP, GenBank # HQ873313). .. Briefly, mCherry coding sequences were PCR amplified from plasmid Nanog-2A-mCherry (a gift from Dr. Rudolf Jaenisch (Addgene plasmid # 59995) with primers 5′-cggcgcagaGTCGACttgtacagctcgtccatgcc-3′ (Sal I site capitalized) and 5′-gattacgccAAGCTTgatggtgagcaagggcgaggaggata-3′ (Hind III site capitalized).

    Article Title: Francisella tularensis IglG Belongs to a Novel Family of PAAR-Like T6SS Proteins and Harbors a Unique N-terminal Extension Required for Virulence
    Article Snippet: Paragraph title: Construction of expression vectors ... E . coli TEM-1 amplified from pUC19 (ThermoFisher Scientific) was then cloned under the Gro promoter using Nhe I/Bam HI sites.

    Article Title: The α-Crystallin Domain Containing Genes: Identification, Phylogeny and Expression Profiling in Abiotic Stress, Phytohormone Response and Development in Tomato (Solanum lycopersicum)
    Article Snippet: Paragraph title: Recombinant proteins expression and holdase chaperone assay ... The open reading frame (ORF) sequences for SlHsp17.6C-CI, SlHsp24.5-CI, SlHsp26.5-PX , and SlAcd15.7-CI were amplified using cDNA synthesized from total RNA isolated from acclimated high temperature stressed tomato leaf tissue (4 h), cloned into Sma I linearized pUC19 (Thermo Scientific, USA) and confirmed by sequencing.

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: The cDNA sequences of S. apiospermum CYP51 ( SapioCYP51 ; allele type 1, CBS 11740T ) and S. cerevisiae ERG11 ( ScereERG11 ; strain S288c) were optimized for expression in S. cerevisiae by GeneArt gene synthesis and synthesized by Invitrogen. .. The genes were cloned into the EcoRI and HindIII (New England BioLabs GmbH, Frankfurt am Main, Germany) sites in pUC19 (T4 ligase; Thermo Fisher Scientific).

    Article Title: Differences in codon bias and GC content contribute to the balanced expression of TLR7 and TLR9
    Article Snippet: Individual hygromycin-B (Life Technologies)–resistant colonies were isolated and tested for protein expression after the addition of doxycycline (Sigma). .. To generate RAW Cas9 Lines, tdTomato and Tlr7 sequences lacking the ATG translation start codon were cloned into pUC19 (Life Technologies) flanked by homology arms derived from the genomic sequence adjacent to exon 3 of Tlr7 (741 bp upstream, 845 bp downstream).

    Article Title: Different Stress-Induced Calcium Signatures Are Reported by Aequorin-Mediated Calcium Measurements in Living Cells of Aspergillus fumigatus
    Article Snippet: The plasmid pAEQ(II) was assembled using GeneArt technology and pUC19 (both from Invitrogen). .. The plasmid comprises the aeqS gene, also (as above) fused downstream of gpdA P .

    Modification:

    Article Title: A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells
    Article Snippet: Fragments for CPEC were generated by PCR amplification of a guide RNA expression vector with oligonucleotides cpec-assembly-for-spec2 and cpec assembly-rev. .. The specR fragment was generated by PCR amplification of the SpecR gene via the oligonucleotides cpec-assembly-for-spec and cpec-assembly-rev-spec. pUC19 (ThermoFisher Scientific, Waltham, MA, USA) was similarly modified. .. HEK293T cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: The genes were cloned into the EcoRI and HindIII (New England BioLabs GmbH, Frankfurt am Main, Germany) sites in pUC19 (T4 ligase; Thermo Fisher Scientific). .. The genes were cloned into the EcoRI and HindIII (New England BioLabs GmbH, Frankfurt am Main, Germany) sites in pUC19 (T4 ligase; Thermo Fisher Scientific).

    Transformation Assay:

    Article Title: Francisella tularensis IglG Belongs to a Novel Family of PAAR-Like T6SS Proteins and Harbors a Unique N-terminal Extension Required for Virulence
    Article Snippet: E . coli TEM-1 amplified from pUC19 (ThermoFisher Scientific) was then cloned under the Gro promoter using Nhe I/Bam HI sites. .. For GST-IglG expression, the F . novicida iglG gene was PCR-amplified and cloned into the pGEX-6-P3 (Novagen) in frame with the GST-encoding gene.

    Article Title: A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells
    Article Snippet: Reactions were incubated overnight at 37°C with 40 U of DpnI, purified and transformed. .. The specR fragment was generated by PCR amplification of the SpecR gene via the oligonucleotides cpec-assembly-for-spec and cpec-assembly-rev-spec. pUC19 (ThermoFisher Scientific, Waltham, MA, USA) was similarly modified.

    Article Title: The α-Crystallin Domain Containing Genes: Identification, Phylogeny and Expression Profiling in Abiotic Stress, Phytohormone Response and Development in Tomato (Solanum lycopersicum)
    Article Snippet: The open reading frame (ORF) sequences for SlHsp17.6C-CI, SlHsp24.5-CI, SlHsp26.5-PX , and SlAcd15.7-CI were amplified using cDNA synthesized from total RNA isolated from acclimated high temperature stressed tomato leaf tissue (4 h), cloned into Sma I linearized pUC19 (Thermo Scientific, USA) and confirmed by sequencing. .. The gene specific primers used for ORF cloning are listed in Supplementary Table .

    Article Title: Transmitted/Founder Hepatitis C Viruses Induce Cell-Type- and Genotype-Specific Differences in Innate Signaling within the Liver
    Article Snippet: This strategy was required in order to obtain faithful representations of the 5′ and 3′ termini of the HCV genomes. .. T/F and pUC19 (Invitrogen) DNA plasmids were transformed into Max Efficiency Stbl2 competent cells (Invitrogen), and bacteria were plated on Luria-Bertani (LB) agar plates supplemented with ampicillin and incubated overnight at 30°C. .. Single colonies were selected and grown overnight in LB broth at 30°C with 225-rpm shaking.

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: The genes were cloned into the EcoRI and HindIII (New England BioLabs GmbH, Frankfurt am Main, Germany) sites in pUC19 (T4 ligase; Thermo Fisher Scientific). .. The URA3-loxP marker was excised from pUG72 (Swiss-Prot accession no. ; Euroscarf, Frankfurt am Main, Germany), using SpeI and PstI, and was ligated in all pUC19(CYP51/ERG11) constructs.

    Derivative Assay:

    Article Title: Francisella tularensis IglG Belongs to a Novel Family of PAAR-Like T6SS Proteins and Harbors a Unique N-terminal Extension Required for Virulence
    Article Snippet: Upon overlap PCR, the resulting hybrid consisted of the first 60 residues of IglG, and where the remaining part was derived from FTN_0054, starting at alanine at position 10. .. E . coli TEM-1 amplified from pUC19 (ThermoFisher Scientific) was then cloned under the Gro promoter using Nhe I/Bam HI sites.

    Article Title: Differences in codon bias and GC content contribute to the balanced expression of TLR7 and TLR9
    Article Snippet: Individual hygromycin-B (Life Technologies)–resistant colonies were isolated and tested for protein expression after the addition of doxycycline (Sigma). .. To generate RAW Cas9 Lines, tdTomato and Tlr7 sequences lacking the ATG translation start codon were cloned into pUC19 (Life Technologies) flanked by homology arms derived from the genomic sequence adjacent to exon 3 of Tlr7 (741 bp upstream, 845 bp downstream). .. Guide RNAs were designed and synthesized as gBlocks as previously described ( ) and then were subcloned into pUC19.

    Gel Purification:

    Article Title: A simple and efficient method to visualize and quantify the efficiency of chromosomal mutations from genome editing
    Article Snippet: The plasmid expressing a fusion protein of mCherry and GFP (pmCherry-GFP) was constructed from pUC19 (Invitrogen, Waltham, MA, USA) by inserting the mCherry coding sequence between the SalI and HindIII sites of the multi-cloning sites (MCS) of the pUC19 to allow in-frame expression of mCherry and the LacZα gene in pUC19, and then replacing the LacZα coding region with super folding green fluorescent gene (sfGFP, GenBank # HQ873313). .. Briefly, mCherry coding sequences were PCR amplified from plasmid Nanog-2A-mCherry (a gift from Dr. Rudolf Jaenisch (Addgene plasmid # 59995) with primers 5′-cggcgcagaGTCGACttgtacagctcgtccatgcc-3′ (Sal I site capitalized) and 5′-gattacgccAAGCTTgatggtgagcaagggcgaggaggata-3′ (Hind III site capitalized).

    Electroporation:

    Article Title: Francisella tularensis IglG Belongs to a Novel Family of PAAR-Like T6SS Proteins and Harbors a Unique N-terminal Extension Required for Virulence
    Article Snippet: E . coli TEM-1 amplified from pUC19 (ThermoFisher Scientific) was then cloned under the Gro promoter using Nhe I/Bam HI sites. .. For GST-IglG expression, the F . novicida iglG gene was PCR-amplified and cloned into the pGEX-6-P3 (Novagen) in frame with the GST-encoding gene.

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: The genes were cloned into the EcoRI and HindIII (New England BioLabs GmbH, Frankfurt am Main, Germany) sites in pUC19 (T4 ligase; Thermo Fisher Scientific). .. The genes were cloned into the EcoRI and HindIII (New England BioLabs GmbH, Frankfurt am Main, Germany) sites in pUC19 (T4 ligase; Thermo Fisher Scientific).

    Transfection:

    Article Title: Comparative Analysis of the Recently Discovered hAT Transposon TcBuster in Human Cells
    Article Snippet: Future studies will test TcBuster in specific applications of transgenesis, insertional mutagenesis, and pre-clinical gene therapy in mammals to capitalize on the impressive performance of TcBuster in vitro . .. All plasmids were prepared for assays by endotoxin-free maxiprep (Qiagen, Valencia, CA). pUC19 (Invitrogen, Carlsbad, CA) was used as filler plasmid DNA for the FuGene6 transfections. .. The blasticidin resistance gene donor and transposase-expressing helper plasmids (pXL-TcB-D-GFP/Bsd and pXL-CMV-TcBusterCO for TcBuster , pXL-PB-D-GFP/Bsd and pXL-CMV-piggyBac for piggyBac , or pXL-SB-D-GFP/Bsd and pXL-CMV-Sleeping Beauty for Sleeping Beauty ) used for excision PCR and integration site analysis are described elsewhere .

    Article Title: Differences in codon bias and GC content contribute to the balanced expression of TLR7 and TLR9
    Article Snippet: To generate RAW Cas9 Lines, tdTomato and Tlr7 sequences lacking the ATG translation start codon were cloned into pUC19 (Life Technologies) flanked by homology arms derived from the genomic sequence adjacent to exon 3 of Tlr7 (741 bp upstream, 845 bp downstream). .. To generate RAW Cas9 Lines, tdTomato and Tlr7 sequences lacking the ATG translation start codon were cloned into pUC19 (Life Technologies) flanked by homology arms derived from the genomic sequence adjacent to exon 3 of Tlr7 (741 bp upstream, 845 bp downstream).

    Genomic Sequencing:

    Article Title: Transmitted/Founder Hepatitis C Viruses Induce Cell-Type- and Genotype-Specific Differences in Innate Signaling within the Liver
    Article Snippet: Full-genome-length T/F genomic sequences were generated by single-genome amplification chemically synthesized in 4 to 5 fragments (Blue Heron, Inc.), and ligated into low-copy-number pBR322 plasmids under control of the T7 promoter, which was added to the 5′ end of the HCV genome in five overlapping fragments, and these sequences were used to enable in vitro transcription. .. T/F and pUC19 (Invitrogen) DNA plasmids were transformed into Max Efficiency Stbl2 competent cells (Invitrogen), and bacteria were plated on Luria-Bertani (LB) agar plates supplemented with ampicillin and incubated overnight at 30°C.

    Low Copy Number:

    Article Title: A One-Step Miniprep for the Isolation of Plasmid DNA and Lambda Phage Particles
    Article Snippet: DH5α cells were supplied by Invitrogen (Carlsbad, CA). .. The following high copy number plasmids were used: 1) pUC19 (2.7 Kb), purchased from Invitrogen (Carlsbad, CA); 2) pCYPAC3 (18.8 Kb) , a pUC-based plasmid, kindly provided by S. O′Brien (NCI, Frederick, MD); 3) pLTM330 (6.5 Kb), a pBluescript-based plasmid, kindly provided by L. Tessarollo (NCI, Frederick, MD); and 4) B254 (6.06 Kb), a pBluescript-based plasmid, kindly provided by E. Leibold (University of Utah, Salt Lake City, UT). pEL04 (5.07 Kb, ts pSC101 oriR), a low copy number plasmid (Qiagen® Plasmid Purification Handbook 3rd Edition, Nov 2005, pg. .. 12), was kindly provided by NCI-Frederick, MD ( http://web.ncifcrf.gov/research/brb/ productDataSheets/recombineering/plasmid.aspx).

    Article Title: Transmitted/Founder Hepatitis C Viruses Induce Cell-Type- and Genotype-Specific Differences in Innate Signaling within the Liver
    Article Snippet: Full-genome-length T/F genomic sequences were generated by single-genome amplification chemically synthesized in 4 to 5 fragments (Blue Heron, Inc.), and ligated into low-copy-number pBR322 plasmids under control of the T7 promoter, which was added to the 5′ end of the HCV genome in five overlapping fragments, and these sequences were used to enable in vitro transcription. .. T/F and pUC19 (Invitrogen) DNA plasmids were transformed into Max Efficiency Stbl2 competent cells (Invitrogen), and bacteria were plated on Luria-Bertani (LB) agar plates supplemented with ampicillin and incubated overnight at 30°C.

    Cell Culture:

    Article Title: Evidence for Horizontal Transfer of SsuDAT1I Restriction-Modification Genes to the Streptococcus suis Genome
    Article Snippet: The plasmid vectors used for gene cloning were pUC19 , pCR2.1 (Invitrogen, Groningen, The Netherlands), and pHSG576 ( ). .. The plasmid vectors used for gene cloning were pUC19 , pCR2.1 (Invitrogen, Groningen, The Netherlands), and pHSG576 ( ).

    Article Title: Differences in codon bias and GC content contribute to the balanced expression of TLR7 and TLR9
    Article Snippet: Paragraph title: Cell Culture Lines and Reagents. ... To generate RAW Cas9 Lines, tdTomato and Tlr7 sequences lacking the ATG translation start codon were cloned into pUC19 (Life Technologies) flanked by homology arms derived from the genomic sequence adjacent to exon 3 of Tlr7 (741 bp upstream, 845 bp downstream).

    Hemagglutination Assay:

    Article Title: Francisella tularensis IglG Belongs to a Novel Family of PAAR-Like T6SS Proteins and Harbors a Unique N-terminal Extension Required for Virulence
    Article Snippet: 2xHA-tagged IglG was generated by cloning iglG in frame with a single HA tag sequence in the popHA plasmid (kindly provided by P. Mangeot) followed by addition of a second HA tag sequence by PCR amplification. .. E . coli TEM-1 amplified from pUC19 (ThermoFisher Scientific) was then cloned under the Gro promoter using Nhe I/Bam HI sites.

    Article Title: Differences in codon bias and GC content contribute to the balanced expression of TLR7 and TLR9
    Article Snippet: For generation of Flp-In T-REx 293 Lines, C-terminally HA-tagged constructs were subcloned into pcDNA5/FRT/TO (Life Technologies) and then cotransfected with pOG44 using Lipofectamine LTX. .. To generate RAW Cas9 Lines, tdTomato and Tlr7 sequences lacking the ATG translation start codon were cloned into pUC19 (Life Technologies) flanked by homology arms derived from the genomic sequence adjacent to exon 3 of Tlr7 (741 bp upstream, 845 bp downstream).

    Generated:

    Article Title: Francisella tularensis IglG Belongs to a Novel Family of PAAR-Like T6SS Proteins and Harbors a Unique N-terminal Extension Required for Virulence
    Article Snippet: 2xHA-tagged IglG was generated by cloning iglG in frame with a single HA tag sequence in the popHA plasmid (kindly provided by P. Mangeot) followed by addition of a second HA tag sequence by PCR amplification. .. E . coli TEM-1 amplified from pUC19 (ThermoFisher Scientific) was then cloned under the Gro promoter using Nhe I/Bam HI sites.

    Article Title: A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells
    Article Snippet: Fragments for CPEC were generated by PCR amplification of a guide RNA expression vector with oligonucleotides cpec-assembly-for-spec2 and cpec assembly-rev. .. The specR fragment was generated by PCR amplification of the SpecR gene via the oligonucleotides cpec-assembly-for-spec and cpec-assembly-rev-spec. pUC19 (ThermoFisher Scientific, Waltham, MA, USA) was similarly modified. .. HEK293T cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

    Article Title: Transmitted/Founder Hepatitis C Viruses Induce Cell-Type- and Genotype-Specific Differences in Innate Signaling within the Liver
    Article Snippet: Full-genome-length T/F genomic sequences were generated by single-genome amplification chemically synthesized in 4 to 5 fragments (Blue Heron, Inc.), and ligated into low-copy-number pBR322 plasmids under control of the T7 promoter, which was added to the 5′ end of the HCV genome in five overlapping fragments, and these sequences were used to enable in vitro transcription. .. T/F and pUC19 (Invitrogen) DNA plasmids were transformed into Max Efficiency Stbl2 competent cells (Invitrogen), and bacteria were plated on Luria-Bertani (LB) agar plates supplemented with ampicillin and incubated overnight at 30°C.

    DNA Sequencing:

    Article Title: Transmitted/Founder Hepatitis C Viruses Induce Cell-Type- and Genotype-Specific Differences in Innate Signaling within the Liver
    Article Snippet: T/F and pUC19 (Invitrogen) DNA plasmids were transformed into Max Efficiency Stbl2 competent cells (Invitrogen), and bacteria were plated on Luria-Bertani (LB) agar plates supplemented with ampicillin and incubated overnight at 30°C. .. Miniprep plasmid DNA isolation was performed via the PureYield Plasmid Miniprep system (Promega, Madison, WI), and plasmid sizes were verified on an agarose gel (Bio-Rad, Hercules, CA).

    Polymerase Chain Reaction:

    Article Title: Comparative Analysis of the Recently Discovered hAT Transposon TcBuster in Human Cells
    Article Snippet: All plasmids were prepared for assays by endotoxin-free maxiprep (Qiagen, Valencia, CA). pUC19 (Invitrogen, Carlsbad, CA) was used as filler plasmid DNA for the FuGene6 transfections. .. All plasmids were prepared for assays by endotoxin-free maxiprep (Qiagen, Valencia, CA). pUC19 (Invitrogen, Carlsbad, CA) was used as filler plasmid DNA for the FuGene6 transfections.

    Article Title: Novel Type of Hepatitis B Virus Mutation: Replacement Mutation Involving a Hepatocyte Nuclear Factor 1 Binding Site Tandem Repeat in Chronic Hepatitis B Virus Genotype E
    Article Snippet: The PCR product was also cloned, and pGEM-fragA-C was produced. .. Finally, the fragments C-B-HindIII-AvrII and pGEM-fragA-C, cut with AvrII and SacI, were cloned into pUC19 without promoters (Invitrogen) cut with HindIII and SacI, and a pUC19-HBV/E wild-type replicon encoding a replication-competent 1.35-unit-length HBV genome was produced.

    Article Title: Francisella tularensis IglG Belongs to a Novel Family of PAAR-Like T6SS Proteins and Harbors a Unique N-terminal Extension Required for Virulence
    Article Snippet: 2xHA-tagged IglG was generated by cloning iglG in frame with a single HA tag sequence in the popHA plasmid (kindly provided by P. Mangeot) followed by addition of a second HA tag sequence by PCR amplification. .. E . coli TEM-1 amplified from pUC19 (ThermoFisher Scientific) was then cloned under the Gro promoter using Nhe I/Bam HI sites.

    Article Title: A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells
    Article Snippet: Fragments for CPEC were generated by PCR amplification of a guide RNA expression vector with oligonucleotides cpec-assembly-for-spec2 and cpec assembly-rev. .. The specR fragment was generated by PCR amplification of the SpecR gene via the oligonucleotides cpec-assembly-for-spec and cpec-assembly-rev-spec. pUC19 (ThermoFisher Scientific, Waltham, MA, USA) was similarly modified. .. HEK293T cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

    Article Title: Filter paper-based spin column method for cost-efficient DNA or RNA purification
    Article Snippet: Paragraph title: Plant materials, plasmid DNA and PCR products ... 50 to 100 mg ground samples were transferred into a tube and used immediately or stored at -80°C prior to use. pUC19 and pBI121 plasmids were purchased from Invitrogen (Carlsbad, CA).

    Article Title: Different Stress-Induced Calcium Signatures Are Reported by Aequorin-Mediated Calcium Measurements in Living Cells of Aspergillus fumigatus
    Article Snippet: To generate pAEQ(I), the aeqS gene was amplified by PCR from the plasmid pAEQ1-15 using the primers AeqF and AeqR. .. The plasmid pAEQ(II) was assembled using GeneArt technology and pUC19 (both from Invitrogen).

    Recombinant:

    Article Title: The α-Crystallin Domain Containing Genes: Identification, Phylogeny and Expression Profiling in Abiotic Stress, Phytohormone Response and Development in Tomato (Solanum lycopersicum)
    Article Snippet: Paragraph title: Recombinant proteins expression and holdase chaperone assay ... The open reading frame (ORF) sequences for SlHsp17.6C-CI, SlHsp24.5-CI, SlHsp26.5-PX , and SlAcd15.7-CI were amplified using cDNA synthesized from total RNA isolated from acclimated high temperature stressed tomato leaf tissue (4 h), cloned into Sma I linearized pUC19 (Thermo Scientific, USA) and confirmed by sequencing.

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: The genes were cloned into the EcoRI and HindIII (New England BioLabs GmbH, Frankfurt am Main, Germany) sites in pUC19 (T4 ligase; Thermo Fisher Scientific). .. The genes were cloned into the EcoRI and HindIII (New England BioLabs GmbH, Frankfurt am Main, Germany) sites in pUC19 (T4 ligase; Thermo Fisher Scientific).

    Transmission Electron Microscopy:

    Article Title: Francisella tularensis IglG Belongs to a Novel Family of PAAR-Like T6SS Proteins and Harbors a Unique N-terminal Extension Required for Virulence
    Article Snippet: The latter plasmid was also used to create TEM fusion after removal of the plasmid encoded β-lactamase gene. .. E . coli TEM-1 amplified from pUC19 (ThermoFisher Scientific) was then cloned under the Gro promoter using Nhe I/Bam HI sites. .. FPI and controls genes were cloned in frame with TEM-1 using Eco RI and Nhe I sites.

    DNA Extraction:

    Article Title: Transmitted/Founder Hepatitis C Viruses Induce Cell-Type- and Genotype-Specific Differences in Innate Signaling within the Liver
    Article Snippet: T/F and pUC19 (Invitrogen) DNA plasmids were transformed into Max Efficiency Stbl2 competent cells (Invitrogen), and bacteria were plated on Luria-Bertani (LB) agar plates supplemented with ampicillin and incubated overnight at 30°C. .. T/F and pUC19 (Invitrogen) DNA plasmids were transformed into Max Efficiency Stbl2 competent cells (Invitrogen), and bacteria were plated on Luria-Bertani (LB) agar plates supplemented with ampicillin and incubated overnight at 30°C.

    Nucleic Acid Electrophoresis:

    Article Title: A conformational RNA zipper promotes intron ejection during non‐conventional XBP1 mRNA splicing
    Article Snippet: Long sense and antisense oligonucleotides containing a minimal T7 RNA polymerase promoter (5′‐TAATACGACTCACTATAGG‐3′) fused upstream of the sequence containing the XBP1 BSL of human origin (nucleotides 513–592 of NCBI Reference Sequence NM_005080.3) and an RNA polymerase III terminator sequence (5′‐TGGCTTTTT‐3′) of RNY4 of human origin (NCBI Reference Sequence NR_004393.1) fused downstream of the XBP1 BSL sequence and harboring 5′‐EcoRI and 3′‐BamHI overhangs were annealed and ligated into the cognate restriction sites of pUC19 (Invitrogen, Life Technologies). .. The resulting clone, pUC19‐T7‐hXBP1‐BSL‐Y4, was digested with BamHI, purified and used as a template for in vitro transcription reactions with T7 RNA polymerase using the HiScribe T7 high‐yield RNA synthesis kit (New England Biolabs) following the manufacturer's recommendations.

    DNA Cleavage Assay:

    Article Title: Creation of a type IIS restriction endonuclease with a long recognition sequence
    Article Snippet: Paragraph title: DNA cleavage assay ... To construct a DNA substrate for I-SceI and the chimeric endonucleases, two complementary oligonucleotides containing the I-SceI target site (5′-AATTCTGGTTCCGAA GCCTGTCCTGCACGC TAGGGATAACAGGGTAAT AATATATGAATCCAAACTAGAGCGGGGCTCTT GACGTTTGGCTCAAAACGTCGTGAGACAGTTTG GTCAGTTGTAAATATCTAATATTCCAATG-3′ and 5′-GATCCATTGGAATATTAGATATTTACAACTGA CCAAACTGTCTCACGACGTTTTGAGCCAAACGT CAAGAGCCCCGCTCTAGTTTGGATTCATATATT ATTACCCTGTTATCCCTA GCGT GCAGGACAGGCTTCGGAACCAG-3′; the I-SceI target site is underlined) were annealed, phosphorylated, and ligated between the EcoRI and BamHI restriction sites of pUC19 (Invitrogen).

    Fluorescence:

    Article Title: Differences in codon bias and GC content contribute to the balanced expression of TLR7 and TLR9
    Article Snippet: To generate RAW Cas9 Lines, tdTomato and Tlr7 sequences lacking the ATG translation start codon were cloned into pUC19 (Life Technologies) flanked by homology arms derived from the genomic sequence adjacent to exon 3 of Tlr7 (741 bp upstream, 845 bp downstream). .. RAW264.7 cells were transfected using Lipofectamine LTX with equal amounts the guide RNA plasmid, Cas9 plasmid, and donor template plasmid.

    Mutagenesis:

    Article Title: Novel Type of Hepatitis B Virus Mutation: Replacement Mutation Involving a Hepatocyte Nuclear Factor 1 Binding Site Tandem Repeat in Chronic Hepatitis B Virus Genotype E
    Article Snippet: Of these, pGEM-fragA-3 and pGEM-fragB-2, with consensus sequences and without core deletion or replacement mutation (not major clones), were used as templates to construct HBV replicons. .. Finally, the fragments C-B-HindIII-AvrII and pGEM-fragA-C, cut with AvrII and SacI, were cloned into pUC19 without promoters (Invitrogen) cut with HindIII and SacI, and a pUC19-HBV/E wild-type replicon encoding a replication-competent 1.35-unit-length HBV genome was produced.

    Article Title: The Borrelia burgdorferi Glycosaminoglycan Binding Protein Bgp in the B31 Strain Is Not Essential for Infectivity despite Facilitating Adherence and Tissue Colonization
    Article Snippet: The bgp gene is disrupted by a gentamicin-containing transposon from pMarGentKan ( ). .. Genomic DNA from the bgp mutant strain was isolated by standard genomic DNA purification, digested with the restriction enzyme Spe1 (New England BioLabs, Ipswich, MA), and cloned in pUC19 (Thermo Scientific, Waltham, MA). .. Transformation of Top10 competent E. coli cells was followed by selection on gentamicin (15 μg/ml)-containing Luria-Bertani plates to select for the DNA fragment containing the resistance cassette of the transposon.

    Isolation:

    Article Title: Evidence for Horizontal Transfer of SsuDAT1I Restriction-Modification Genes to the Streptococcus suis Genome
    Article Snippet: Other S. suis strains were independently isolated from diseases pigs in Japan and stocked in our laboratory. .. The plasmid vectors used for gene cloning were pUC19 , pCR2.1 (Invitrogen, Groningen, The Netherlands), and pHSG576 ( ).

    Article Title: The α-Crystallin Domain Containing Genes: Identification, Phylogeny and Expression Profiling in Abiotic Stress, Phytohormone Response and Development in Tomato (Solanum lycopersicum)
    Article Snippet: The expression was computed in form of heat maps for abiotic stress conditions. .. The open reading frame (ORF) sequences for SlHsp17.6C-CI, SlHsp24.5-CI, SlHsp26.5-PX , and SlAcd15.7-CI were amplified using cDNA synthesized from total RNA isolated from acclimated high temperature stressed tomato leaf tissue (4 h), cloned into Sma I linearized pUC19 (Thermo Scientific, USA) and confirmed by sequencing. .. The ORFs were then introduced into the pET28a vector between the Nde I and Xho I sites for recombinant protein expression.

    Article Title: The Borrelia burgdorferi Glycosaminoglycan Binding Protein Bgp in the B31 Strain Is Not Essential for Infectivity despite Facilitating Adherence and Tissue Colonization
    Article Snippet: The bgp gene is disrupted by a gentamicin-containing transposon from pMarGentKan ( ). .. Genomic DNA from the bgp mutant strain was isolated by standard genomic DNA purification, digested with the restriction enzyme Spe1 (New England BioLabs, Ipswich, MA), and cloned in pUC19 (Thermo Scientific, Waltham, MA). .. Transformation of Top10 competent E. coli cells was followed by selection on gentamicin (15 μg/ml)-containing Luria-Bertani plates to select for the DNA fragment containing the resistance cassette of the transposon.

    Article Title: Indole Biodegradation in Acinetobacter sp. Strain O153: Genetic and Biochemical Characterization
    Article Snippet: Paragraph title: Isolation and identification of an indole-oxidizing bacterial strain. ... Genomic DNA of strain O153 was extracted as described previously , digested with HindIII (ThermoFisher Scientific) to obtain 5- to 20-kb DNA fragments, which were cloned into pUC19 (ThermoFisher Scientific).

    Article Title: Differences in codon bias and GC content contribute to the balanced expression of TLR7 and TLR9
    Article Snippet: Individual hygromycin-B (Life Technologies)–resistant colonies were isolated and tested for protein expression after the addition of doxycycline (Sigma). .. To generate RAW Cas9 Lines, tdTomato and Tlr7 sequences lacking the ATG translation start codon were cloned into pUC19 (Life Technologies) flanked by homology arms derived from the genomic sequence adjacent to exon 3 of Tlr7 (741 bp upstream, 845 bp downstream).

    Purification:

    Article Title: A One-Step Miniprep for the Isolation of Plasmid DNA and Lambda Phage Particles
    Article Snippet: DH5α cells were supplied by Invitrogen (Carlsbad, CA). .. The following high copy number plasmids were used: 1) pUC19 (2.7 Kb), purchased from Invitrogen (Carlsbad, CA); 2) pCYPAC3 (18.8 Kb) , a pUC-based plasmid, kindly provided by S. O′Brien (NCI, Frederick, MD); 3) pLTM330 (6.5 Kb), a pBluescript-based plasmid, kindly provided by L. Tessarollo (NCI, Frederick, MD); and 4) B254 (6.06 Kb), a pBluescript-based plasmid, kindly provided by E. Leibold (University of Utah, Salt Lake City, UT). pEL04 (5.07 Kb, ts pSC101 oriR), a low copy number plasmid (Qiagen® Plasmid Purification Handbook 3rd Edition, Nov 2005, pg. .. 12), was kindly provided by NCI-Frederick, MD ( http://web.ncifcrf.gov/research/brb/ productDataSheets/recombineering/plasmid.aspx).

    Article Title: A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells
    Article Snippet: Reactions were incubated overnight at 37°C with 40 U of DpnI, purified and transformed. .. The specR fragment was generated by PCR amplification of the SpecR gene via the oligonucleotides cpec-assembly-for-spec and cpec-assembly-rev-spec. pUC19 (ThermoFisher Scientific, Waltham, MA, USA) was similarly modified.

    Article Title: The α-Crystallin Domain Containing Genes: Identification, Phylogeny and Expression Profiling in Abiotic Stress, Phytohormone Response and Development in Tomato (Solanum lycopersicum)
    Article Snippet: The open reading frame (ORF) sequences for SlHsp17.6C-CI, SlHsp24.5-CI, SlHsp26.5-PX , and SlAcd15.7-CI were amplified using cDNA synthesized from total RNA isolated from acclimated high temperature stressed tomato leaf tissue (4 h), cloned into Sma I linearized pUC19 (Thermo Scientific, USA) and confirmed by sequencing. .. The pET28a-His-Hsp17.6C-CI, pET28a-His-Hsp24.5-CI, pET28a-His-Hsp26.5-PX , and pET28a-His-Acd15.7-CI plasmids were transformed into E. coli BL21, BL21 (DE3), BL21 (DE3) pLys, and BL21 Rosetta cells, respectively.

    Article Title: Filter paper-based spin column method for cost-efficient DNA or RNA purification
    Article Snippet: Leaf samples for RNA purification were immediately frozen in liquid nitrogen after collection and ground into a fine powder in liquid nitrogen. .. 50 to 100 mg ground samples were transferred into a tube and used immediately or stored at -80°C prior to use. pUC19 and pBI121 plasmids were purchased from Invitrogen (Carlsbad, CA).

    Article Title: A conformational RNA zipper promotes intron ejection during non‐conventional XBP1 mRNA splicing
    Article Snippet: Long sense and antisense oligonucleotides containing a minimal T7 RNA polymerase promoter (5′‐TAATACGACTCACTATAGG‐3′) fused upstream of the sequence containing the XBP1 BSL of human origin (nucleotides 513–592 of NCBI Reference Sequence NM_005080.3) and an RNA polymerase III terminator sequence (5′‐TGGCTTTTT‐3′) of RNY4 of human origin (NCBI Reference Sequence NR_004393.1) fused downstream of the XBP1 BSL sequence and harboring 5′‐EcoRI and 3′‐BamHI overhangs were annealed and ligated into the cognate restriction sites of pUC19 (Invitrogen, Life Technologies). .. The resulting clone, pUC19‐T7‐hXBP1‐BSL‐Y4, was digested with BamHI, purified and used as a template for in vitro transcription reactions with T7 RNA polymerase using the HiScribe T7 high‐yield RNA synthesis kit (New England Biolabs) following the manufacturer's recommendations.

    Article Title: Creation of a type IIS restriction endonuclease with a long recognition sequence
    Article Snippet: To construct a DNA substrate for I-SceI and the chimeric endonucleases, two complementary oligonucleotides containing the I-SceI target site (5′-AATTCTGGTTCCGAA GCCTGTCCTGCACGC TAGGGATAACAGGGTAAT AATATATGAATCCAAACTAGAGCGGGGCTCTT GACGTTTGGCTCAAAACGTCGTGAGACAGTTTG GTCAGTTGTAAATATCTAATATTCCAATG-3′ and 5′-GATCCATTGGAATATTAGATATTTACAACTGA CCAAACTGTCTCACGACGTTTTGAGCCAAACGT CAAGAGCCCCGCTCTAGTTTGGATTCATATATT ATTACCCTGTTATCCCTA GCGT GCAGGACAGGCTTCGGAACCAG-3′; the I-SceI target site is underlined) were annealed, phosphorylated, and ligated between the EcoRI and BamHI restriction sites of pUC19 (Invitrogen). .. The plasmid, named pSCI, was propagated in and extracted from E. coli OneShot Top 10 (Invitrogen), linearized by cleavage with AlwNI (New England Biolabs, Ipswich, MA) and purified using standard isopropanol/acetate precipitation.

    Sequencing:

    Article Title: Comparative Analysis of the Recently Discovered hAT Transposon TcBuster in Human Cells
    Article Snippet: All plasmids were prepared for assays by endotoxin-free maxiprep (Qiagen, Valencia, CA). pUC19 (Invitrogen, Carlsbad, CA) was used as filler plasmid DNA for the FuGene6 transfections. .. All plasmids were prepared for assays by endotoxin-free maxiprep (Qiagen, Valencia, CA). pUC19 (Invitrogen, Carlsbad, CA) was used as filler plasmid DNA for the FuGene6 transfections.

    Article Title: A simple and efficient method to visualize and quantify the efficiency of chromosomal mutations from genome editing
    Article Snippet: For TALEN mRNA injection, equal amounts of the TALEN-L (left) and -R (right) arm mRNAs were mixed and injected into the fertilized egg at 400 pg for each mRNA/egg. .. The plasmid expressing a fusion protein of mCherry and GFP (pmCherry-GFP) was constructed from pUC19 (Invitrogen, Waltham, MA, USA) by inserting the mCherry coding sequence between the SalI and HindIII sites of the multi-cloning sites (MCS) of the pUC19 to allow in-frame expression of mCherry and the LacZα gene in pUC19, and then replacing the LacZα coding region with super folding green fluorescent gene (sfGFP, GenBank # HQ873313). .. Briefly, mCherry coding sequences were PCR amplified from plasmid Nanog-2A-mCherry (a gift from Dr. Rudolf Jaenisch (Addgene plasmid # 59995) with primers 5′-cggcgcagaGTCGACttgtacagctcgtccatgcc-3′ (Sal I site capitalized) and 5′-gattacgccAAGCTTgatggtgagcaagggcgaggaggata-3′ (Hind III site capitalized).

    Article Title: Folding of Hepatitis C Virus E1 Glycoprotein in a Cell-Free System
    Article Snippet: All other reagents were purchased from Sigma Biochemicals (St. Louis, Mo.). .. The full-length consensus sequence of HCV type 1 (HCV-1) was cloned into the Hin dIII- Xba I site of pUC19 (Invitrogen), resulting in the pUC-HCV-1PC clone (A. J. Weiner, unpublished data). .. DNA templates for RNA synthesis were generated by amplification of this recombinant plasmid with the appropriate pair of primers.

    Article Title: Francisella tularensis IglG Belongs to a Novel Family of PAAR-Like T6SS Proteins and Harbors a Unique N-terminal Extension Required for Virulence
    Article Snippet: 2xHA-tagged IglG was generated by cloning iglG in frame with a single HA tag sequence in the popHA plasmid (kindly provided by P. Mangeot) followed by addition of a second HA tag sequence by PCR amplification. .. E . coli TEM-1 amplified from pUC19 (ThermoFisher Scientific) was then cloned under the Gro promoter using Nhe I/Bam HI sites.

    Article Title: A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells
    Article Snippet: All other plasmids described in this study contained specR to facilitate sequencing experiments. .. The specR fragment was generated by PCR amplification of the SpecR gene via the oligonucleotides cpec-assembly-for-spec and cpec-assembly-rev-spec. pUC19 (ThermoFisher Scientific, Waltham, MA, USA) was similarly modified.

    Article Title: The α-Crystallin Domain Containing Genes: Identification, Phylogeny and Expression Profiling in Abiotic Stress, Phytohormone Response and Development in Tomato (Solanum lycopersicum)
    Article Snippet: The expression was computed in form of heat maps for abiotic stress conditions. .. The open reading frame (ORF) sequences for SlHsp17.6C-CI, SlHsp24.5-CI, SlHsp26.5-PX , and SlAcd15.7-CI were amplified using cDNA synthesized from total RNA isolated from acclimated high temperature stressed tomato leaf tissue (4 h), cloned into Sma I linearized pUC19 (Thermo Scientific, USA) and confirmed by sequencing. .. The ORFs were then introduced into the pET28a vector between the Nde I and Xho I sites for recombinant protein expression.

    Article Title: Transmitted/Founder Hepatitis C Viruses Induce Cell-Type- and Genotype-Specific Differences in Innate Signaling within the Liver
    Article Snippet: Full-length HCV T/F sequences were determined from acute infection plasma vRNA by single-genome sequencing, phylogenetic inference, and a mathematical model of random early virus diversification, as described previously ( , ). .. T/F and pUC19 (Invitrogen) DNA plasmids were transformed into Max Efficiency Stbl2 competent cells (Invitrogen), and bacteria were plated on Luria-Bertani (LB) agar plates supplemented with ampicillin and incubated overnight at 30°C.

    Article Title: The Borrelia burgdorferi Glycosaminoglycan Binding Protein Bgp in the B31 Strain Is Not Essential for Infectivity despite Facilitating Adherence and Tissue Colonization
    Article Snippet: Genomic DNA from the bgp mutant strain was isolated by standard genomic DNA purification, digested with the restriction enzyme Spe1 (New England BioLabs, Ipswich, MA), and cloned in pUC19 (Thermo Scientific, Waltham, MA). .. Plasmids were isolated and sequenced using bgp primers to determine the location and direction of the transposon within the gene.

    Article Title: Differences in codon bias and GC content contribute to the balanced expression of TLR7 and TLR9
    Article Snippet: Individual hygromycin-B (Life Technologies)–resistant colonies were isolated and tested for protein expression after the addition of doxycycline (Sigma). .. To generate RAW Cas9 Lines, tdTomato and Tlr7 sequences lacking the ATG translation start codon were cloned into pUC19 (Life Technologies) flanked by homology arms derived from the genomic sequence adjacent to exon 3 of Tlr7 (741 bp upstream, 845 bp downstream). .. Guide RNAs were designed and synthesized as gBlocks as previously described ( ) and then were subcloned into pUC19.

    Article Title: Different Stress-Induced Calcium Signatures Are Reported by Aequorin-Mediated Calcium Measurements in Living Cells of Aspergillus fumigatus
    Article Snippet: The resulting pAEQ(I) plasmid contains a sequence encoding the promoter region (from -433 to -1 with respect to the ATG) of the constitutively expressed Aspergillus nidulans glyceraldehyde-3-phosphate dehydrogenase gene (ANIA_08041) designated gpdA P ; and a 1997 bp targeting sequence identical to the region intergenic to the A . fumigatus genes AFUA_3G05360 and AFUA_3G05370. .. The plasmid pAEQ(II) was assembled using GeneArt technology and pUC19 (both from Invitrogen).

    Article Title: A conformational RNA zipper promotes intron ejection during non‐conventional XBP1 mRNA splicing
    Article Snippet: The custom tracks (BigWig files) were uploaded into the University of California at Santa Cruz (UCSC) Genome browser ( http://genome.ucsc.edu , and ) and displayed on the 2011 mouse genome assembly (UCSC mm10; Genome Reference Consortium GRCm38). .. Long sense and antisense oligonucleotides containing a minimal T7 RNA polymerase promoter (5′‐TAATACGACTCACTATAGG‐3′) fused upstream of the sequence containing the XBP1 BSL of human origin (nucleotides 513–592 of NCBI Reference Sequence NM_005080.3) and an RNA polymerase III terminator sequence (5′‐TGGCTTTTT‐3′) of RNY4 of human origin (NCBI Reference Sequence NR_004393.1) fused downstream of the XBP1 BSL sequence and harboring 5′‐EcoRI and 3′‐BamHI overhangs were annealed and ligated into the cognate restriction sites of pUC19 (Invitrogen, Life Technologies). .. The resulting clone, pUC19‐T7‐hXBP1‐BSL‐Y4, was digested with BamHI, purified and used as a template for in vitro transcription reactions with T7 RNA polymerase using the HiScribe T7 high‐yield RNA synthesis kit (New England Biolabs) following the manufacturer's recommendations.

    RNA Expression:

    Article Title: A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells
    Article Snippet: Fragments for CPEC were generated by PCR amplification of a guide RNA expression vector with oligonucleotides cpec-assembly-for-spec2 and cpec assembly-rev. .. The specR fragment was generated by PCR amplification of the SpecR gene via the oligonucleotides cpec-assembly-for-spec and cpec-assembly-rev-spec. pUC19 (ThermoFisher Scientific, Waltham, MA, USA) was similarly modified.

    Plasmid Preparation:

    Article Title: Comparative Analysis of the Recently Discovered hAT Transposon TcBuster in Human Cells
    Article Snippet: Future studies will test TcBuster in specific applications of transgenesis, insertional mutagenesis, and pre-clinical gene therapy in mammals to capitalize on the impressive performance of TcBuster in vitro . .. All plasmids were prepared for assays by endotoxin-free maxiprep (Qiagen, Valencia, CA). pUC19 (Invitrogen, Carlsbad, CA) was used as filler plasmid DNA for the FuGene6 transfections. .. The blasticidin resistance gene donor and transposase-expressing helper plasmids (pXL-TcB-D-GFP/Bsd and pXL-CMV-TcBusterCO for TcBuster , pXL-PB-D-GFP/Bsd and pXL-CMV-piggyBac for piggyBac , or pXL-SB-D-GFP/Bsd and pXL-CMV-Sleeping Beauty for Sleeping Beauty ) used for excision PCR and integration site analysis are described elsewhere .

    Article Title: Novel Type of Hepatitis B Virus Mutation: Replacement Mutation Involving a Hepatocyte Nuclear Factor 1 Binding Site Tandem Repeat in Chronic Hepatitis B Virus Genotype E
    Article Snippet: Paragraph title: Plasmid construction for replication model (replicon). ... Finally, the fragments C-B-HindIII-AvrII and pGEM-fragA-C, cut with AvrII and SacI, were cloned into pUC19 without promoters (Invitrogen) cut with HindIII and SacI, and a pUC19-HBV/E wild-type replicon encoding a replication-competent 1.35-unit-length HBV genome was produced.

    Article Title: A simple and efficient method to visualize and quantify the efficiency of chromosomal mutations from genome editing
    Article Snippet: For TALEN mRNA injection, equal amounts of the TALEN-L (left) and -R (right) arm mRNAs were mixed and injected into the fertilized egg at 400 pg for each mRNA/egg. .. The plasmid expressing a fusion protein of mCherry and GFP (pmCherry-GFP) was constructed from pUC19 (Invitrogen, Waltham, MA, USA) by inserting the mCherry coding sequence between the SalI and HindIII sites of the multi-cloning sites (MCS) of the pUC19 to allow in-frame expression of mCherry and the LacZα gene in pUC19, and then replacing the LacZα coding region with super folding green fluorescent gene (sfGFP, GenBank # HQ873313). .. Briefly, mCherry coding sequences were PCR amplified from plasmid Nanog-2A-mCherry (a gift from Dr. Rudolf Jaenisch (Addgene plasmid # 59995) with primers 5′-cggcgcagaGTCGACttgtacagctcgtccatgcc-3′ (Sal I site capitalized) and 5′-gattacgccAAGCTTgatggtgagcaagggcgaggaggata-3′ (Hind III site capitalized).

    Article Title: Folding of Hepatitis C Virus E1 Glycoprotein in a Cell-Free System
    Article Snippet: The full-length consensus sequence of HCV type 1 (HCV-1) was cloned into the Hin dIII- Xba I site of pUC19 (Invitrogen), resulting in the pUC-HCV-1PC clone (A. J. Weiner, unpublished data). .. DNA templates for RNA synthesis were generated by amplification of this recombinant plasmid with the appropriate pair of primers.

    Article Title: A One-Step Miniprep for the Isolation of Plasmid DNA and Lambda Phage Particles
    Article Snippet: DH5α cells were supplied by Invitrogen (Carlsbad, CA). .. The following high copy number plasmids were used: 1) pUC19 (2.7 Kb), purchased from Invitrogen (Carlsbad, CA); 2) pCYPAC3 (18.8 Kb) , a pUC-based plasmid, kindly provided by S. O′Brien (NCI, Frederick, MD); 3) pLTM330 (6.5 Kb), a pBluescript-based plasmid, kindly provided by L. Tessarollo (NCI, Frederick, MD); and 4) B254 (6.06 Kb), a pBluescript-based plasmid, kindly provided by E. Leibold (University of Utah, Salt Lake City, UT). pEL04 (5.07 Kb, ts pSC101 oriR), a low copy number plasmid (Qiagen® Plasmid Purification Handbook 3rd Edition, Nov 2005, pg. .. 12), was kindly provided by NCI-Frederick, MD ( http://web.ncifcrf.gov/research/brb/ productDataSheets/recombineering/plasmid.aspx).

    Article Title: Evidence for Horizontal Transfer of SsuDAT1I Restriction-Modification Genes to the Streptococcus suis Genome
    Article Snippet: E. coli strains used were SCS110 ( thr leu endA thi-1 lacY galK galT ara tonA tsx dam dcm supE44 rpsL Δ( lac-proAB ) [F′ traD36 proAB lacI q Z ΔM15]) (Stratagene, La Jolla, Calif.), C600 (F− thr-1 thi-1 leuB6 lacY1 tonA21 supE44 ) , XL-1 blue MRF′ [Δ( mcrA ) 183 Δ( mcrCB-hsdSMR-mrr ) 173 endA1 supE44 thi-1 recA1 gyrA96 relA1 lac [F′ proAB lacI q Z ΔM15 Tn 10 ]) (Stratagene), XLOLR {Δ( mcrA ) 183 Δ( mcrCB-hsdSMR-mrr ) 173 endA1 thi-1 recA1 gyrA96 relA1 lac [F′ proAB lacI q Z ΔM15 Tn 10 ] Su− λ− } (Stratagene), and DH5α (F− endA1 recA1 hsdR17 (rK − mK + ) supE44 thi-1 gyrA relA1 φ80 lacZ ΔM15 Δ( lacZYA-argF ) deoR + ) ( ). .. The plasmid vectors used for gene cloning were pUC19 , pCR2.1 (Invitrogen, Groningen, The Netherlands), and pHSG576 ( ). .. Phagemid vector λZAP Express (Stratagene) was used for the construction of the genomic library.

    Article Title: Francisella tularensis IglG Belongs to a Novel Family of PAAR-Like T6SS Proteins and Harbors a Unique N-terminal Extension Required for Virulence
    Article Snippet: The latter plasmid was also used to create TEM fusion after removal of the plasmid encoded β-lactamase gene. .. E . coli TEM-1 amplified from pUC19 (ThermoFisher Scientific) was then cloned under the Gro promoter using Nhe I/Bam HI sites.

    Article Title: A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells
    Article Snippet: Fragments for CPEC were generated by PCR amplification of a guide RNA expression vector with oligonucleotides cpec-assembly-for-spec2 and cpec assembly-rev. .. The specR fragment was generated by PCR amplification of the SpecR gene via the oligonucleotides cpec-assembly-for-spec and cpec-assembly-rev-spec. pUC19 (ThermoFisher Scientific, Waltham, MA, USA) was similarly modified.

    Article Title: Transmitted/Founder Hepatitis C Viruses Induce Cell-Type- and Genotype-Specific Differences in Innate Signaling within the Liver
    Article Snippet: Paragraph title: T/F virus DNA plasmid and vRNA generation. ... T/F and pUC19 (Invitrogen) DNA plasmids were transformed into Max Efficiency Stbl2 competent cells (Invitrogen), and bacteria were plated on Luria-Bertani (LB) agar plates supplemented with ampicillin and incubated overnight at 30°C.

    Article Title: Differences in codon bias and GC content contribute to the balanced expression of TLR7 and TLR9
    Article Snippet: To generate RAW Cas9 Lines, tdTomato and Tlr7 sequences lacking the ATG translation start codon were cloned into pUC19 (Life Technologies) flanked by homology arms derived from the genomic sequence adjacent to exon 3 of Tlr7 (741 bp upstream, 845 bp downstream). .. To generate RAW Cas9 Lines, tdTomato and Tlr7 sequences lacking the ATG translation start codon were cloned into pUC19 (Life Technologies) flanked by homology arms derived from the genomic sequence adjacent to exon 3 of Tlr7 (741 bp upstream, 845 bp downstream).

    Article Title: Filter paper-based spin column method for cost-efficient DNA or RNA purification
    Article Snippet: Paragraph title: Plant materials, plasmid DNA and PCR products ... 50 to 100 mg ground samples were transferred into a tube and used immediately or stored at -80°C prior to use. pUC19 and pBI121 plasmids were purchased from Invitrogen (Carlsbad, CA).

    Article Title: Different Stress-Induced Calcium Signatures Are Reported by Aequorin-Mediated Calcium Measurements in Living Cells of Aspergillus fumigatus
    Article Snippet: The resulting pAEQ(I) plasmid contains a sequence encoding the promoter region (from -433 to -1 with respect to the ATG) of the constitutively expressed Aspergillus nidulans glyceraldehyde-3-phosphate dehydrogenase gene (ANIA_08041) designated gpdA P ; and a 1997 bp targeting sequence identical to the region intergenic to the A . fumigatus genes AFUA_3G05360 and AFUA_3G05370. .. The plasmid pAEQ(II) was assembled using GeneArt technology and pUC19 (both from Invitrogen). .. The plasmid comprises the aeqS gene, also (as above) fused downstream of gpdA P .

    Article Title: Creation of a type IIS restriction endonuclease with a long recognition sequence
    Article Snippet: To construct a DNA substrate for I-SceI and the chimeric endonucleases, two complementary oligonucleotides containing the I-SceI target site (5′-AATTCTGGTTCCGAA GCCTGTCCTGCACGC TAGGGATAACAGGGTAAT AATATATGAATCCAAACTAGAGCGGGGCTCTT GACGTTTGGCTCAAAACGTCGTGAGACAGTTTG GTCAGTTGTAAATATCTAATATTCCAATG-3′ and 5′-GATCCATTGGAATATTAGATATTTACAACTGA CCAAACTGTCTCACGACGTTTTGAGCCAAACGT CAAGAGCCCCGCTCTAGTTTGGATTCATATATT ATTACCCTGTTATCCCTA GCGT GCAGGACAGGCTTCGGAACCAG-3′; the I-SceI target site is underlined) were annealed, phosphorylated, and ligated between the EcoRI and BamHI restriction sites of pUC19 (Invitrogen). .. The plasmid, named pSCI, was propagated in and extracted from E. coli OneShot Top 10 (Invitrogen), linearized by cleavage with AlwNI (New England Biolabs, Ipswich, MA) and purified using standard isopropanol/acetate precipitation.

    Software:

    Article Title: Mlh1-Mlh3, a Meiotic Crossover and DNA Mismatch Repair Factor, Is a Msh2-Msh3-stimulated Endonuclease
    Article Snippet: Mlh1-Mlh3 nicking activity was assayed on supercoiled or nicked pUC19 (Thermo Scientific). .. Reactions were quenched by incubation for 20 min at 37 °C with 0.1% SDS, 14 m m EDTA, and 0.1 mg/ml proteinase K (New England Biolabs) (final concentrations).

    Functional Assay:

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: Paragraph title: Functional complementation study. ... The genes were cloned into the EcoRI and HindIII (New England BioLabs GmbH, Frankfurt am Main, Germany) sites in pUC19 (T4 ligase; Thermo Fisher Scientific).

    Selection:

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: The genes were cloned into the EcoRI and HindIII (New England BioLabs GmbH, Frankfurt am Main, Germany) sites in pUC19 (T4 ligase; Thermo Fisher Scientific). .. The genes were cloned into the EcoRI and HindIII (New England BioLabs GmbH, Frankfurt am Main, Germany) sites in pUC19 (T4 ligase; Thermo Fisher Scientific).

    Article Title: Different Stress-Induced Calcium Signatures Are Reported by Aequorin-Mediated Calcium Measurements in Living Cells of Aspergillus fumigatus
    Article Snippet: In all instances, the ampicillin resistance marker (bla ) was used for selection and maintenance in bacterial cells. .. The plasmid pAEQ(II) was assembled using GeneArt technology and pUC19 (both from Invitrogen).

    Agarose Gel Electrophoresis:

    Article Title: Mlh1-Mlh3, a Meiotic Crossover and DNA Mismatch Repair Factor, Is a Msh2-Msh3-stimulated Endonuclease
    Article Snippet: Mlh1-Mlh3 nicking activity was assayed on supercoiled or nicked pUC19 (Thermo Scientific). .. Reactions were quenched by incubation for 20 min at 37 °C with 0.1% SDS, 14 m m EDTA, and 0.1 mg/ml proteinase K (New England Biolabs) (final concentrations).

    Article Title: Transmitted/Founder Hepatitis C Viruses Induce Cell-Type- and Genotype-Specific Differences in Innate Signaling within the Liver
    Article Snippet: T/F and pUC19 (Invitrogen) DNA plasmids were transformed into Max Efficiency Stbl2 competent cells (Invitrogen), and bacteria were plated on Luria-Bertani (LB) agar plates supplemented with ampicillin and incubated overnight at 30°C. .. T/F and pUC19 (Invitrogen) DNA plasmids were transformed into Max Efficiency Stbl2 competent cells (Invitrogen), and bacteria were plated on Luria-Bertani (LB) agar plates supplemented with ampicillin and incubated overnight at 30°C.

    In Vitro:

    Article Title: Transmitted/Founder Hepatitis C Viruses Induce Cell-Type- and Genotype-Specific Differences in Innate Signaling within the Liver
    Article Snippet: Full-genome-length T/F genomic sequences were generated by single-genome amplification chemically synthesized in 4 to 5 fragments (Blue Heron, Inc.), and ligated into low-copy-number pBR322 plasmids under control of the T7 promoter, which was added to the 5′ end of the HCV genome in five overlapping fragments, and these sequences were used to enable in vitro transcription. .. T/F and pUC19 (Invitrogen) DNA plasmids were transformed into Max Efficiency Stbl2 competent cells (Invitrogen), and bacteria were plated on Luria-Bertani (LB) agar plates supplemented with ampicillin and incubated overnight at 30°C.

    Produced:

    Article Title: Novel Type of Hepatitis B Virus Mutation: Replacement Mutation Involving a Hepatocyte Nuclear Factor 1 Binding Site Tandem Repeat in Chronic Hepatitis B Virus Genotype E
    Article Snippet: The PCR product was also cloned, and pGEM-fragA-C was produced. .. Finally, the fragments C-B-HindIII-AvrII and pGEM-fragA-C, cut with AvrII and SacI, were cloned into pUC19 without promoters (Invitrogen) cut with HindIII and SacI, and a pUC19-HBV/E wild-type replicon encoding a replication-competent 1.35-unit-length HBV genome was produced. .. In addition, the pUC19-HBV/E wild-type replicon was digested by RsrIII and XbaI, the fragment with the replacement mutation from patient 2 (strain UK2), cut with RsrIII and XbalI, was ligated, and a pUC19-HBV/E replacement replicon was produced.

    Concentration Assay:

    Article Title: Structural and Functional Analysis of the Symmetrical Type I Restriction Endonuclease R.EcoR124INT
    Article Snippet: The plasmids: pUC19 (Invitrogen, 2686bp) containing two recognition sites at positions 1126 bp and 2294 bp ( GAACCCCCCGTTC and GAAAACGTTCTTC , respectively), and pTK-neo (Novagen, 2872 bp) containing one site at position 2535 bp ( GAACGGGGGGTTC ) were used as the DNA substrates. .. The plasmids: pUC19 (Invitrogen, 2686bp) containing two recognition sites at positions 1126 bp and 2294 bp ( GAACCCCCCGTTC and GAAAACGTTCTTC , respectively), and pTK-neo (Novagen, 2872 bp) containing one site at position 2535 bp ( GAACGGGGGGTTC ) were used as the DNA substrates.

    DNA Purification:

    Article Title: The Borrelia burgdorferi Glycosaminoglycan Binding Protein Bgp in the B31 Strain Is Not Essential for Infectivity despite Facilitating Adherence and Tissue Colonization
    Article Snippet: The bgp gene is disrupted by a gentamicin-containing transposon from pMarGentKan ( ). .. Genomic DNA from the bgp mutant strain was isolated by standard genomic DNA purification, digested with the restriction enzyme Spe1 (New England BioLabs, Ipswich, MA), and cloned in pUC19 (Thermo Scientific, Waltham, MA). .. Transformation of Top10 competent E. coli cells was followed by selection on gentamicin (15 μg/ml)-containing Luria-Bertani plates to select for the DNA fragment containing the resistance cassette of the transposon.

    Article Title: Filter paper-based spin column method for cost-efficient DNA or RNA purification
    Article Snippet: 50 to 100 mg ground samples were transferred into a tube and used immediately or stored at -80°C prior to use. pUC19 and pBI121 plasmids were purchased from Invitrogen (Carlsbad, CA). .. 50 to 100 mg ground samples were transferred into a tube and used immediately or stored at -80°C prior to use. pUC19 and pBI121 plasmids were purchased from Invitrogen (Carlsbad, CA).

    Marker:

    Article Title: Different Stress-Induced Calcium Signatures Are Reported by Aequorin-Mediated Calcium Measurements in Living Cells of Aspergillus fumigatus
    Article Snippet: In all instances, the ampicillin resistance marker (bla ) was used for selection and maintenance in bacterial cells. .. The plasmid pAEQ(II) was assembled using GeneArt technology and pUC19 (both from Invitrogen).

    FACS:

    Article Title: Differences in codon bias and GC content contribute to the balanced expression of TLR7 and TLR9
    Article Snippet: To generate RAW Cas9 Lines, tdTomato and Tlr7 sequences lacking the ATG translation start codon were cloned into pUC19 (Life Technologies) flanked by homology arms derived from the genomic sequence adjacent to exon 3 of Tlr7 (741 bp upstream, 845 bp downstream). .. RAW264.7 cells were transfected using Lipofectamine LTX with equal amounts the guide RNA plasmid, Cas9 plasmid, and donor template plasmid.

    Synthesized:

    Article Title: The α-Crystallin Domain Containing Genes: Identification, Phylogeny and Expression Profiling in Abiotic Stress, Phytohormone Response and Development in Tomato (Solanum lycopersicum)
    Article Snippet: The expression was computed in form of heat maps for abiotic stress conditions. .. The open reading frame (ORF) sequences for SlHsp17.6C-CI, SlHsp24.5-CI, SlHsp26.5-PX , and SlAcd15.7-CI were amplified using cDNA synthesized from total RNA isolated from acclimated high temperature stressed tomato leaf tissue (4 h), cloned into Sma I linearized pUC19 (Thermo Scientific, USA) and confirmed by sequencing. .. The ORFs were then introduced into the pET28a vector between the Nde I and Xho I sites for recombinant protein expression.

    Article Title: Transmitted/Founder Hepatitis C Viruses Induce Cell-Type- and Genotype-Specific Differences in Innate Signaling within the Liver
    Article Snippet: Full-genome-length T/F genomic sequences were generated by single-genome amplification chemically synthesized in 4 to 5 fragments (Blue Heron, Inc.), and ligated into low-copy-number pBR322 plasmids under control of the T7 promoter, which was added to the 5′ end of the HCV genome in five overlapping fragments, and these sequences were used to enable in vitro transcription. .. T/F and pUC19 (Invitrogen) DNA plasmids were transformed into Max Efficiency Stbl2 competent cells (Invitrogen), and bacteria were plated on Luria-Bertani (LB) agar plates supplemented with ampicillin and incubated overnight at 30°C.

    Article Title: Identification of 14-α-Lanosterol Demethylase (CYP51) in Scedosporium Species
    Article Snippet: The cDNA sequences of S. apiospermum CYP51 ( SapioCYP51 ; allele type 1, CBS 11740T ) and S. cerevisiae ERG11 ( ScereERG11 ; strain S288c) were optimized for expression in S. cerevisiae by GeneArt gene synthesis and synthesized by Invitrogen. .. The genes were cloned into the EcoRI and HindIII (New England BioLabs GmbH, Frankfurt am Main, Germany) sites in pUC19 (T4 ligase; Thermo Fisher Scientific).

    Homologous Recombination:

    Article Title: Different Stress-Induced Calcium Signatures Are Reported by Aequorin-Mediated Calcium Measurements in Living Cells of Aspergillus fumigatus
    Article Snippet: The plasmid pAEQ(II) was assembled using GeneArt technology and pUC19 (both from Invitrogen). .. The plasmid comprises the aeqS gene, also (as above) fused downstream of gpdA P .

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher puc19
    Mlh1-Mlh3 displays an endonuclease activity on supercoiled DNA substrates. See “Experimental Procedures” for details. A , Mlh1-Mlh3 (100, 150, 200, 250, and 300 n m ) was incubated with linearized <t>pUC19</t> DNA, resolved, and analyzed as described under “Experimental Procedures.” Ladder , 1 kb of DNA ladder (New England Biolabs). B , comparison of the nicking activity of Mlh1-Mlh3 ( wt ) and Mlh1-mlh3-D523N ( D523N ) in the presence of 1 m m Mn2+ on supercoiled pUC19. Mlh1-Mlh3 is at 150 n m in lanes 3 and 4 . In lanes 5–9 , Mlh1-Mlh3 is at 50, 150, 200, 250, and 300 n m , respectively. In lanes 10 and 11 Mlh1-Mlh3 D523N is at 150 and 300 n m , respectively. Migration of supercoiled ( sc ) and nicked ( n ) DNA is indicated. The linear product is indicated by a black triangle. C , immunodepletion analysis of Mlh1(FLAG)-Mlh3(HA). Mlh1(FLAG)-Mlh3(HA) was incubated with either Protein A-linked mouse anti-FLAG antibodies ( anti-FLAG ) or control mouse IgG ( Control ). The immunodepleted supernatants were then assayed for endonuclease activity. D , Mlh1-Mlh3 endonuclease activity is stimulated by a variety of divalent cations. Nicking activity of Mlh1-Mlh3 (150 n m ) in the presence of 1 m m Mg2+ , Mn2+ , Zn2+ , Cd2+ , Co2+ , Ca2+ , or Ni2+ is indicated ( left ). Stimulation of the Mlh1-Mlh3 endonuclease activity in the presence of 1 m m Mn2+ by a second divalent metal ion (1 m m ) ( right ) is shown.
    Puc19, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 47 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/puc19/product/Thermo Fisher
    Average 99 stars, based on 47 article reviews
    Price from $9.99 to $1999.99
    puc19 - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Mlh1-Mlh3 displays an endonuclease activity on supercoiled DNA substrates. See “Experimental Procedures” for details. A , Mlh1-Mlh3 (100, 150, 200, 250, and 300 n m ) was incubated with linearized pUC19 DNA, resolved, and analyzed as described under “Experimental Procedures.” Ladder , 1 kb of DNA ladder (New England Biolabs). B , comparison of the nicking activity of Mlh1-Mlh3 ( wt ) and Mlh1-mlh3-D523N ( D523N ) in the presence of 1 m m Mn2+ on supercoiled pUC19. Mlh1-Mlh3 is at 150 n m in lanes 3 and 4 . In lanes 5–9 , Mlh1-Mlh3 is at 50, 150, 200, 250, and 300 n m , respectively. In lanes 10 and 11 Mlh1-Mlh3 D523N is at 150 and 300 n m , respectively. Migration of supercoiled ( sc ) and nicked ( n ) DNA is indicated. The linear product is indicated by a black triangle. C , immunodepletion analysis of Mlh1(FLAG)-Mlh3(HA). Mlh1(FLAG)-Mlh3(HA) was incubated with either Protein A-linked mouse anti-FLAG antibodies ( anti-FLAG ) or control mouse IgG ( Control ). The immunodepleted supernatants were then assayed for endonuclease activity. D , Mlh1-Mlh3 endonuclease activity is stimulated by a variety of divalent cations. Nicking activity of Mlh1-Mlh3 (150 n m ) in the presence of 1 m m Mg2+ , Mn2+ , Zn2+ , Cd2+ , Co2+ , Ca2+ , or Ni2+ is indicated ( left ). Stimulation of the Mlh1-Mlh3 endonuclease activity in the presence of 1 m m Mn2+ by a second divalent metal ion (1 m m ) ( right ) is shown.

    Journal:

    Article Title: Mlh1-Mlh3, a Meiotic Crossover and DNA Mismatch Repair Factor, Is a Msh2-Msh3-stimulated Endonuclease

    doi: 10.1074/jbc.M113.534644

    Figure Lengend Snippet: Mlh1-Mlh3 displays an endonuclease activity on supercoiled DNA substrates. See “Experimental Procedures” for details. A , Mlh1-Mlh3 (100, 150, 200, 250, and 300 n m ) was incubated with linearized pUC19 DNA, resolved, and analyzed as described under “Experimental Procedures.” Ladder , 1 kb of DNA ladder (New England Biolabs). B , comparison of the nicking activity of Mlh1-Mlh3 ( wt ) and Mlh1-mlh3-D523N ( D523N ) in the presence of 1 m m Mn2+ on supercoiled pUC19. Mlh1-Mlh3 is at 150 n m in lanes 3 and 4 . In lanes 5–9 , Mlh1-Mlh3 is at 50, 150, 200, 250, and 300 n m , respectively. In lanes 10 and 11 Mlh1-Mlh3 D523N is at 150 and 300 n m , respectively. Migration of supercoiled ( sc ) and nicked ( n ) DNA is indicated. The linear product is indicated by a black triangle. C , immunodepletion analysis of Mlh1(FLAG)-Mlh3(HA). Mlh1(FLAG)-Mlh3(HA) was incubated with either Protein A-linked mouse anti-FLAG antibodies ( anti-FLAG ) or control mouse IgG ( Control ). The immunodepleted supernatants were then assayed for endonuclease activity. D , Mlh1-Mlh3 endonuclease activity is stimulated by a variety of divalent cations. Nicking activity of Mlh1-Mlh3 (150 n m ) in the presence of 1 m m Mg2+ , Mn2+ , Zn2+ , Cd2+ , Co2+ , Ca2+ , or Ni2+ is indicated ( left ). Stimulation of the Mlh1-Mlh3 endonuclease activity in the presence of 1 m m Mn2+ by a second divalent metal ion (1 m m ) ( right ) is shown.

    Article Snippet: Mlh1-Mlh3 nicking activity was assayed on supercoiled or nicked pUC19 (Thermo Scientific).

    Techniques: Activity Assay, Incubation, Migration

    Mlh1-Mlh3 endonuclease activity is unaffected by ATP. A, endonuclease activity of Mlh1-Mlh3 (120 n m ) on supercoiled ( sc ) pUC19 DNA in the presence of various concentrations of ATP. + indicates an ATP concentration of 500 μ m , and in lanes 8–10 ATP concentrations were 30, 100, 500 μ m , respectively. Mg2+ and Mn2+ are present at 1 m m as indicated. The % of supercoiled substrate that was cleaved is indicated. n , nicked. B , endonuclease assays were performed in the same reactions as in A but contained 1 m m Mg2+ (Mn2+ is not present) and 0.5 m m ATP or GTP. nt , nucleotide. C , ATPase activity of Mlh1-Mlh3 in the presence of a 10-fold excess of single-stranded ( ssDNA ) and double-stranded ( dsDNA ) oligonucleotides or supercoiled plasmid. See “Experimental Procedures” for details. D , endonuclease activity of yMlh1-Mlh3 was not stimulated by yeast RFC ( yRFC ) or yeast PCNA ( yPCNA ). Lanes are from 1–17 , left to right . In lanes 1–8 , hMlh1-Pms2 (60 n m ) was incubated with RFC (100 n m ) and PCNA (100 n m ) with and without 500 μ m ATP. In lanes 9–16 , yMlh1-Mlh3 (120 n m ) was incubated with RFC (200 n m ) and PCNA (200 n m ) as indicated with and without 500 μ m ATP. Lane 17 contains 200 n m RFC, 200 n m PCNA, and 500 μ m ATP in the absence of yMlh1-Mlh3.

    Journal:

    Article Title: Mlh1-Mlh3, a Meiotic Crossover and DNA Mismatch Repair Factor, Is a Msh2-Msh3-stimulated Endonuclease

    doi: 10.1074/jbc.M113.534644

    Figure Lengend Snippet: Mlh1-Mlh3 endonuclease activity is unaffected by ATP. A, endonuclease activity of Mlh1-Mlh3 (120 n m ) on supercoiled ( sc ) pUC19 DNA in the presence of various concentrations of ATP. + indicates an ATP concentration of 500 μ m , and in lanes 8–10 ATP concentrations were 30, 100, 500 μ m , respectively. Mg2+ and Mn2+ are present at 1 m m as indicated. The % of supercoiled substrate that was cleaved is indicated. n , nicked. B , endonuclease assays were performed in the same reactions as in A but contained 1 m m Mg2+ (Mn2+ is not present) and 0.5 m m ATP or GTP. nt , nucleotide. C , ATPase activity of Mlh1-Mlh3 in the presence of a 10-fold excess of single-stranded ( ssDNA ) and double-stranded ( dsDNA ) oligonucleotides or supercoiled plasmid. See “Experimental Procedures” for details. D , endonuclease activity of yMlh1-Mlh3 was not stimulated by yeast RFC ( yRFC ) or yeast PCNA ( yPCNA ). Lanes are from 1–17 , left to right . In lanes 1–8 , hMlh1-Pms2 (60 n m ) was incubated with RFC (100 n m ) and PCNA (100 n m ) with and without 500 μ m ATP. In lanes 9–16 , yMlh1-Mlh3 (120 n m ) was incubated with RFC (200 n m ) and PCNA (200 n m ) as indicated with and without 500 μ m ATP. Lane 17 contains 200 n m RFC, 200 n m PCNA, and 500 μ m ATP in the absence of yMlh1-Mlh3.

    Article Snippet: Mlh1-Mlh3 nicking activity was assayed on supercoiled or nicked pUC19 (Thermo Scientific).

    Techniques: Activity Assay, Concentration Assay, Plasmid Preparation, Incubation

    Fluorescence of free and bound to DNA of compounds 1–3. Comparison of fluorescence intensity of compounds 1 (circles) , 2 (squares) and 3 ( triangles) in the presence (A) or absence (B) of magnesium cations. Open symbols, fluorescence of free (unbound) 1– 3; filled symbols, fluorescence of 1–3 in complexes with pUC19 DNA (10 μM; bp). Excitation: 440 nm, fluorescence detection: 480 nm.

    Journal: PLoS ONE

    Article Title: Divalent cations are dispensable for binding to DNA of a novel positively charged olivomycin A derivative

    doi: 10.1371/journal.pone.0191923

    Figure Lengend Snippet: Fluorescence of free and bound to DNA of compounds 1–3. Comparison of fluorescence intensity of compounds 1 (circles) , 2 (squares) and 3 ( triangles) in the presence (A) or absence (B) of magnesium cations. Open symbols, fluorescence of free (unbound) 1– 3; filled symbols, fluorescence of 1–3 in complexes with pUC19 DNA (10 μM; bp). Excitation: 440 nm, fluorescence detection: 480 nm.

    Article Snippet: Compounds 1–3 were incubated with 0.2 μg of pUC19 plasmid (Thermo Fisher Scientific, USA) in BB or BB-Mg (total volume 15 μl, final DNA concentration 20 μM; bp) at 37°C for 30 min before loading the reaction mixture on a 1% agarose gel.

    Techniques: Fluorescence

    Binding of compounds 1–3 to the pUC19 plasmid DNA monitored by electrophoretic mobility in 1% agarose gel. The plasmid was incubated with the compounds at indicated concentrations (μM) in BB-Mg buffer containing 5 mM MgCl 2 (A) or BB buffer (same buffer with no MgCl 2 ) (B). Migration of the free compound is shown at the highest concentration (25 μM) for each drug (arrows). Bottom panels in A and B: electrophoresis with EtBr in the gel and in the running buffer.

    Journal: PLoS ONE

    Article Title: Divalent cations are dispensable for binding to DNA of a novel positively charged olivomycin A derivative

    doi: 10.1371/journal.pone.0191923

    Figure Lengend Snippet: Binding of compounds 1–3 to the pUC19 plasmid DNA monitored by electrophoretic mobility in 1% agarose gel. The plasmid was incubated with the compounds at indicated concentrations (μM) in BB-Mg buffer containing 5 mM MgCl 2 (A) or BB buffer (same buffer with no MgCl 2 ) (B). Migration of the free compound is shown at the highest concentration (25 μM) for each drug (arrows). Bottom panels in A and B: electrophoresis with EtBr in the gel and in the running buffer.

    Article Snippet: Compounds 1–3 were incubated with 0.2 μg of pUC19 plasmid (Thermo Fisher Scientific, USA) in BB or BB-Mg (total volume 15 μl, final DNA concentration 20 μM; bp) at 37°C for 30 min before loading the reaction mixture on a 1% agarose gel.

    Techniques: Binding Assay, Plasmid Preparation, Agarose Gel Electrophoresis, Incubation, Migration, Concentration Assay, Electrophoresis

    Intracellular UBP replication a , Structure of pACS and pINF. d X and d Y correspond to d NaM and a d 5SICS analog 22 that facilitated plasmid construction (see Methods). cloDF = origin of replication; Sm = streptomycin resistance gene; AmpR = ampicillin resistance gene; ori = ColE1 origin of replication; MCS = multiple cloning site; lacZα = β-galactosidase fragment gene. b , Overview of pINF construction. A DNA fragment containing the unnatural nucleotide was synthesized via solid phase DNA synthesis and then used to assemble synthetic pINF via circular-extension PCR 29 . X = d NaM , Y’ = d TPT3 (an analog of d 5SICS 22 ), and Y = d 5SICS (see text). Color indicates regions of homology. The doubly-nicked product was used directly to transform E. coli harboring pACS. c , The addition of d 5SICS TP and d NaM TP eliminates a growth lag of cells harboring pINF. EP=electroporation. Errors represent s.d. of the mean, n =3. d , LC-MS/MS total ion chromatogram of global nucleoside content in pINF and pUC19 recorded in Dynamic Multiple Reaction Monitoring (DMRM) mode. pINF and pUC19 (control) were propagated in E. coli in the presence or absence of unnatural triphosphates, and with or without Pt NTT2 induction. The inset shows a 100× expansion of the mass count axis in the d 5SICS region. e , Biotinylation only occurs in the presence of the UBP, the unnatural triphosphates, and transporter induction. After growth, pINF was recovered, and a 194 nt region containing the site of UBP incorporation (nt 437–630) was amplified and biotinylated. B=biotin; SA=streptavidin. The natural pUC19 control plasmid was prepared identically to pINF. 50-bp DNA ladder is shown to the left. f , Sequencing analysis demonstrates retention of the UBP. An abrupt termination in the Sanger sequencing reaction indicates the presence of UBP incorporation (site indicated with arrow).

    Journal: Nature

    Article Title: A Semi-Synthetic Organism with an Expanded Genetic Alphabet

    doi: 10.1038/nature13314

    Figure Lengend Snippet: Intracellular UBP replication a , Structure of pACS and pINF. d X and d Y correspond to d NaM and a d 5SICS analog 22 that facilitated plasmid construction (see Methods). cloDF = origin of replication; Sm = streptomycin resistance gene; AmpR = ampicillin resistance gene; ori = ColE1 origin of replication; MCS = multiple cloning site; lacZα = β-galactosidase fragment gene. b , Overview of pINF construction. A DNA fragment containing the unnatural nucleotide was synthesized via solid phase DNA synthesis and then used to assemble synthetic pINF via circular-extension PCR 29 . X = d NaM , Y’ = d TPT3 (an analog of d 5SICS 22 ), and Y = d 5SICS (see text). Color indicates regions of homology. The doubly-nicked product was used directly to transform E. coli harboring pACS. c , The addition of d 5SICS TP and d NaM TP eliminates a growth lag of cells harboring pINF. EP=electroporation. Errors represent s.d. of the mean, n =3. d , LC-MS/MS total ion chromatogram of global nucleoside content in pINF and pUC19 recorded in Dynamic Multiple Reaction Monitoring (DMRM) mode. pINF and pUC19 (control) were propagated in E. coli in the presence or absence of unnatural triphosphates, and with or without Pt NTT2 induction. The inset shows a 100× expansion of the mass count axis in the d 5SICS region. e , Biotinylation only occurs in the presence of the UBP, the unnatural triphosphates, and transporter induction. After growth, pINF was recovered, and a 194 nt region containing the site of UBP incorporation (nt 437–630) was amplified and biotinylated. B=biotin; SA=streptavidin. The natural pUC19 control plasmid was prepared identically to pINF. 50-bp DNA ladder is shown to the left. f , Sequencing analysis demonstrates retention of the UBP. An abrupt termination in the Sanger sequencing reaction indicates the presence of UBP incorporation (site indicated with arrow).

    Article Snippet: Plasmids pUC19 and pCDF-1b were obtained from Thermo Scientific and EMD Millipore, respectively.

    Techniques: Plasmid Preparation, Clone Assay, Synthesized, DNA Synthesis, Polymerase Chain Reaction, Electroporation, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Amplification, Sequencing