psci pcii  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    PscI PciI 10 U µL
    Description:
    5 A ↓C A T G T 3 3 T G T A C ↑A 5 Thermo Scientific PscI PciI restriction enzyme recognizes A CATGT sites and cuts best at 37°C in Tango buffer isoschizomers PciI See Reaction Conditions for Restriction Enzymes for a table of enzyme activity conditions for double digestion and heat inactivation for this and other restriction enzymes Thermo Scientific conventional restriction endonucleases are a large collection of high quality restriction enzymes optimized to work in one of the buffers of the Five Buffer System In addition the universal Tango buffer is provided for convenience in double digestions All of the enzymes exhibit 100 activity in the recommended buffer and reaction conditions To ensure consistent performance Thermo Scientific restriction enzyme reaction buffers contain premixed BSA which enhances the stability of many enzymes and binds contaminants that may be present in DNA preparations Features• Superior quality stringent quality control and industry leading manufacturing process• Convenient color coded Five Buffer System• Includes universal Tango buffer for double digestions• BSA premixed in reaction buffers• Wide selection of restriction endonuclease specificitiesApplications• Molecular cloning• Restriction site mapping• Genotyping• Southern blotting• Restriction fragment length polymorphism RFLP • SNPNote For methylation sensitivity refer to product specifications
    Catalog Number:
    er1871
    Price:
    None
    Applications:
    Cloning|Restriction Enzyme Cloning
    Category:
    Proteins Enzymes Peptides
    Buy from Supplier


    Structured Review

    Thermo Fisher psci pcii
    5 A ↓C A T G T 3 3 T G T A C ↑A 5 Thermo Scientific PscI PciI restriction enzyme recognizes A CATGT sites and cuts best at 37°C in Tango buffer isoschizomers PciI See Reaction Conditions for Restriction Enzymes for a table of enzyme activity conditions for double digestion and heat inactivation for this and other restriction enzymes Thermo Scientific conventional restriction endonucleases are a large collection of high quality restriction enzymes optimized to work in one of the buffers of the Five Buffer System In addition the universal Tango buffer is provided for convenience in double digestions All of the enzymes exhibit 100 activity in the recommended buffer and reaction conditions To ensure consistent performance Thermo Scientific restriction enzyme reaction buffers contain premixed BSA which enhances the stability of many enzymes and binds contaminants that may be present in DNA preparations Features• Superior quality stringent quality control and industry leading manufacturing process• Convenient color coded Five Buffer System• Includes universal Tango buffer for double digestions• BSA premixed in reaction buffers• Wide selection of restriction endonuclease specificitiesApplications• Molecular cloning• Restriction site mapping• Genotyping• Southern blotting• Restriction fragment length polymorphism RFLP • SNPNote For methylation sensitivity refer to product specifications
    https://www.bioz.com/result/psci pcii/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    psci pcii - by Bioz Stars, 2020-04
    99/100 stars

    Related Products / Commonly Used Together

    lentiviral packaging
    sfaai (asisi)

    Images

    Related Articles

    DNA Cleavage Assay:

    Article Title: Creation of a type IIS restriction endonuclease with a long recognition sequence
    Article Snippet: Paragraph title: DNA cleavage assay ... The plasmid, named pSCI, was propagated in and extracted from E. coli OneShot Top 10 (Invitrogen), linearized by cleavage with AlwNI (New England Biolabs, Ipswich, MA) and purified using standard isopropanol/acetate precipitation.

    Amplification:

    Article Title: Global inhibition with specific activation: how p53 and MYC redistribute the transcriptome in the DNA double-strand break response
    Article Snippet: The vector was digested with restriction enzymes BspE1 (NEB, R0540) and MluI (NEB, R0198) and the large fragment was ligated with AgeI- (NEB, R0552) and MluI-digested PCR products obtained from amplification of plasmid p-c-Myc-pd4-EGFP-N1 ( ) using the primers 5′-TCCGTCCGGAGCCACCATGCCCCTCAACGTTAG-3′ and 5′-ACTACACGCGTAAGATACATTGATATGAGT-3′ (for MYC-GFP) or 5′-GATCCACCGGTCGCCACC-3′ and 5′-ACTACACGCGTAAGATACATTGATATGAGT-3′ (for GFP). .. To reduce the size of the plasmids to aid lentiviral packaging, each plasmid was next digested with restriction enzyme SfaAI (ThermoFisher, ER2091) and digested with PscI (ThermoFisher, ER1871).

    Construct:

    Article Title: Global inhibition with specific activation: how p53 and MYC redistribute the transcriptome in the DNA double-strand break response
    Article Snippet: To reduce the size of the plasmids to aid lentiviral packaging, each plasmid was next digested with restriction enzyme SfaAI (ThermoFisher, ER2091) and digested with PscI (ThermoFisher, ER1871). .. A separate smaller doxycycline-inducible MYC-GFP expression plasmid was constructed for integration into hTERT-RPE1 cells.

    Article Title: Creation of a type IIS restriction endonuclease with a long recognition sequence
    Article Snippet: DNA cleavage assay To construct a DNA substrate for I-SceI and the chimeric endonucleases, two complementary oligonucleotides containing the I-SceI target site (5′-AATTCTGGTTCCGAA GCCTGTCCTGCACGC TAGGGATAACAGGGTAAT AATATATGAATCCAAACTAGAGCGGGGCTCTT GACGTTTGGCTCAAAACGTCGTGAGACAGTTTG GTCAGTTGTAAATATCTAATATTCCAATG-3′ and 5′-GATCCATTGGAATATTAGATATTTACAACTGA CCAAACTGTCTCACGACGTTTTGAGCCAAACGT CAAGAGCCCCGCTCTAGTTTGGATTCATATATT ATTACCCTGTTATCCCTA GCGT GCAGGACAGGCTTCGGAACCAG-3′; the I-SceI target site is underlined) were annealed, phosphorylated, and ligated between the EcoRI and BamHI restriction sites of pUC19 (Invitrogen). .. The plasmid, named pSCI, was propagated in and extracted from E. coli OneShot Top 10 (Invitrogen), linearized by cleavage with AlwNI (New England Biolabs, Ipswich, MA) and purified using standard isopropanol/acetate precipitation.

    Purification:

    Article Title: Creation of a type IIS restriction endonuclease with a long recognition sequence
    Article Snippet: .. The plasmid, named pSCI, was propagated in and extracted from E. coli OneShot Top 10 (Invitrogen), linearized by cleavage with AlwNI (New England Biolabs, Ipswich, MA) and purified using standard isopropanol/acetate precipitation. .. To observe cleavage of the linearized, purified pSCI substrate by the chimeric endonucleases, 400 ng (11 nM) of the plasmid DNA were incubated for 4 h under different reaction conditions.

    Polymerase Chain Reaction:

    Article Title: Global inhibition with specific activation: how p53 and MYC redistribute the transcriptome in the DNA double-strand break response
    Article Snippet: The vector was digested with restriction enzymes BspE1 (NEB, R0540) and MluI (NEB, R0198) and the large fragment was ligated with AgeI- (NEB, R0552) and MluI-digested PCR products obtained from amplification of plasmid p-c-Myc-pd4-EGFP-N1 ( ) using the primers 5′-TCCGTCCGGAGCCACCATGCCCCTCAACGTTAG-3′ and 5′-ACTACACGCGTAAGATACATTGATATGAGT-3′ (for MYC-GFP) or 5′-GATCCACCGGTCGCCACC-3′ and 5′-ACTACACGCGTAAGATACATTGATATGAGT-3′ (for GFP). .. To reduce the size of the plasmids to aid lentiviral packaging, each plasmid was next digested with restriction enzyme SfaAI (ThermoFisher, ER2091) and digested with PscI (ThermoFisher, ER1871).

    Incubation:

    Article Title: Creation of a type IIS restriction endonuclease with a long recognition sequence
    Article Snippet: The plasmid, named pSCI, was propagated in and extracted from E. coli OneShot Top 10 (Invitrogen), linearized by cleavage with AlwNI (New England Biolabs, Ipswich, MA) and purified using standard isopropanol/acetate precipitation. .. To observe cleavage of the linearized, purified pSCI substrate by the chimeric endonucleases, 400 ng (11 nM) of the plasmid DNA were incubated for 4 h under different reaction conditions.

    Expressing:

    Article Title: Global inhibition with specific activation: how p53 and MYC redistribute the transcriptome in the DNA double-strand break response
    Article Snippet: A doxycycline-inducible pTRIPZ-derived vector (GE Dharmacon, RHS4750) was used to generate a system for inducible MYC-GFP and GFP expression. .. To reduce the size of the plasmids to aid lentiviral packaging, each plasmid was next digested with restriction enzyme SfaAI (ThermoFisher, ER2091) and digested with PscI (ThermoFisher, ER1871).

    Sequencing:

    Article Title: Global inhibition with specific activation: how p53 and MYC redistribute the transcriptome in the DNA double-strand break response
    Article Snippet: To reduce the size of the plasmids to aid lentiviral packaging, each plasmid was next digested with restriction enzyme SfaAI (ThermoFisher, ER2091) and digested with PscI (ThermoFisher, ER1871). .. The MYC-GFP coding sequence was amplified from pTRIPZ-del89-c-Myc-d4EGFP using the primers 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGCCCCTCAACGTTAGCTTC-3′ and 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTCTACACATTGATCCTAGCAG-3′.

    Plasmid Preparation:

    Article Title: Global inhibition with specific activation: how p53 and MYC redistribute the transcriptome in the DNA double-strand break response
    Article Snippet: .. To reduce the size of the plasmids to aid lentiviral packaging, each plasmid was next digested with restriction enzyme SfaAI (ThermoFisher, ER2091) and digested with PscI (ThermoFisher, ER1871). .. The larger fragment was ligated with a PscI- and SfaAIdigested PCR product obtained from amplification of pTRIPZ using the primers 5′-TTTGACCTTGACATGCT- 3′ and 5′-ACTTATGCGATCGCGCCCCAGCTGGTTCT-3′, resulting in plasmids pTRIPZ-del89-c-Myc-d4EGFP and pTRIPZ-del89-d4EGFP for MYC-GFP and GFP expression, respectively.

    Article Title: Creation of a type IIS restriction endonuclease with a long recognition sequence
    Article Snippet: .. The plasmid, named pSCI, was propagated in and extracted from E. coli OneShot Top 10 (Invitrogen), linearized by cleavage with AlwNI (New England Biolabs, Ipswich, MA) and purified using standard isopropanol/acetate precipitation. .. To observe cleavage of the linearized, purified pSCI substrate by the chimeric endonucleases, 400 ng (11 nM) of the plasmid DNA were incubated for 4 h under different reaction conditions.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher psci pcii
    Psci Pcii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psci pcii/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    psci pcii - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results