Structured Review

Thermo Fisher prsetb
Proliferative responses of T lymphocyte-enriched splenocyte cultures from B. melitensis 16M-infected mice at 28 weeks postinfection. Lymphocytes were stimulated with antigen (1-μg protein concentration) for 96 h and pulsed with [ 3 H]thymidine for 18 h. Antigens: RSET, E. coli BL21 <t>(DE3)/pRSETB</t> cell lysate; RSET-BA14K, E. coli BL21 <t>(DE3)/pRS44.8;</t> 2308, B. abortus 2308 whole killed cells. Stimulation indices were calculated as described in the text. ∗, P
Prsetb, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 61 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/prsetb/product/Thermo Fisher
Average 99 stars, based on 61 article reviews
Price from $9.99 to $1999.99
prsetb - by Bioz Stars, 2020-02
99/100 stars

Images

1) Product Images from "Identification and Characterization of a 14-Kilodalton Brucella abortus Protein Reactive with Antibodies from Naturally and Experimentally Infected Hosts and T Lymphocytes from Experimentally Infected BALB/c Mice"

Article Title: Identification and Characterization of a 14-Kilodalton Brucella abortus Protein Reactive with Antibodies from Naturally and Experimentally Infected Hosts and T Lymphocytes from Experimentally Infected BALB/c Mice

Journal: Infection and Immunity

doi:

Proliferative responses of T lymphocyte-enriched splenocyte cultures from B. melitensis 16M-infected mice at 28 weeks postinfection. Lymphocytes were stimulated with antigen (1-μg protein concentration) for 96 h and pulsed with [ 3 H]thymidine for 18 h. Antigens: RSET, E. coli BL21 (DE3)/pRSETB cell lysate; RSET-BA14K, E. coli BL21 (DE3)/pRS44.8; 2308, B. abortus 2308 whole killed cells. Stimulation indices were calculated as described in the text. ∗, P
Figure Legend Snippet: Proliferative responses of T lymphocyte-enriched splenocyte cultures from B. melitensis 16M-infected mice at 28 weeks postinfection. Lymphocytes were stimulated with antigen (1-μg protein concentration) for 96 h and pulsed with [ 3 H]thymidine for 18 h. Antigens: RSET, E. coli BL21 (DE3)/pRSETB cell lysate; RSET-BA14K, E. coli BL21 (DE3)/pRS44.8; 2308, B. abortus 2308 whole killed cells. Stimulation indices were calculated as described in the text. ∗, P

Techniques Used: Infection, Mouse Assay, Protein Concentration

Related Articles

Clone Assay:

Article Title: Herpes simplex virus 2 UL13 protein kinase disrupts nuclear lamins
Article Snippet: .. The product was cloned into pRsetB (Invitrogen). .. To generate the 333-UL13-HA virus, pRsetB-UL13-HA was co-transfected into Vero cells with full-length 333 DNA using the Amaxa nucleofection system.

Article Title: Circular permutation and receptor insertion within green fluorescent proteins
Article Snippet: .. The full-length cDNA was digested with Bam HI and Eco RI, ligated, and cloned into the Bam HI and Eco RI sites of pRSETB (Invitrogen) to yield the plasmid pYFPins. .. Next, cDNAs encoding Xenopus calmodulin ( ) and the first zinc finger motif from zif268 ( ) were amplified by PCR by using primers containing 5′ Kpn I sites and 3′ Sac I sites and then digested with Kpn I and Sac I.

Article Title: Five colour variants of bright luminescent protein for real-time multicolour bioimaging
Article Snippet: .. The digested PCR fragments were gel-purified, mixed together and cloned in-frame into the BamHI/EcoRI sites of pRSETB (Invitrogen) for bacterial expression ( ). .. After screening, the linker amino acids (encoded by KpnI, – Gly–Thr–) of deletion mutants was randomized by inverse PCR techniques (nucleotide sequence NNKNNK , where N =A, G, C and T; and K =G and T) to generate 400 amino-acid combinations (1,024 nucleotide combinations; ).

Article Title: The Botrytis cinerea xylanase Xyn11A contributes to virulence with its necrotizing activity, not with its catalytic activity
Article Snippet: .. Expression of the 30-amino acids elicitor peptide in Escherichia coli and binding to tobacco protoplasts A 90-bp region of xyn11A containing the putative elicitor epitope (residues 131 to 160 in the immature Xyn11A polypeptide) was amplified by PCR using oligonucleotides ELEPI-BGL (5'-GCAGATCTACCTACGATCCCTCCTCC-3') and ELEPI-KPN (5'-GCGGTACCGTTTGTACGGGTGGTCTCG-3'), which introduced the restriction sites Bgl II and Xba I, and cloned in the corresponding sites of pRSETB (Invitrogen, http://www.invitrogen.com ) to generate the plasmid pEliX. ..

Article Title: Simultaneous Visualization of Pro-tumorigenic Src and MT1-MMP Activities with Fluorescence Resonance Energy Transfer
Article Snippet: .. The PCR products were cloned into pRSETb (Invitrogen) using Bgl II/ Hind III for bacterial expression and into pDisplay (Invitrogen) using Bgl II/ Sac II for mammalian cell expression, as shown in . .. The AHLR MT1-MMP biosensor was constructed by replacing the original substrate peptide (CPKESC NL FVLKD) in the MT1-MMP biosensor with an optimized cleavage peptide sequence (CRP AHLR DSG) flanked by GGS linker peptides.

Article Title: The Caenorhabditis elegans unc-64 Locus Encodes a Syntaxin That Interacts Genetically with Synaptobrevin
Article Snippet: .. Sequences from pTX4 coding for amino acids 1–266 were amplified by PCR using oligonucleotides TX-7 (5′-GCTCTAGAATGACTAAGGACAGATTG) and TX-8 (5′-CAAGATCTACTTCTTCCTTCGCGCCTTC) and cloned into pRSETB (Invitrogen, San Diego, CA) to create the plasmid pTX10. .. The plasmid expresses a 32-kDa fusion protein containing a six-histidine tag on the amino terminus of a 30.5- kDa cytoplasmic domain of the UNC-64 protein.

Article Title: The Elk-1 ETS-Domain Transcription Factor Contains a Mitogen-Activated Protein Kinase Targeting Motif
Article Snippet: The following plasmids were constructed for use in mammalian cell transfections. pG5E1b contains five GAL4 DNA-binding sites cloned upstream of a minimal promoter element and the firefly luciferase gene ( ). .. The expression vectors for HA-tagged ERK2 (pCMV5-HA-ERK2) and constitutively active MEK1(ΔN S218E-S222D) (pCMV-MEK-DN) ( ) were provided by M. Weber and N. Ahn, respectively. pSG424 encodes the GAL4 DNA-binding domain ( ). pAS551 (GAL4-Elk205), pAS552 (GAL4-Elk349), pAS553 (GAL4-Elk205M1), pAS554 (GAL4-Elk205M2), pAS555 (GAL4-Elk205M3), and pAS570 (GAL4-Elk205M4) were constructed by ligating the Bam HI- Xba I fragments from pAS407, pAS405, pAS548, pAS549, pAS550, and pAS564, respectively, into the same sites of pSG424. pAS571 (pCMV-GAL4), pAS572 (pCMV-GAL4-Elk205), pAS574 (pCMV-GAL4-Elk205M1), pAS575 (pCMV-GAL4-Elk205M2), pAS576 (pCMV-GAL4-Elk205M3), and pAS577 (pCMV-GAL4-Elk205M4) were constructed by ligating the Hin dIII- Xba I fragments from pSG424, pAS551, pAS553, pAS554, pAS555, and pAS570, espectively, into the same sites of pCMV5. pRSETB–Elk-1 was generated by inserting the Nco I- Hin dIII fragment from pAS278 into the same sites of pRSETB (Invitrogen). pAS383 (encoding full-length Elk-1 with a C-terminal FLAG tag) was constructed by ligating a Kpn I- Hin dIII fragment from pRSETB–Elk-1 into the same sites of pCMV5. pAS387, encoding Elk-1ΔD, was constructed by ligating the Xba I- Bam HI fragment of pAS380 into the same sites of pCMV5.

Article Title: The antagonistic roles of PDGF and integrin ?v?3 in regulating ROS production at focal adhesions
Article Snippet: .. This cytosolic ROS sensor was cloned into pRsetB (Invitrogen), and the insert was sequenced (W. M. Keck Center for Functional and Comparative Genomics, University of Illinois at Urbana-Champaign) to verify the integrity of the coding sequence. .. The plasmid has the coding sequence in-frame with six histidines (His6 -tag), and hence when expressed, the product carried an N-terminal His6 -tag to allow Ni column purification.

Article Title: Determination of hierarchical relationship of Src and Rac at subcellular locations with FRET biosensors
Article Snippet: .. Biosensor constructs for Src, Rac, and Ca2+ were cloned into pRSETB (Invitrogen) for bacteria expression and into pcDNA3.1 (Invitrogen) behind a Kozak sequence for mammalian cell expression using BamHI/EcoRI. .. The MT1-MMP biosensors were cloned into pRSETB (Invitrogen) using BglII/HindIII and into pDisplay (Invitrogen) using BglII/PstI for outer membrane expression in mammalian cells.

Article Title: Identification and Characterization of a 14-Kilodalton Brucella abortus Protein Reactive with Antibodies from Naturally and Experimentally Infected Hosts and T Lymphocytes from Experimentally Infected BALB/c Mice
Article Snippet: .. An overexpression plasmid (pRS44.8) was constructed by cloning the 1.8-kb fragment encoding BA14K into pRSETB (Invitrogen). .. This plasmid and pRSETB were independently introduced into E. coli BL21 (F− ompT r− B m− B ) (DE3) by the procedures described by Hanahan ( ).

Article Title: A Multiprotein DNA Translocation Complex Directs Intramycelial Plasmid Spreading during Streptomyces Conjugation
Article Snippet: .. The fragment was cloned as a BamHI/HindIII fragment into pRSETB (Life Technologies). .. All other genes were amplified using primers containing an NdeI site overlapping with the start codon and a BamHI site replacing the stop codon.

Article Title: Structure of the Membrane-tethering GRASP Domain Reveals a Unique PDZ Ligand Interaction That Mediates Golgi Biogenesis *
Article Snippet: GFP-ActA ( ) was cloned into GRASP55 pCS-2 ( ) using XbaI. .. To generate His-tagged GRASP55, GRASP55 was inserted into pRSETB (Invitrogen) using the EcoRI site.

Article Title: Human CDC6/Cdc18 Associates with Orc1 and Cyclin-cdk and Is Selectively Eliminated from the Nucleus at the Onset of S Phase
Article Snippet: .. Antibody against hOrc1 was raised against a recombinant His6 -tagged fragment of Orc1 from amino acids 647 to 861 created by cloning the 1.1-kb Eco RI- Hin dIII fragment of EST clone 121313 (GenBank) into pRSETB (Invitrogen). .. Antibody against hOrc2 was raised against a recombinant His6 -tagged fragment of Orc2 from amino acids 27 to 577 created by cloning the Xba I- Sac I Orc2 fragment into the Pvu II site of pRSETC.

Amplification:

Article Title: Herpes simplex virus 2 UL13 protein kinase disrupts nuclear lamins
Article Snippet: For the second fragment, the forward primer 5’- TACCCATACGACGTCCCAGACTACGCTT GAGGTCCCTTCCGCCCTCGAGC and the reverse primer 5’- GGAATTC CGTACTTGGCTCGGCACTTAAC amplified a region which included the remainder of the UL13 ORF and 1106bp of downstream UL12 sequence. .. The product was cloned into pRsetB (Invitrogen).

Article Title: Circular permutation and receptor insertion within green fluorescent proteins
Article Snippet: These two PCR products were combined and amplified with N- and C-terminal EYFP primers to yield a full-length cDNA containing the insertion. .. The full-length cDNA was digested with Bam HI and Eco RI, ligated, and cloned into the Bam HI and Eco RI sites of pRSETB (Invitrogen) to yield the plasmid pYFPins.

Article Title: Five colour variants of bright luminescent protein for real-time multicolour bioimaging
Article Snippet: The cDNAs of N-terminally deleted Nluc mutants (NlucΔN1-5 for mNG and NlucΔN1-6 for Venus) were amplified by PCR and digested with EcoRI and KpnI. .. The digested PCR fragments were gel-purified, mixed together and cloned in-frame into the BamHI/EcoRI sites of pRSETB (Invitrogen) for bacterial expression ( ).

Article Title: The Botrytis cinerea xylanase Xyn11A contributes to virulence with its necrotizing activity, not with its catalytic activity
Article Snippet: .. Expression of the 30-amino acids elicitor peptide in Escherichia coli and binding to tobacco protoplasts A 90-bp region of xyn11A containing the putative elicitor epitope (residues 131 to 160 in the immature Xyn11A polypeptide) was amplified by PCR using oligonucleotides ELEPI-BGL (5'-GCAGATCTACCTACGATCCCTCCTCC-3') and ELEPI-KPN (5'-GCGGTACCGTTTGTACGGGTGGTCTCG-3'), which introduced the restriction sites Bgl II and Xba I, and cloned in the corresponding sites of pRSETB (Invitrogen, http://www.invitrogen.com ) to generate the plasmid pEliX. ..

Article Title: Simultaneous Visualization of Pro-tumorigenic Src and MT1-MMP Activities with Fluorescence Resonance Energy Transfer
Article Snippet: The mOrange2 gene was amplified by PCR with a sense primer containing a Sac I site and the sequence for the MT1-MMP substrate peptide CPKESC NL FVLKD from proMMP-2 , and a reverse primer containing a Sac II site, a stop codon, and a Hind III site. .. The PCR products were cloned into pRSETb (Invitrogen) using Bgl II/ Hind III for bacterial expression and into pDisplay (Invitrogen) using Bgl II/ Sac II for mammalian cell expression, as shown in .

Article Title: The Caenorhabditis elegans unc-64 Locus Encodes a Syntaxin That Interacts Genetically with Synaptobrevin
Article Snippet: .. Sequences from pTX4 coding for amino acids 1–266 were amplified by PCR using oligonucleotides TX-7 (5′-GCTCTAGAATGACTAAGGACAGATTG) and TX-8 (5′-CAAGATCTACTTCTTCCTTCGCGCCTTC) and cloned into pRSETB (Invitrogen, San Diego, CA) to create the plasmid pTX10. .. The plasmid expresses a 32-kDa fusion protein containing a six-histidine tag on the amino terminus of a 30.5- kDa cytoplasmic domain of the UNC-64 protein.

Article Title: The Elk-1 ETS-Domain Transcription Factor Contains a Mitogen-Activated Protein Kinase Targeting Motif
Article Snippet: The expression vectors for HA-tagged ERK2 (pCMV5-HA-ERK2) and constitutively active MEK1(ΔN S218E-S222D) (pCMV-MEK-DN) ( ) were provided by M. Weber and N. Ahn, respectively. pSG424 encodes the GAL4 DNA-binding domain ( ). pAS551 (GAL4-Elk205), pAS552 (GAL4-Elk349), pAS553 (GAL4-Elk205M1), pAS554 (GAL4-Elk205M2), pAS555 (GAL4-Elk205M3), and pAS570 (GAL4-Elk205M4) were constructed by ligating the Bam HI- Xba I fragments from pAS407, pAS405, pAS548, pAS549, pAS550, and pAS564, respectively, into the same sites of pSG424. pAS571 (pCMV-GAL4), pAS572 (pCMV-GAL4-Elk205), pAS574 (pCMV-GAL4-Elk205M1), pAS575 (pCMV-GAL4-Elk205M2), pAS576 (pCMV-GAL4-Elk205M3), and pAS577 (pCMV-GAL4-Elk205M4) were constructed by ligating the Hin dIII- Xba I fragments from pSG424, pAS551, pAS553, pAS554, pAS555, and pAS570, espectively, into the same sites of pCMV5. pRSETB–Elk-1 was generated by inserting the Nco I- Hin dIII fragment from pAS278 into the same sites of pRSETB (Invitrogen). pAS383 (encoding full-length Elk-1 with a C-terminal FLAG tag) was constructed by ligating a Kpn I- Hin dIII fragment from pRSETB–Elk-1 into the same sites of pCMV5. pAS387, encoding Elk-1ΔD, was constructed by ligating the Xba I- Bam HI fragment of pAS380 into the same sites of pCMV5. .. Constitutively activated MEK-1 (CA-MEK1) was PCR amplified from pCMV–MEK-1 , cleaved with Eco RV, and ligated into the same site in pHAM8 (kindly provided by H. Mountain) to give pAS592 (containing a MET3 promoter-driven MEK-1 gene). pAS593 was constructed by insertion of a Bam HI- Sac I-cleaved PCR fragment amplified from pAS592 (encompassing the MET3 promoter and MEK-1 gene) into the same sites of the yeast expression vector pRS313 , which carries the HIS 3 selectable marker gene.

Article Title: A Multiprotein DNA Translocation Complex Directs Intramycelial Plasmid Spreading during Streptomyces Conjugation
Article Snippet: Heterologous expression and purification of pSVH1 proteins. spdB3-spd79 was amplified from template pSVH1 using primers Spd79upB/Spd79flaglow containing a BamHI site replacing the start codon of spdB3 and a Flag tag-encoding sequence replacing the stop codon of spd79 . .. The fragment was cloned as a BamHI/HindIII fragment into pRSETB (Life Technologies).

Positive Control:

Article Title: Identification and Characterization of a 14-Kilodalton Brucella abortus Protein Reactive with Antibodies from Naturally and Experimentally Infected Hosts and T Lymphocytes from Experimentally Infected BALB/c Mice
Article Snippet: An overexpression plasmid (pRS44.8) was constructed by cloning the 1.8-kb fragment encoding BA14K into pRSETB (Invitrogen). .. Concanavalin A (ConA) (Sigma Chemical Co.) was used as a positive control.

Construct:

Article Title: Five colour variants of bright luminescent protein for real-time multicolour bioimaging
Article Snippet: The deletion mutant libraries of mNeonGreen–Nluc and Venus–Nluc fusion constructs were generated as follows . .. The digested PCR fragments were gel-purified, mixed together and cloned in-frame into the BamHI/EcoRI sites of pRSETB (Invitrogen) for bacterial expression ( ).

Article Title: Rck2 Kinase Is a Substrate for the Osmotic Stress-Activated Mitogen-Activated Protein Kinase Hog1
Article Snippet: .. RCK2 (434–610) was constructed using pRSETB (Invitrogen) and expressed as described above. .. Glutathione S -transferase (GST) fusion proteins encoding PBS2(EE) and HOG1 were constructed using pGEX-4T (Pharmacia), expressed in E. coli DH5, and purified using glutathione-Sepharose beads (Pharmacia) in buffer B as described previously ( ).

Article Title: Simultaneous Visualization of Pro-tumorigenic Src and MT1-MMP Activities with Fluorescence Resonance Energy Transfer
Article Snippet: The PCR products were cloned into pRSETb (Invitrogen) using Bgl II/ Hind III for bacterial expression and into pDisplay (Invitrogen) using Bgl II/ Sac II for mammalian cell expression, as shown in . .. The AHLR MT1-MMP biosensor was constructed by replacing the original substrate peptide (CPKESC NL FVLKD) in the MT1-MMP biosensor with an optimized cleavage peptide sequence (CRP AHLR DSG) flanked by GGS linker peptides.

Article Title: The Elk-1 ETS-Domain Transcription Factor Contains a Mitogen-Activated Protein Kinase Targeting Motif
Article Snippet: .. The expression vectors for HA-tagged ERK2 (pCMV5-HA-ERK2) and constitutively active MEK1(ΔN S218E-S222D) (pCMV-MEK-DN) ( ) were provided by M. Weber and N. Ahn, respectively. pSG424 encodes the GAL4 DNA-binding domain ( ). pAS551 (GAL4-Elk205), pAS552 (GAL4-Elk349), pAS553 (GAL4-Elk205M1), pAS554 (GAL4-Elk205M2), pAS555 (GAL4-Elk205M3), and pAS570 (GAL4-Elk205M4) were constructed by ligating the Bam HI- Xba I fragments from pAS407, pAS405, pAS548, pAS549, pAS550, and pAS564, respectively, into the same sites of pSG424. pAS571 (pCMV-GAL4), pAS572 (pCMV-GAL4-Elk205), pAS574 (pCMV-GAL4-Elk205M1), pAS575 (pCMV-GAL4-Elk205M2), pAS576 (pCMV-GAL4-Elk205M3), and pAS577 (pCMV-GAL4-Elk205M4) were constructed by ligating the Hin dIII- Xba I fragments from pSG424, pAS551, pAS553, pAS554, pAS555, and pAS570, espectively, into the same sites of pCMV5. pRSETB–Elk-1 was generated by inserting the Nco I- Hin dIII fragment from pAS278 into the same sites of pRSETB (Invitrogen). pAS383 (encoding full-length Elk-1 with a C-terminal FLAG tag) was constructed by ligating a Kpn I- Hin dIII fragment from pRSETB–Elk-1 into the same sites of pCMV5. pAS387, encoding Elk-1ΔD, was constructed by ligating the Xba I- Bam HI fragment of pAS380 into the same sites of pCMV5. .. The following constructs were made for expressing proteins in yeast. pAS591 (encoding a TRP1 selectable marker and a fusion of the GAL4 DNA-binding domain and ERK2 [GAL-ERK2]) was constructed by insertion of an Xma I- Pst I-cleaved PCR fragment into the same sites of pAS2-1 (Clontech). pAS467 (encoding a LEU2 selectable marker and a fusion of the GAL4 activation domain and full-length Elk-1 [Elk-AD]) was constructed by insertion of an Eco RI-cleaved PCR fragment encompassing the first 90 nucleotides of Elk-1 (and introducing an Nco I site at the N terminus) and an Eco RI- Bam HI fragment from pAS278 into pGAD424 (Clontech). pAS504 (encoding a fusion of the GAL4 activation domain and Elk-1ΔD [ElkΔD-AD]) was constructed by insertion of an Nco I- Xho I fragment from pAS380 into the same sites of pAS467.

Article Title: Determination of hierarchical relationship of Src and Rac at subcellular locations with FRET biosensors
Article Snippet: .. Biosensor constructs for Src, Rac, and Ca2+ were cloned into pRSETB (Invitrogen) for bacteria expression and into pcDNA3.1 (Invitrogen) behind a Kozak sequence for mammalian cell expression using BamHI/EcoRI. .. The MT1-MMP biosensors were cloned into pRSETB (Invitrogen) using BglII/HindIII and into pDisplay (Invitrogen) using BglII/PstI for outer membrane expression in mammalian cells.

Article Title: Identification and Characterization of a 14-Kilodalton Brucella abortus Protein Reactive with Antibodies from Naturally and Experimentally Infected Hosts and T Lymphocytes from Experimentally Infected BALB/c Mice
Article Snippet: .. An overexpression plasmid (pRS44.8) was constructed by cloning the 1.8-kb fragment encoding BA14K into pRSETB (Invitrogen). .. This plasmid and pRSETB were independently introduced into E. coli BL21 (F− ompT r− B m− B ) (DE3) by the procedures described by Hanahan ( ).

Article Title: Structure of the Membrane-tethering GRASP Domain Reveals a Unique PDZ Ligand Interaction That Mediates Golgi Biogenesis *
Article Snippet: Paragraph title: Constructs ... To generate His-tagged GRASP55, GRASP55 was inserted into pRSETB (Invitrogen) using the EcoRI site.

Luciferase:

Article Title: The Elk-1 ETS-Domain Transcription Factor Contains a Mitogen-Activated Protein Kinase Targeting Motif
Article Snippet: The following plasmids were constructed for use in mammalian cell transfections. pG5E1b contains five GAL4 DNA-binding sites cloned upstream of a minimal promoter element and the firefly luciferase gene ( ). .. The expression vectors for HA-tagged ERK2 (pCMV5-HA-ERK2) and constitutively active MEK1(ΔN S218E-S222D) (pCMV-MEK-DN) ( ) were provided by M. Weber and N. Ahn, respectively. pSG424 encodes the GAL4 DNA-binding domain ( ). pAS551 (GAL4-Elk205), pAS552 (GAL4-Elk349), pAS553 (GAL4-Elk205M1), pAS554 (GAL4-Elk205M2), pAS555 (GAL4-Elk205M3), and pAS570 (GAL4-Elk205M4) were constructed by ligating the Bam HI- Xba I fragments from pAS407, pAS405, pAS548, pAS549, pAS550, and pAS564, respectively, into the same sites of pSG424. pAS571 (pCMV-GAL4), pAS572 (pCMV-GAL4-Elk205), pAS574 (pCMV-GAL4-Elk205M1), pAS575 (pCMV-GAL4-Elk205M2), pAS576 (pCMV-GAL4-Elk205M3), and pAS577 (pCMV-GAL4-Elk205M4) were constructed by ligating the Hin dIII- Xba I fragments from pSG424, pAS551, pAS553, pAS554, pAS555, and pAS570, espectively, into the same sites of pCMV5. pRSETB–Elk-1 was generated by inserting the Nco I- Hin dIII fragment from pAS278 into the same sites of pRSETB (Invitrogen). pAS383 (encoding full-length Elk-1 with a C-terminal FLAG tag) was constructed by ligating a Kpn I- Hin dIII fragment from pRSETB–Elk-1 into the same sites of pCMV5. pAS387, encoding Elk-1ΔD, was constructed by ligating the Xba I- Bam HI fragment of pAS380 into the same sites of pCMV5.

Activity Assay:

Article Title: An ATP-Binding Cassette Transporter and Two rRNA Methyltransferases Are Involved in Resistance to Avilamycin in the Producer Organism Streptomyces viridochromogenes T?57
Article Snippet: Escherichia coli XLIBlue and pBluescript SK(−) were from Stratagene (Heidelberg, Germany), and E. coli BL21(DE3)pLysS and pRSETb were from Invitrogen (Leek, The Netherlands). .. Avilamycin A was a gift from Eli Lilly, carbenicillin was from Roth (Karlsruhe, Germany), and thiostrepton was from Sigma (Deisenhofen, Germany). l -[2,3,4,5,6-3 H]phenylalanine (specific activity, 137 Ci/mmol) and S -adenosyl- l -[ methyl -3 H]methionine ([ methyl -3 H]AdoMet) (specific activity, 15 Ci/mmol) were from Amersham Life Science (Buckinghamshire, United Kingdom).

Expressing:

Article Title: Five colour variants of bright luminescent protein for real-time multicolour bioimaging
Article Snippet: .. The digested PCR fragments were gel-purified, mixed together and cloned in-frame into the BamHI/EcoRI sites of pRSETB (Invitrogen) for bacterial expression ( ). .. After screening, the linker amino acids (encoded by KpnI, – Gly–Thr–) of deletion mutants was randomized by inverse PCR techniques (nucleotide sequence NNKNNK , where N =A, G, C and T; and K =G and T) to generate 400 amino-acid combinations (1,024 nucleotide combinations; ).

Article Title: Rck2 Kinase Is a Substrate for the Osmotic Stress-Activated Mitogen-Activated Protein Kinase Hog1
Article Snippet: Paragraph title: Expression and purification of epitope-tagged proteins. ... RCK2 (434–610) was constructed using pRSETB (Invitrogen) and expressed as described above.

Article Title: The Botrytis cinerea xylanase Xyn11A contributes to virulence with its necrotizing activity, not with its catalytic activity
Article Snippet: .. Expression of the 30-amino acids elicitor peptide in Escherichia coli and binding to tobacco protoplasts A 90-bp region of xyn11A containing the putative elicitor epitope (residues 131 to 160 in the immature Xyn11A polypeptide) was amplified by PCR using oligonucleotides ELEPI-BGL (5'-GCAGATCTACCTACGATCCCTCCTCC-3') and ELEPI-KPN (5'-GCGGTACCGTTTGTACGGGTGGTCTCG-3'), which introduced the restriction sites Bgl II and Xba I, and cloned in the corresponding sites of pRSETB (Invitrogen, http://www.invitrogen.com ) to generate the plasmid pEliX. ..

Article Title: Simultaneous Visualization of Pro-tumorigenic Src and MT1-MMP Activities with Fluorescence Resonance Energy Transfer
Article Snippet: .. The PCR products were cloned into pRSETb (Invitrogen) using Bgl II/ Hind III for bacterial expression and into pDisplay (Invitrogen) using Bgl II/ Sac II for mammalian cell expression, as shown in . .. The AHLR MT1-MMP biosensor was constructed by replacing the original substrate peptide (CPKESC NL FVLKD) in the MT1-MMP biosensor with an optimized cleavage peptide sequence (CRP AHLR DSG) flanked by GGS linker peptides.

Article Title: The Elk-1 ETS-Domain Transcription Factor Contains a Mitogen-Activated Protein Kinase Targeting Motif
Article Snippet: .. The expression vectors for HA-tagged ERK2 (pCMV5-HA-ERK2) and constitutively active MEK1(ΔN S218E-S222D) (pCMV-MEK-DN) ( ) were provided by M. Weber and N. Ahn, respectively. pSG424 encodes the GAL4 DNA-binding domain ( ). pAS551 (GAL4-Elk205), pAS552 (GAL4-Elk349), pAS553 (GAL4-Elk205M1), pAS554 (GAL4-Elk205M2), pAS555 (GAL4-Elk205M3), and pAS570 (GAL4-Elk205M4) were constructed by ligating the Bam HI- Xba I fragments from pAS407, pAS405, pAS548, pAS549, pAS550, and pAS564, respectively, into the same sites of pSG424. pAS571 (pCMV-GAL4), pAS572 (pCMV-GAL4-Elk205), pAS574 (pCMV-GAL4-Elk205M1), pAS575 (pCMV-GAL4-Elk205M2), pAS576 (pCMV-GAL4-Elk205M3), and pAS577 (pCMV-GAL4-Elk205M4) were constructed by ligating the Hin dIII- Xba I fragments from pSG424, pAS551, pAS553, pAS554, pAS555, and pAS570, espectively, into the same sites of pCMV5. pRSETB–Elk-1 was generated by inserting the Nco I- Hin dIII fragment from pAS278 into the same sites of pRSETB (Invitrogen). pAS383 (encoding full-length Elk-1 with a C-terminal FLAG tag) was constructed by ligating a Kpn I- Hin dIII fragment from pRSETB–Elk-1 into the same sites of pCMV5. pAS387, encoding Elk-1ΔD, was constructed by ligating the Xba I- Bam HI fragment of pAS380 into the same sites of pCMV5. .. The following constructs were made for expressing proteins in yeast. pAS591 (encoding a TRP1 selectable marker and a fusion of the GAL4 DNA-binding domain and ERK2 [GAL-ERK2]) was constructed by insertion of an Xma I- Pst I-cleaved PCR fragment into the same sites of pAS2-1 (Clontech). pAS467 (encoding a LEU2 selectable marker and a fusion of the GAL4 activation domain and full-length Elk-1 [Elk-AD]) was constructed by insertion of an Eco RI-cleaved PCR fragment encompassing the first 90 nucleotides of Elk-1 (and introducing an Nco I site at the N terminus) and an Eco RI- Bam HI fragment from pAS278 into pGAD424 (Clontech). pAS504 (encoding a fusion of the GAL4 activation domain and Elk-1ΔD [ElkΔD-AD]) was constructed by insertion of an Nco I- Xho I fragment from pAS380 into the same sites of pAS467.

Article Title: The antagonistic roles of PDGF and integrin ?v?3 in regulating ROS production at focal adhesions
Article Snippet: This cytosolic ROS sensor was cloned into pRsetB (Invitrogen), and the insert was sequenced (W. M. Keck Center for Functional and Comparative Genomics, University of Illinois at Urbana-Champaign) to verify the integrity of the coding sequence. .. The DNA insert was then digested by BamHI/EcoRI and ligated into a pcDNA3 vector (Invitrogen) to create the resultant ROS sensor for mammalian cell expression ( ).

Article Title: Determination of hierarchical relationship of Src and Rac at subcellular locations with FRET biosensors
Article Snippet: .. Biosensor constructs for Src, Rac, and Ca2+ were cloned into pRSETB (Invitrogen) for bacteria expression and into pcDNA3.1 (Invitrogen) behind a Kozak sequence for mammalian cell expression using BamHI/EcoRI. .. The MT1-MMP biosensors were cloned into pRSETB (Invitrogen) using BglII/HindIII and into pDisplay (Invitrogen) using BglII/PstI for outer membrane expression in mammalian cells.

Article Title: Identification and Characterization of a 14-Kilodalton Brucella abortus Protein Reactive with Antibodies from Naturally and Experimentally Infected Hosts and T Lymphocytes from Experimentally Infected BALB/c Mice
Article Snippet: A commercial T7 polymerase-based expression system (RSET; Invitrogen, San Diego, Calif.) was used for enhanced production of BA14K in recombinant E. coli . .. An overexpression plasmid (pRS44.8) was constructed by cloning the 1.8-kb fragment encoding BA14K into pRSETB (Invitrogen).

Article Title: A Multiprotein DNA Translocation Complex Directs Intramycelial Plasmid Spreading during Streptomyces Conjugation
Article Snippet: Paragraph title: Heterologous expression and purification of pSVH1 proteins. ... The fragment was cloned as a BamHI/HindIII fragment into pRSETB (Life Technologies).

Modification:

Article Title: The antagonistic roles of PDGF and integrin ?v?3 in regulating ROS production at focal adhesions
Article Snippet: This cytosolic ROS sensor was cloned into pRsetB (Invitrogen), and the insert was sequenced (W. M. Keck Center for Functional and Comparative Genomics, University of Illinois at Urbana-Champaign) to verify the integrity of the coding sequence. .. The ROS sensor mutant was generated by site-specific mutations of cysteine to serine on both CEG peptides, thus resulting in its resistance to oxidative modification.

Transformation Assay:

Article Title: Identification and Characterization of a 14-Kilodalton Brucella abortus Protein Reactive with Antibodies from Naturally and Experimentally Infected Hosts and T Lymphocytes from Experimentally Infected BALB/c Mice
Article Snippet: Their spleens were aseptically removed, and lymphocyte transformation assays were performed on pooled, single-cell suspensions of T-lymphocyte-enriched splenocytes by previously described methods ( ). .. An overexpression plasmid (pRS44.8) was constructed by cloning the 1.8-kb fragment encoding BA14K into pRSETB (Invitrogen).

Over Expression:

Article Title: Identification and Characterization of a 14-Kilodalton Brucella abortus Protein Reactive with Antibodies from Naturally and Experimentally Infected Hosts and T Lymphocytes from Experimentally Infected BALB/c Mice
Article Snippet: .. An overexpression plasmid (pRS44.8) was constructed by cloning the 1.8-kb fragment encoding BA14K into pRSETB (Invitrogen). .. This plasmid and pRSETB were independently introduced into E. coli BL21 (F− ompT r− B m− B ) (DE3) by the procedures described by Hanahan ( ).

Derivative Assay:

Article Title: Determination of hierarchical relationship of Src and Rac at subcellular locations with FRET biosensors
Article Snippet: For the MT1-MMP FRET biosensors, the substrate peptide sequence CPKESC NL FVLKD connecting a N-terminal YFP variant (Citrine, cpVenus, or YPet) and a C-terminal ECFP was derived from MT1-MMP substrate-molecule, proMMP-2 ( ). .. Biosensor constructs for Src, Rac, and Ca2+ were cloned into pRSETB (Invitrogen) for bacteria expression and into pcDNA3.1 (Invitrogen) behind a Kozak sequence for mammalian cell expression using BamHI/EcoRI.

Transfection:

Article Title: Herpes simplex virus 2 UL13 protein kinase disrupts nuclear lamins
Article Snippet: The product was cloned into pRsetB (Invitrogen). .. Positive plaque isolates from two independent transfections underwent three rounds of plaque purification.

Article Title: The Elk-1 ETS-Domain Transcription Factor Contains a Mitogen-Activated Protein Kinase Targeting Motif
Article Snippet: The following plasmids were constructed for use in mammalian cell transfections. pG5E1b contains five GAL4 DNA-binding sites cloned upstream of a minimal promoter element and the firefly luciferase gene ( ). .. The expression vectors for HA-tagged ERK2 (pCMV5-HA-ERK2) and constitutively active MEK1(ΔN S218E-S222D) (pCMV-MEK-DN) ( ) were provided by M. Weber and N. Ahn, respectively. pSG424 encodes the GAL4 DNA-binding domain ( ). pAS551 (GAL4-Elk205), pAS552 (GAL4-Elk349), pAS553 (GAL4-Elk205M1), pAS554 (GAL4-Elk205M2), pAS555 (GAL4-Elk205M3), and pAS570 (GAL4-Elk205M4) were constructed by ligating the Bam HI- Xba I fragments from pAS407, pAS405, pAS548, pAS549, pAS550, and pAS564, respectively, into the same sites of pSG424. pAS571 (pCMV-GAL4), pAS572 (pCMV-GAL4-Elk205), pAS574 (pCMV-GAL4-Elk205M1), pAS575 (pCMV-GAL4-Elk205M2), pAS576 (pCMV-GAL4-Elk205M3), and pAS577 (pCMV-GAL4-Elk205M4) were constructed by ligating the Hin dIII- Xba I fragments from pSG424, pAS551, pAS553, pAS554, pAS555, and pAS570, espectively, into the same sites of pCMV5. pRSETB–Elk-1 was generated by inserting the Nco I- Hin dIII fragment from pAS278 into the same sites of pRSETB (Invitrogen). pAS383 (encoding full-length Elk-1 with a C-terminal FLAG tag) was constructed by ligating a Kpn I- Hin dIII fragment from pRSETB–Elk-1 into the same sites of pCMV5. pAS387, encoding Elk-1ΔD, was constructed by ligating the Xba I- Bam HI fragment of pAS380 into the same sites of pCMV5.

Inverse PCR:

Article Title: Five colour variants of bright luminescent protein for real-time multicolour bioimaging
Article Snippet: The digested PCR fragments were gel-purified, mixed together and cloned in-frame into the BamHI/EcoRI sites of pRSETB (Invitrogen) for bacterial expression ( ). .. After screening, the linker amino acids (encoded by KpnI, – Gly–Thr–) of deletion mutants was randomized by inverse PCR techniques (nucleotide sequence NNKNNK , where N =A, G, C and T; and K =G and T) to generate 400 amino-acid combinations (1,024 nucleotide combinations; ).

Concentration Assay:

Article Title: The Botrytis cinerea xylanase Xyn11A contributes to virulence with its necrotizing activity, not with its catalytic activity
Article Snippet: Expression of the 30-amino acids elicitor peptide in Escherichia coli and binding to tobacco protoplasts A 90-bp region of xyn11A containing the putative elicitor epitope (residues 131 to 160 in the immature Xyn11A polypeptide) was amplified by PCR using oligonucleotides ELEPI-BGL (5'-GCAGATCTACCTACGATCCCTCCTCC-3') and ELEPI-KPN (5'-GCGGTACCGTTTGTACGGGTGGTCTCG-3'), which introduced the restriction sites Bgl II and Xba I, and cloned in the corresponding sites of pRSETB (Invitrogen, http://www.invitrogen.com ) to generate the plasmid pEliX. .. Tobacco protoplasts were prepared as [ ], except that a concentration of 0.5% cellulase was used instead of 2%, and binding of the elicitor epitope-GFP fusions to them was assayed as [ ].

Infection:

Article Title: Identification and Characterization of a 14-Kilodalton Brucella abortus Protein Reactive with Antibodies from Naturally and Experimentally Infected Hosts and T Lymphocytes from Experimentally Infected BALB/c Mice
Article Snippet: Female BALB/c mice (Harlan Sprague Dawley, Indianapolis, Ind.) that were 8 to 10 weeks of age were infected with 5 × 104 CFU of B. abortus 2308, B. melitensis 16M, or B. abortus S19 via the intravenous route by previously described procedures ( , ). .. An overexpression plasmid (pRS44.8) was constructed by cloning the 1.8-kb fragment encoding BA14K into pRSETB (Invitrogen).

Generated:

Article Title: An ATP-Binding Cassette Transporter and Two rRNA Methyltransferases Are Involved in Resistance to Avilamycin in the Producer Organism Streptomyces viridochromogenes T?57
Article Snippet: Escherichia coli XLIBlue and pBluescript SK(−) were from Stratagene (Heidelberg, Germany), and E. coli BL21(DE3)pLysS and pRSETb were from Invitrogen (Leek, The Netherlands). .. Plasmids pMunI and pMunII were generated in our lab, pUWL201 ( ) was obtained from U. Wehmeier and W. Piepersberg (Wuppertal, Germany), pWHM3 ( ) was obtained from H. Decker (Aventis, Frankfurt, Germany), and pLitmus 28 was from New England Biolabs (Beverly, Mass.).

Article Title: Five colour variants of bright luminescent protein for real-time multicolour bioimaging
Article Snippet: The deletion mutant libraries of mNeonGreen–Nluc and Venus–Nluc fusion constructs were generated as follows . .. The digested PCR fragments were gel-purified, mixed together and cloned in-frame into the BamHI/EcoRI sites of pRSETB (Invitrogen) for bacterial expression ( ).

Article Title: The Botrytis cinerea xylanase Xyn11A contributes to virulence with its necrotizing activity, not with its catalytic activity
Article Snippet: Expression of the 30-amino acids elicitor peptide in Escherichia coli and binding to tobacco protoplasts A 90-bp region of xyn11A containing the putative elicitor epitope (residues 131 to 160 in the immature Xyn11A polypeptide) was amplified by PCR using oligonucleotides ELEPI-BGL (5'-GCAGATCTACCTACGATCCCTCCTCC-3') and ELEPI-KPN (5'-GCGGTACCGTTTGTACGGGTGGTCTCG-3'), which introduced the restriction sites Bgl II and Xba I, and cloned in the corresponding sites of pRSETB (Invitrogen, http://www.invitrogen.com ) to generate the plasmid pEliX. .. The mgfp4 gene [ ] was then amplified from the nos-GFP cassette [ ] with either primer pairs GFP-BAM (5'-GCGGATCCGATGAGTAAAGGAGAAGAAC-3') and GFP-KPN (5'-GCGGTACCATGAGTAAAGGAGAAGAAC-3'), or GFP-BGL (5'-GCAGATCTGTATAGTTCATCCATGCC-3') and GFP-ECO (5'-GCGAATTCGCTTGACTCTAGCTTATTTG-3'), which introduced the restriction sites BamH I, Kpn I, Bgl II or EcoR I as indicated, for cloning into the corresponding sites of pEliX, so that two plasmids were generated, pGFPEliX and pEliXGFP, to direct the expression of the elicitor epitope in E. coli fused to either the carboxy or the amino terminus of GFP and to the poly-His tag.

Article Title: The Elk-1 ETS-Domain Transcription Factor Contains a Mitogen-Activated Protein Kinase Targeting Motif
Article Snippet: .. The expression vectors for HA-tagged ERK2 (pCMV5-HA-ERK2) and constitutively active MEK1(ΔN S218E-S222D) (pCMV-MEK-DN) ( ) were provided by M. Weber and N. Ahn, respectively. pSG424 encodes the GAL4 DNA-binding domain ( ). pAS551 (GAL4-Elk205), pAS552 (GAL4-Elk349), pAS553 (GAL4-Elk205M1), pAS554 (GAL4-Elk205M2), pAS555 (GAL4-Elk205M3), and pAS570 (GAL4-Elk205M4) were constructed by ligating the Bam HI- Xba I fragments from pAS407, pAS405, pAS548, pAS549, pAS550, and pAS564, respectively, into the same sites of pSG424. pAS571 (pCMV-GAL4), pAS572 (pCMV-GAL4-Elk205), pAS574 (pCMV-GAL4-Elk205M1), pAS575 (pCMV-GAL4-Elk205M2), pAS576 (pCMV-GAL4-Elk205M3), and pAS577 (pCMV-GAL4-Elk205M4) were constructed by ligating the Hin dIII- Xba I fragments from pSG424, pAS551, pAS553, pAS554, pAS555, and pAS570, espectively, into the same sites of pCMV5. pRSETB–Elk-1 was generated by inserting the Nco I- Hin dIII fragment from pAS278 into the same sites of pRSETB (Invitrogen). pAS383 (encoding full-length Elk-1 with a C-terminal FLAG tag) was constructed by ligating a Kpn I- Hin dIII fragment from pRSETB–Elk-1 into the same sites of pCMV5. pAS387, encoding Elk-1ΔD, was constructed by ligating the Xba I- Bam HI fragment of pAS380 into the same sites of pCMV5. .. The following constructs were made for expressing proteins in yeast. pAS591 (encoding a TRP1 selectable marker and a fusion of the GAL4 DNA-binding domain and ERK2 [GAL-ERK2]) was constructed by insertion of an Xma I- Pst I-cleaved PCR fragment into the same sites of pAS2-1 (Clontech). pAS467 (encoding a LEU2 selectable marker and a fusion of the GAL4 activation domain and full-length Elk-1 [Elk-AD]) was constructed by insertion of an Eco RI-cleaved PCR fragment encompassing the first 90 nucleotides of Elk-1 (and introducing an Nco I site at the N terminus) and an Eco RI- Bam HI fragment from pAS278 into pGAD424 (Clontech). pAS504 (encoding a fusion of the GAL4 activation domain and Elk-1ΔD [ElkΔD-AD]) was constructed by insertion of an Nco I- Xho I fragment from pAS380 into the same sites of pAS467.

Article Title: The antagonistic roles of PDGF and integrin ?v?3 in regulating ROS production at focal adhesions
Article Snippet: This cytosolic ROS sensor was cloned into pRsetB (Invitrogen), and the insert was sequenced (W. M. Keck Center for Functional and Comparative Genomics, University of Illinois at Urbana-Champaign) to verify the integrity of the coding sequence. .. The ROS sensor mutant was generated by site-specific mutations of cysteine to serine on both CEG peptides, thus resulting in its resistance to oxidative modification.

Article Title: Determination of hierarchical relationship of Src and Rac at subcellular locations with FRET biosensors
Article Snippet: Biosensor constructs for Src, Rac, and Ca2+ were cloned into pRSETB (Invitrogen) for bacteria expression and into pcDNA3.1 (Invitrogen) behind a Kozak sequence for mammalian cell expression using BamHI/EcoRI. .. The negative (N17) or active (V12) mutant of Rac biosensors and monomerized YPet (A206K) were generated by using QuikChange Site-Directed Mutagenesis Kit (Stratagene).

Polymerase Chain Reaction:

Article Title: Herpes simplex virus 2 UL13 protein kinase disrupts nuclear lamins
Article Snippet: To create HSV-2 333 UL13-HA virus, the HSV-2 UL13 ORF was amplified by PCR from HSV-2 333 genomic DNA in two fragments. .. The product was cloned into pRsetB (Invitrogen).

Article Title: Circular permutation and receptor insertion within green fluorescent proteins
Article Snippet: These two PCR products were combined and amplified with N- and C-terminal EYFP primers to yield a full-length cDNA containing the insertion. .. The full-length cDNA was digested with Bam HI and Eco RI, ligated, and cloned into the Bam HI and Eco RI sites of pRSETB (Invitrogen) to yield the plasmid pYFPins.

Article Title: Five colour variants of bright luminescent protein for real-time multicolour bioimaging
Article Snippet: .. The digested PCR fragments were gel-purified, mixed together and cloned in-frame into the BamHI/EcoRI sites of pRSETB (Invitrogen) for bacterial expression ( ). .. After screening, the linker amino acids (encoded by KpnI, – Gly–Thr–) of deletion mutants was randomized by inverse PCR techniques (nucleotide sequence NNKNNK , where N =A, G, C and T; and K =G and T) to generate 400 amino-acid combinations (1,024 nucleotide combinations; ).

Article Title: The Botrytis cinerea xylanase Xyn11A contributes to virulence with its necrotizing activity, not with its catalytic activity
Article Snippet: .. Expression of the 30-amino acids elicitor peptide in Escherichia coli and binding to tobacco protoplasts A 90-bp region of xyn11A containing the putative elicitor epitope (residues 131 to 160 in the immature Xyn11A polypeptide) was amplified by PCR using oligonucleotides ELEPI-BGL (5'-GCAGATCTACCTACGATCCCTCCTCC-3') and ELEPI-KPN (5'-GCGGTACCGTTTGTACGGGTGGTCTCG-3'), which introduced the restriction sites Bgl II and Xba I, and cloned in the corresponding sites of pRSETB (Invitrogen, http://www.invitrogen.com ) to generate the plasmid pEliX. ..

Article Title: Simultaneous Visualization of Pro-tumorigenic Src and MT1-MMP Activities with Fluorescence Resonance Energy Transfer
Article Snippet: .. The PCR products were cloned into pRSETb (Invitrogen) using Bgl II/ Hind III for bacterial expression and into pDisplay (Invitrogen) using Bgl II/ Sac II for mammalian cell expression, as shown in . .. The AHLR MT1-MMP biosensor was constructed by replacing the original substrate peptide (CPKESC NL FVLKD) in the MT1-MMP biosensor with an optimized cleavage peptide sequence (CRP AHLR DSG) flanked by GGS linker peptides.

Article Title: The Caenorhabditis elegans unc-64 Locus Encodes a Syntaxin That Interacts Genetically with Synaptobrevin
Article Snippet: .. Sequences from pTX4 coding for amino acids 1–266 were amplified by PCR using oligonucleotides TX-7 (5′-GCTCTAGAATGACTAAGGACAGATTG) and TX-8 (5′-CAAGATCTACTTCTTCCTTCGCGCCTTC) and cloned into pRSETB (Invitrogen, San Diego, CA) to create the plasmid pTX10. .. The plasmid expresses a 32-kDa fusion protein containing a six-histidine tag on the amino terminus of a 30.5- kDa cytoplasmic domain of the UNC-64 protein.

Article Title: The Elk-1 ETS-Domain Transcription Factor Contains a Mitogen-Activated Protein Kinase Targeting Motif
Article Snippet: Mutations were introduced by a two-step PCR protocol with a mutagenic primer and two flanking primers as described previously ( ). pAS278 and pAS380 were constructed for expressing Elk-1 derivatives as hexahistidine/FLAG-tagged proteins in E. coli . pAS278 was constructed by ligating the Nco I- Bgl II fragment from pQE6/16Elk ( ) and the Bgl II- Xho I fragment from pAS276 ( ) into the Nco I and Xho I sites of pET-Hnef-PFH ( ). pAS379 was constructed by inserting a Bam HI- Xho I PCR fragment of Elk-1, encoding amino acids 322 to 428, into the same sites in pBS-SK+ . pAS380 (encoding full-length His/FLAG-tagged Elk-1 with an internal deletion of amino acids 312 to 321 (Elk-1ΔD), was constructed by ligating a Nco I- Bgl II fragment from pQE6/16Elk and a Bam HI- Xho I fragment from pAS379 into the Nco I and Xho I sites of pET-Hnef-PFH. .. The expression vectors for HA-tagged ERK2 (pCMV5-HA-ERK2) and constitutively active MEK1(ΔN S218E-S222D) (pCMV-MEK-DN) ( ) were provided by M. Weber and N. Ahn, respectively. pSG424 encodes the GAL4 DNA-binding domain ( ). pAS551 (GAL4-Elk205), pAS552 (GAL4-Elk349), pAS553 (GAL4-Elk205M1), pAS554 (GAL4-Elk205M2), pAS555 (GAL4-Elk205M3), and pAS570 (GAL4-Elk205M4) were constructed by ligating the Bam HI- Xba I fragments from pAS407, pAS405, pAS548, pAS549, pAS550, and pAS564, respectively, into the same sites of pSG424. pAS571 (pCMV-GAL4), pAS572 (pCMV-GAL4-Elk205), pAS574 (pCMV-GAL4-Elk205M1), pAS575 (pCMV-GAL4-Elk205M2), pAS576 (pCMV-GAL4-Elk205M3), and pAS577 (pCMV-GAL4-Elk205M4) were constructed by ligating the Hin dIII- Xba I fragments from pSG424, pAS551, pAS553, pAS554, pAS555, and pAS570, espectively, into the same sites of pCMV5. pRSETB–Elk-1 was generated by inserting the Nco I- Hin dIII fragment from pAS278 into the same sites of pRSETB (Invitrogen). pAS383 (encoding full-length Elk-1 with a C-terminal FLAG tag) was constructed by ligating a Kpn I- Hin dIII fragment from pRSETB–Elk-1 into the same sites of pCMV5. pAS387, encoding Elk-1ΔD, was constructed by ligating the Xba I- Bam HI fragment of pAS380 into the same sites of pCMV5.

Affinity Purification:

Article Title: The Caenorhabditis elegans unc-64 Locus Encodes a Syntaxin That Interacts Genetically with Synaptobrevin
Article Snippet: Sequences from pTX4 coding for amino acids 1–266 were amplified by PCR using oligonucleotides TX-7 (5′-GCTCTAGAATGACTAAGGACAGATTG) and TX-8 (5′-CAAGATCTACTTCTTCCTTCGCGCCTTC) and cloned into pRSETB (Invitrogen, San Diego, CA) to create the plasmid pTX10. .. UNC-64 antiserum was affinity purified using the a method described previously ( ).

Article Title: Human CDC6/Cdc18 Associates with Orc1 and Cyclin-cdk and Is Selectively Eliminated from the Nucleus at the Onset of S Phase
Article Snippet: The antibody was affinity purified on the antigen to confirm the immunoblot experiments. .. Antibody against hOrc1 was raised against a recombinant His6 -tagged fragment of Orc1 from amino acids 647 to 861 created by cloning the 1.1-kb Eco RI- Hin dIII fragment of EST clone 121313 (GenBank) into pRSETB (Invitrogen).

Binding Assay:

Article Title: The Botrytis cinerea xylanase Xyn11A contributes to virulence with its necrotizing activity, not with its catalytic activity
Article Snippet: .. Expression of the 30-amino acids elicitor peptide in Escherichia coli and binding to tobacco protoplasts A 90-bp region of xyn11A containing the putative elicitor epitope (residues 131 to 160 in the immature Xyn11A polypeptide) was amplified by PCR using oligonucleotides ELEPI-BGL (5'-GCAGATCTACCTACGATCCCTCCTCC-3') and ELEPI-KPN (5'-GCGGTACCGTTTGTACGGGTGGTCTCG-3'), which introduced the restriction sites Bgl II and Xba I, and cloned in the corresponding sites of pRSETB (Invitrogen, http://www.invitrogen.com ) to generate the plasmid pEliX. ..

Mutagenesis:

Article Title: Five colour variants of bright luminescent protein for real-time multicolour bioimaging
Article Snippet: The deletion mutant libraries of mNeonGreen–Nluc and Venus–Nluc fusion constructs were generated as follows . .. The digested PCR fragments were gel-purified, mixed together and cloned in-frame into the BamHI/EcoRI sites of pRSETB (Invitrogen) for bacterial expression ( ).

Article Title: Rck2 Kinase Is a Substrate for the Osmotic Stress-Activated Mitogen-Activated Protein Kinase Hog1
Article Snippet: His-tagged wild-type and mutant RCK2 alleles were constructed using pET-16b, expressed in E. coli BL21(DE3) cells , purified using TALON metal affinity resin (Clontech), and eluted using imidazole buffer, according to the manufacturer's instructions. .. RCK2 (434–610) was constructed using pRSETB (Invitrogen) and expressed as described above.

Article Title: The Elk-1 ETS-Domain Transcription Factor Contains a Mitogen-Activated Protein Kinase Targeting Motif
Article Snippet: The following plasmids were constructed for expressing GST fusion proteins in Escherichia coli . pAS407 (encoding GST-Elk205; Elk-1 amino acids 205 to 428), pAS545 (encoding GST-Elk310; Elk-1 amino acids 310 to 428), pAS406 (encoding GST-Elk330; Elk-1 amino acids 330 to 428), and pAS405 (encoding GST-Elk349; Elk-1 amino acids 349 to 428) were generated by inserting Bam HI- Eco RI-cleaved PCR-derived fragments into the same sites of pGEX-3X. pAS547, encoding Elk-1 amino acids 310 to 348 fused to c-Jun amino acids 55 to 223, was constructed by ligating an Eco RI-cleaved PCR fragment (encoding c-Jun amino acids 55 to 223) into the Nae I- Eco RI sites of pAS545. pAS569, encoding glutathione S -transferase (GST) fused to Elk-1 amino acids 310 to 348 and c-Jun amino acids 197 to 223 (GST-ElkD), was constructed by cleavage of pAS547 with Nae I (to remove c-Jun amino acids 55 to 197) followed by religation of the vector. pAS548, pAS549, pAS550, and pAS564 (encoding GST-Elk205 mutants) are derivatives of pAS407 with the site-directed mutations R314A/K315A (GST-Elk205M1), R317A/L319A (GST-Elk205M2), L323A/S324A (GST-Elk205M3), and L327A/L328A (GST-Elk205M4), respectively. pAS565 (GST-Elk307M2) and pAS566 (GST-Elk307M3) were constructed by cleavage of pAS549 and pAS550, respectively, with Bam HI- Bgl II (to remove DNA encoding Elk-1 amino acids 205 to 306) followed by religation of the vector. pAS567 (GST-Elk310S383A/S389A ) was constructed by PCR-mediated site-directed mutagenesis with pAS545 as a template, and pAS568 (encoding GST-Elk310M2/S383A/S389A ) was constructed with pAS567 as a template. .. The expression vectors for HA-tagged ERK2 (pCMV5-HA-ERK2) and constitutively active MEK1(ΔN S218E-S222D) (pCMV-MEK-DN) ( ) were provided by M. Weber and N. Ahn, respectively. pSG424 encodes the GAL4 DNA-binding domain ( ). pAS551 (GAL4-Elk205), pAS552 (GAL4-Elk349), pAS553 (GAL4-Elk205M1), pAS554 (GAL4-Elk205M2), pAS555 (GAL4-Elk205M3), and pAS570 (GAL4-Elk205M4) were constructed by ligating the Bam HI- Xba I fragments from pAS407, pAS405, pAS548, pAS549, pAS550, and pAS564, respectively, into the same sites of pSG424. pAS571 (pCMV-GAL4), pAS572 (pCMV-GAL4-Elk205), pAS574 (pCMV-GAL4-Elk205M1), pAS575 (pCMV-GAL4-Elk205M2), pAS576 (pCMV-GAL4-Elk205M3), and pAS577 (pCMV-GAL4-Elk205M4) were constructed by ligating the Hin dIII- Xba I fragments from pSG424, pAS551, pAS553, pAS554, pAS555, and pAS570, espectively, into the same sites of pCMV5. pRSETB–Elk-1 was generated by inserting the Nco I- Hin dIII fragment from pAS278 into the same sites of pRSETB (Invitrogen). pAS383 (encoding full-length Elk-1 with a C-terminal FLAG tag) was constructed by ligating a Kpn I- Hin dIII fragment from pRSETB–Elk-1 into the same sites of pCMV5. pAS387, encoding Elk-1ΔD, was constructed by ligating the Xba I- Bam HI fragment of pAS380 into the same sites of pCMV5.

Article Title: The antagonistic roles of PDGF and integrin ?v?3 in regulating ROS production at focal adhesions
Article Snippet: This cytosolic ROS sensor was cloned into pRsetB (Invitrogen), and the insert was sequenced (W. M. Keck Center for Functional and Comparative Genomics, University of Illinois at Urbana-Champaign) to verify the integrity of the coding sequence. .. The ROS sensor mutant was generated by site-specific mutations of cysteine to serine on both CEG peptides, thus resulting in its resistance to oxidative modification.

Article Title: Determination of hierarchical relationship of Src and Rac at subcellular locations with FRET biosensors
Article Snippet: Biosensor constructs for Src, Rac, and Ca2+ were cloned into pRSETB (Invitrogen) for bacteria expression and into pcDNA3.1 (Invitrogen) behind a Kozak sequence for mammalian cell expression using BamHI/EcoRI. .. The negative (N17) or active (V12) mutant of Rac biosensors and monomerized YPet (A206K) were generated by using QuikChange Site-Directed Mutagenesis Kit (Stratagene).

Article Title: Structure of the Membrane-tethering GRASP Domain Reveals a Unique PDZ Ligand Interaction That Mediates Golgi Biogenesis *
Article Snippet: To generate His-tagged GRASP55, GRASP55 was inserted into pRSETB (Invitrogen) using the EcoRI site. .. Two sequential rounds of mutagenesis were used for double point mutations.

Purification:

Article Title: Herpes simplex virus 2 UL13 protein kinase disrupts nuclear lamins
Article Snippet: The product was cloned into pRsetB (Invitrogen). .. Positive plaque isolates from two independent transfections underwent three rounds of plaque purification.

Article Title: Rck2 Kinase Is a Substrate for the Osmotic Stress-Activated Mitogen-Activated Protein Kinase Hog1
Article Snippet: Paragraph title: Expression and purification of epitope-tagged proteins. ... RCK2 (434–610) was constructed using pRSETB (Invitrogen) and expressed as described above.

Article Title: The antagonistic roles of PDGF and integrin ?v?3 in regulating ROS production at focal adhesions
Article Snippet: This cytosolic ROS sensor was cloned into pRsetB (Invitrogen), and the insert was sequenced (W. M. Keck Center for Functional and Comparative Genomics, University of Illinois at Urbana-Champaign) to verify the integrity of the coding sequence. .. The plasmid has the coding sequence in-frame with six histidines (His6 -tag), and hence when expressed, the product carried an N-terminal His6 -tag to allow Ni column purification.

Article Title: A Multiprotein DNA Translocation Complex Directs Intramycelial Plasmid Spreading during Streptomyces Conjugation
Article Snippet: Paragraph title: Heterologous expression and purification of pSVH1 proteins. ... The fragment was cloned as a BamHI/HindIII fragment into pRSETB (Life Technologies).

Sequencing:

Article Title: Herpes simplex virus 2 UL13 protein kinase disrupts nuclear lamins
Article Snippet: For the second fragment, the forward primer 5’- TACCCATACGACGTCCCAGACTACGCTT GAGGTCCCTTCCGCCCTCGAGC and the reverse primer 5’- GGAATTC CGTACTTGGCTCGGCACTTAAC amplified a region which included the remainder of the UL13 ORF and 1106bp of downstream UL12 sequence. .. The product was cloned into pRsetB (Invitrogen).

Article Title: Five colour variants of bright luminescent protein for real-time multicolour bioimaging
Article Snippet: The digested PCR fragments were gel-purified, mixed together and cloned in-frame into the BamHI/EcoRI sites of pRSETB (Invitrogen) for bacterial expression ( ). .. After screening, the linker amino acids (encoded by KpnI, – Gly–Thr–) of deletion mutants was randomized by inverse PCR techniques (nucleotide sequence NNKNNK , where N =A, G, C and T; and K =G and T) to generate 400 amino-acid combinations (1,024 nucleotide combinations; ).

Article Title: Simultaneous Visualization of Pro-tumorigenic Src and MT1-MMP Activities with Fluorescence Resonance Energy Transfer
Article Snippet: The mOrange2 gene was amplified by PCR with a sense primer containing a Sac I site and the sequence for the MT1-MMP substrate peptide CPKESC NL FVLKD from proMMP-2 , and a reverse primer containing a Sac II site, a stop codon, and a Hind III site. .. The PCR products were cloned into pRSETb (Invitrogen) using Bgl II/ Hind III for bacterial expression and into pDisplay (Invitrogen) using Bgl II/ Sac II for mammalian cell expression, as shown in .

Article Title: The Elk-1 ETS-Domain Transcription Factor Contains a Mitogen-Activated Protein Kinase Targeting Motif
Article Snippet: The expression vectors for HA-tagged ERK2 (pCMV5-HA-ERK2) and constitutively active MEK1(ΔN S218E-S222D) (pCMV-MEK-DN) ( ) were provided by M. Weber and N. Ahn, respectively. pSG424 encodes the GAL4 DNA-binding domain ( ). pAS551 (GAL4-Elk205), pAS552 (GAL4-Elk349), pAS553 (GAL4-Elk205M1), pAS554 (GAL4-Elk205M2), pAS555 (GAL4-Elk205M3), and pAS570 (GAL4-Elk205M4) were constructed by ligating the Bam HI- Xba I fragments from pAS407, pAS405, pAS548, pAS549, pAS550, and pAS564, respectively, into the same sites of pSG424. pAS571 (pCMV-GAL4), pAS572 (pCMV-GAL4-Elk205), pAS574 (pCMV-GAL4-Elk205M1), pAS575 (pCMV-GAL4-Elk205M2), pAS576 (pCMV-GAL4-Elk205M3), and pAS577 (pCMV-GAL4-Elk205M4) were constructed by ligating the Hin dIII- Xba I fragments from pSG424, pAS551, pAS553, pAS554, pAS555, and pAS570, espectively, into the same sites of pCMV5. pRSETB–Elk-1 was generated by inserting the Nco I- Hin dIII fragment from pAS278 into the same sites of pRSETB (Invitrogen). pAS383 (encoding full-length Elk-1 with a C-terminal FLAG tag) was constructed by ligating a Kpn I- Hin dIII fragment from pRSETB–Elk-1 into the same sites of pCMV5. pAS387, encoding Elk-1ΔD, was constructed by ligating the Xba I- Bam HI fragment of pAS380 into the same sites of pCMV5. .. All plasmid constructs encoding Elk-1-derived proteins made by PCR were verified by automated dideoxy sequencing.

Article Title: The antagonistic roles of PDGF and integrin ?v?3 in regulating ROS production at focal adhesions
Article Snippet: .. This cytosolic ROS sensor was cloned into pRsetB (Invitrogen), and the insert was sequenced (W. M. Keck Center for Functional and Comparative Genomics, University of Illinois at Urbana-Champaign) to verify the integrity of the coding sequence. .. The plasmid has the coding sequence in-frame with six histidines (His6 -tag), and hence when expressed, the product carried an N-terminal His6 -tag to allow Ni column purification.

Article Title: Determination of hierarchical relationship of Src and Rac at subcellular locations with FRET biosensors
Article Snippet: .. Biosensor constructs for Src, Rac, and Ca2+ were cloned into pRSETB (Invitrogen) for bacteria expression and into pcDNA3.1 (Invitrogen) behind a Kozak sequence for mammalian cell expression using BamHI/EcoRI. .. The MT1-MMP biosensors were cloned into pRSETB (Invitrogen) using BglII/HindIII and into pDisplay (Invitrogen) using BglII/PstI for outer membrane expression in mammalian cells.

Article Title: A Multiprotein DNA Translocation Complex Directs Intramycelial Plasmid Spreading during Streptomyces Conjugation
Article Snippet: Heterologous expression and purification of pSVH1 proteins. spdB3-spd79 was amplified from template pSVH1 using primers Spd79upB/Spd79flaglow containing a BamHI site replacing the start codon of spdB3 and a Flag tag-encoding sequence replacing the stop codon of spd79 . .. The fragment was cloned as a BamHI/HindIII fragment into pRSETB (Life Technologies).

Article Title: Structure of the Membrane-tethering GRASP Domain Reveals a Unique PDZ Ligand Interaction That Mediates Golgi Biogenesis *
Article Snippet: To generate His-tagged GRASP55, GRASP55 was inserted into pRSETB (Invitrogen) using the EcoRI site. .. For His-TEV-GRASP55 1–208, the TEV recognition sequence ENLYFQG was inserted upstream of the start codon in HisGRASP55, and a stop codon was introduced after residue 208.

Immunoprecipitation:

Article Title: Rck2 Kinase Is a Substrate for the Osmotic Stress-Activated Mitogen-Activated Protein Kinase Hog1
Article Snippet: RCK2 (434–610) was constructed using pRSETB (Invitrogen) and expressed as described above. .. HA-tagged HOG1 was expressed in yeast, and purification was carried out by immunoprecipitation with anti-HA monoclonal antibody 12CA5 and protein A-Sepharose beads (Roche).

Mouse Assay:

Article Title: Identification and Characterization of a 14-Kilodalton Brucella abortus Protein Reactive with Antibodies from Naturally and Experimentally Infected Hosts and T Lymphocytes from Experimentally Infected BALB/c Mice
Article Snippet: Between 28 and 30 weeks postinfection, five mice from each experimental group were euthanized with a halothane overdose. .. An overexpression plasmid (pRS44.8) was constructed by cloning the 1.8-kb fragment encoding BA14K into pRSETB (Invitrogen).

Plasmid Preparation:

Article Title: Circular permutation and receptor insertion within green fluorescent proteins
Article Snippet: .. The full-length cDNA was digested with Bam HI and Eco RI, ligated, and cloned into the Bam HI and Eco RI sites of pRSETB (Invitrogen) to yield the plasmid pYFPins. .. Next, cDNAs encoding Xenopus calmodulin ( ) and the first zinc finger motif from zif268 ( ) were amplified by PCR by using primers containing 5′ Kpn I sites and 3′ Sac I sites and then digested with Kpn I and Sac I.

Article Title: The Botrytis cinerea xylanase Xyn11A contributes to virulence with its necrotizing activity, not with its catalytic activity
Article Snippet: .. Expression of the 30-amino acids elicitor peptide in Escherichia coli and binding to tobacco protoplasts A 90-bp region of xyn11A containing the putative elicitor epitope (residues 131 to 160 in the immature Xyn11A polypeptide) was amplified by PCR using oligonucleotides ELEPI-BGL (5'-GCAGATCTACCTACGATCCCTCCTCC-3') and ELEPI-KPN (5'-GCGGTACCGTTTGTACGGGTGGTCTCG-3'), which introduced the restriction sites Bgl II and Xba I, and cloned in the corresponding sites of pRSETB (Invitrogen, http://www.invitrogen.com ) to generate the plasmid pEliX. ..

Article Title: The Caenorhabditis elegans unc-64 Locus Encodes a Syntaxin That Interacts Genetically with Synaptobrevin
Article Snippet: .. Sequences from pTX4 coding for amino acids 1–266 were amplified by PCR using oligonucleotides TX-7 (5′-GCTCTAGAATGACTAAGGACAGATTG) and TX-8 (5′-CAAGATCTACTTCTTCCTTCGCGCCTTC) and cloned into pRSETB (Invitrogen, San Diego, CA) to create the plasmid pTX10. .. The plasmid expresses a 32-kDa fusion protein containing a six-histidine tag on the amino terminus of a 30.5- kDa cytoplasmic domain of the UNC-64 protein.

Article Title: The Elk-1 ETS-Domain Transcription Factor Contains a Mitogen-Activated Protein Kinase Targeting Motif
Article Snippet: Paragraph title: Plasmid constructs. ... The expression vectors for HA-tagged ERK2 (pCMV5-HA-ERK2) and constitutively active MEK1(ΔN S218E-S222D) (pCMV-MEK-DN) ( ) were provided by M. Weber and N. Ahn, respectively. pSG424 encodes the GAL4 DNA-binding domain ( ). pAS551 (GAL4-Elk205), pAS552 (GAL4-Elk349), pAS553 (GAL4-Elk205M1), pAS554 (GAL4-Elk205M2), pAS555 (GAL4-Elk205M3), and pAS570 (GAL4-Elk205M4) were constructed by ligating the Bam HI- Xba I fragments from pAS407, pAS405, pAS548, pAS549, pAS550, and pAS564, respectively, into the same sites of pSG424. pAS571 (pCMV-GAL4), pAS572 (pCMV-GAL4-Elk205), pAS574 (pCMV-GAL4-Elk205M1), pAS575 (pCMV-GAL4-Elk205M2), pAS576 (pCMV-GAL4-Elk205M3), and pAS577 (pCMV-GAL4-Elk205M4) were constructed by ligating the Hin dIII- Xba I fragments from pSG424, pAS551, pAS553, pAS554, pAS555, and pAS570, espectively, into the same sites of pCMV5. pRSETB–Elk-1 was generated by inserting the Nco I- Hin dIII fragment from pAS278 into the same sites of pRSETB (Invitrogen). pAS383 (encoding full-length Elk-1 with a C-terminal FLAG tag) was constructed by ligating a Kpn I- Hin dIII fragment from pRSETB–Elk-1 into the same sites of pCMV5. pAS387, encoding Elk-1ΔD, was constructed by ligating the Xba I- Bam HI fragment of pAS380 into the same sites of pCMV5.

Article Title: The antagonistic roles of PDGF and integrin ?v?3 in regulating ROS production at focal adhesions
Article Snippet: This cytosolic ROS sensor was cloned into pRsetB (Invitrogen), and the insert was sequenced (W. M. Keck Center for Functional and Comparative Genomics, University of Illinois at Urbana-Champaign) to verify the integrity of the coding sequence. .. The plasmid has the coding sequence in-frame with six histidines (His6 -tag), and hence when expressed, the product carried an N-terminal His6 -tag to allow Ni column purification.

Article Title: Identification and Characterization of a 14-Kilodalton Brucella abortus Protein Reactive with Antibodies from Naturally and Experimentally Infected Hosts and T Lymphocytes from Experimentally Infected BALB/c Mice
Article Snippet: .. An overexpression plasmid (pRS44.8) was constructed by cloning the 1.8-kb fragment encoding BA14K into pRSETB (Invitrogen). .. This plasmid and pRSETB were independently introduced into E. coli BL21 (F− ompT r− B m− B ) (DE3) by the procedures described by Hanahan ( ).

Functional Assay:

Article Title: The antagonistic roles of PDGF and integrin ?v?3 in regulating ROS production at focal adhesions
Article Snippet: .. This cytosolic ROS sensor was cloned into pRsetB (Invitrogen), and the insert was sequenced (W. M. Keck Center for Functional and Comparative Genomics, University of Illinois at Urbana-Champaign) to verify the integrity of the coding sequence. .. The plasmid has the coding sequence in-frame with six histidines (His6 -tag), and hence when expressed, the product carried an N-terminal His6 -tag to allow Ni column purification.

Positron Emission Tomography:

Article Title: Rck2 Kinase Is a Substrate for the Osmotic Stress-Activated Mitogen-Activated Protein Kinase Hog1
Article Snippet: His-tagged wild-type and mutant RCK2 alleles were constructed using pET-16b, expressed in E. coli BL21(DE3) cells , purified using TALON metal affinity resin (Clontech), and eluted using imidazole buffer, according to the manufacturer's instructions. .. RCK2 (434–610) was constructed using pRSETB (Invitrogen) and expressed as described above.

Article Title: The Elk-1 ETS-Domain Transcription Factor Contains a Mitogen-Activated Protein Kinase Targeting Motif
Article Snippet: Mutations were introduced by a two-step PCR protocol with a mutagenic primer and two flanking primers as described previously ( ). pAS278 and pAS380 were constructed for expressing Elk-1 derivatives as hexahistidine/FLAG-tagged proteins in E. coli . pAS278 was constructed by ligating the Nco I- Bgl II fragment from pQE6/16Elk ( ) and the Bgl II- Xho I fragment from pAS276 ( ) into the Nco I and Xho I sites of pET-Hnef-PFH ( ). pAS379 was constructed by inserting a Bam HI- Xho I PCR fragment of Elk-1, encoding amino acids 322 to 428, into the same sites in pBS-SK+ . pAS380 (encoding full-length His/FLAG-tagged Elk-1 with an internal deletion of amino acids 312 to 321 (Elk-1ΔD), was constructed by ligating a Nco I- Bgl II fragment from pQE6/16Elk and a Bam HI- Xho I fragment from pAS379 into the Nco I and Xho I sites of pET-Hnef-PFH. .. The expression vectors for HA-tagged ERK2 (pCMV5-HA-ERK2) and constitutively active MEK1(ΔN S218E-S222D) (pCMV-MEK-DN) ( ) were provided by M. Weber and N. Ahn, respectively. pSG424 encodes the GAL4 DNA-binding domain ( ). pAS551 (GAL4-Elk205), pAS552 (GAL4-Elk349), pAS553 (GAL4-Elk205M1), pAS554 (GAL4-Elk205M2), pAS555 (GAL4-Elk205M3), and pAS570 (GAL4-Elk205M4) were constructed by ligating the Bam HI- Xba I fragments from pAS407, pAS405, pAS548, pAS549, pAS550, and pAS564, respectively, into the same sites of pSG424. pAS571 (pCMV-GAL4), pAS572 (pCMV-GAL4-Elk205), pAS574 (pCMV-GAL4-Elk205M1), pAS575 (pCMV-GAL4-Elk205M2), pAS576 (pCMV-GAL4-Elk205M3), and pAS577 (pCMV-GAL4-Elk205M4) were constructed by ligating the Hin dIII- Xba I fragments from pSG424, pAS551, pAS553, pAS554, pAS555, and pAS570, espectively, into the same sites of pCMV5. pRSETB–Elk-1 was generated by inserting the Nco I- Hin dIII fragment from pAS278 into the same sites of pRSETB (Invitrogen). pAS383 (encoding full-length Elk-1 with a C-terminal FLAG tag) was constructed by ligating a Kpn I- Hin dIII fragment from pRSETB–Elk-1 into the same sites of pCMV5. pAS387, encoding Elk-1ΔD, was constructed by ligating the Xba I- Bam HI fragment of pAS380 into the same sites of pCMV5.

Activation Assay:

Article Title: The Elk-1 ETS-Domain Transcription Factor Contains a Mitogen-Activated Protein Kinase Targeting Motif
Article Snippet: The expression vectors for HA-tagged ERK2 (pCMV5-HA-ERK2) and constitutively active MEK1(ΔN S218E-S222D) (pCMV-MEK-DN) ( ) were provided by M. Weber and N. Ahn, respectively. pSG424 encodes the GAL4 DNA-binding domain ( ). pAS551 (GAL4-Elk205), pAS552 (GAL4-Elk349), pAS553 (GAL4-Elk205M1), pAS554 (GAL4-Elk205M2), pAS555 (GAL4-Elk205M3), and pAS570 (GAL4-Elk205M4) were constructed by ligating the Bam HI- Xba I fragments from pAS407, pAS405, pAS548, pAS549, pAS550, and pAS564, respectively, into the same sites of pSG424. pAS571 (pCMV-GAL4), pAS572 (pCMV-GAL4-Elk205), pAS574 (pCMV-GAL4-Elk205M1), pAS575 (pCMV-GAL4-Elk205M2), pAS576 (pCMV-GAL4-Elk205M3), and pAS577 (pCMV-GAL4-Elk205M4) were constructed by ligating the Hin dIII- Xba I fragments from pSG424, pAS551, pAS553, pAS554, pAS555, and pAS570, espectively, into the same sites of pCMV5. pRSETB–Elk-1 was generated by inserting the Nco I- Hin dIII fragment from pAS278 into the same sites of pRSETB (Invitrogen). pAS383 (encoding full-length Elk-1 with a C-terminal FLAG tag) was constructed by ligating a Kpn I- Hin dIII fragment from pRSETB–Elk-1 into the same sites of pCMV5. pAS387, encoding Elk-1ΔD, was constructed by ligating the Xba I- Bam HI fragment of pAS380 into the same sites of pCMV5. .. The following constructs were made for expressing proteins in yeast. pAS591 (encoding a TRP1 selectable marker and a fusion of the GAL4 DNA-binding domain and ERK2 [GAL-ERK2]) was constructed by insertion of an Xma I- Pst I-cleaved PCR fragment into the same sites of pAS2-1 (Clontech). pAS467 (encoding a LEU2 selectable marker and a fusion of the GAL4 activation domain and full-length Elk-1 [Elk-AD]) was constructed by insertion of an Eco RI-cleaved PCR fragment encompassing the first 90 nucleotides of Elk-1 (and introducing an Nco I site at the N terminus) and an Eco RI- Bam HI fragment from pAS278 into pGAD424 (Clontech). pAS504 (encoding a fusion of the GAL4 activation domain and Elk-1ΔD [ElkΔD-AD]) was constructed by insertion of an Nco I- Xho I fragment from pAS380 into the same sites of pAS467.

FLAG-tag:

Article Title: The Elk-1 ETS-Domain Transcription Factor Contains a Mitogen-Activated Protein Kinase Targeting Motif
Article Snippet: .. The expression vectors for HA-tagged ERK2 (pCMV5-HA-ERK2) and constitutively active MEK1(ΔN S218E-S222D) (pCMV-MEK-DN) ( ) were provided by M. Weber and N. Ahn, respectively. pSG424 encodes the GAL4 DNA-binding domain ( ). pAS551 (GAL4-Elk205), pAS552 (GAL4-Elk349), pAS553 (GAL4-Elk205M1), pAS554 (GAL4-Elk205M2), pAS555 (GAL4-Elk205M3), and pAS570 (GAL4-Elk205M4) were constructed by ligating the Bam HI- Xba I fragments from pAS407, pAS405, pAS548, pAS549, pAS550, and pAS564, respectively, into the same sites of pSG424. pAS571 (pCMV-GAL4), pAS572 (pCMV-GAL4-Elk205), pAS574 (pCMV-GAL4-Elk205M1), pAS575 (pCMV-GAL4-Elk205M2), pAS576 (pCMV-GAL4-Elk205M3), and pAS577 (pCMV-GAL4-Elk205M4) were constructed by ligating the Hin dIII- Xba I fragments from pSG424, pAS551, pAS553, pAS554, pAS555, and pAS570, espectively, into the same sites of pCMV5. pRSETB–Elk-1 was generated by inserting the Nco I- Hin dIII fragment from pAS278 into the same sites of pRSETB (Invitrogen). pAS383 (encoding full-length Elk-1 with a C-terminal FLAG tag) was constructed by ligating a Kpn I- Hin dIII fragment from pRSETB–Elk-1 into the same sites of pCMV5. pAS387, encoding Elk-1ΔD, was constructed by ligating the Xba I- Bam HI fragment of pAS380 into the same sites of pCMV5. .. The following constructs were made for expressing proteins in yeast. pAS591 (encoding a TRP1 selectable marker and a fusion of the GAL4 DNA-binding domain and ERK2 [GAL-ERK2]) was constructed by insertion of an Xma I- Pst I-cleaved PCR fragment into the same sites of pAS2-1 (Clontech). pAS467 (encoding a LEU2 selectable marker and a fusion of the GAL4 activation domain and full-length Elk-1 [Elk-AD]) was constructed by insertion of an Eco RI-cleaved PCR fragment encompassing the first 90 nucleotides of Elk-1 (and introducing an Nco I site at the N terminus) and an Eco RI- Bam HI fragment from pAS278 into pGAD424 (Clontech). pAS504 (encoding a fusion of the GAL4 activation domain and Elk-1ΔD [ElkΔD-AD]) was constructed by insertion of an Nco I- Xho I fragment from pAS380 into the same sites of pAS467.

Marker:

Article Title: The Elk-1 ETS-Domain Transcription Factor Contains a Mitogen-Activated Protein Kinase Targeting Motif
Article Snippet: The expression vectors for HA-tagged ERK2 (pCMV5-HA-ERK2) and constitutively active MEK1(ΔN S218E-S222D) (pCMV-MEK-DN) ( ) were provided by M. Weber and N. Ahn, respectively. pSG424 encodes the GAL4 DNA-binding domain ( ). pAS551 (GAL4-Elk205), pAS552 (GAL4-Elk349), pAS553 (GAL4-Elk205M1), pAS554 (GAL4-Elk205M2), pAS555 (GAL4-Elk205M3), and pAS570 (GAL4-Elk205M4) were constructed by ligating the Bam HI- Xba I fragments from pAS407, pAS405, pAS548, pAS549, pAS550, and pAS564, respectively, into the same sites of pSG424. pAS571 (pCMV-GAL4), pAS572 (pCMV-GAL4-Elk205), pAS574 (pCMV-GAL4-Elk205M1), pAS575 (pCMV-GAL4-Elk205M2), pAS576 (pCMV-GAL4-Elk205M3), and pAS577 (pCMV-GAL4-Elk205M4) were constructed by ligating the Hin dIII- Xba I fragments from pSG424, pAS551, pAS553, pAS554, pAS555, and pAS570, espectively, into the same sites of pCMV5. pRSETB–Elk-1 was generated by inserting the Nco I- Hin dIII fragment from pAS278 into the same sites of pRSETB (Invitrogen). pAS383 (encoding full-length Elk-1 with a C-terminal FLAG tag) was constructed by ligating a Kpn I- Hin dIII fragment from pRSETB–Elk-1 into the same sites of pCMV5. pAS387, encoding Elk-1ΔD, was constructed by ligating the Xba I- Bam HI fragment of pAS380 into the same sites of pCMV5. .. The following constructs were made for expressing proteins in yeast. pAS591 (encoding a TRP1 selectable marker and a fusion of the GAL4 DNA-binding domain and ERK2 [GAL-ERK2]) was constructed by insertion of an Xma I- Pst I-cleaved PCR fragment into the same sites of pAS2-1 (Clontech). pAS467 (encoding a LEU2 selectable marker and a fusion of the GAL4 activation domain and full-length Elk-1 [Elk-AD]) was constructed by insertion of an Eco RI-cleaved PCR fragment encompassing the first 90 nucleotides of Elk-1 (and introducing an Nco I site at the N terminus) and an Eco RI- Bam HI fragment from pAS278 into pGAD424 (Clontech). pAS504 (encoding a fusion of the GAL4 activation domain and Elk-1ΔD [ElkΔD-AD]) was constructed by insertion of an Nco I- Xho I fragment from pAS380 into the same sites of pAS467.

Recombinant:

Article Title: Identification and Characterization of a 14-Kilodalton Brucella abortus Protein Reactive with Antibodies from Naturally and Experimentally Infected Hosts and T Lymphocytes from Experimentally Infected BALB/c Mice
Article Snippet: A commercial T7 polymerase-based expression system (RSET; Invitrogen, San Diego, Calif.) was used for enhanced production of BA14K in recombinant E. coli . .. An overexpression plasmid (pRS44.8) was constructed by cloning the 1.8-kb fragment encoding BA14K into pRSETB (Invitrogen).

Article Title: Human CDC6/Cdc18 Associates with Orc1 and Cyclin-cdk and Is Selectively Eliminated from the Nucleus at the Onset of S Phase
Article Snippet: .. Antibody against hOrc1 was raised against a recombinant His6 -tagged fragment of Orc1 from amino acids 647 to 861 created by cloning the 1.1-kb Eco RI- Hin dIII fragment of EST clone 121313 (GenBank) into pRSETB (Invitrogen). .. Antibody against hOrc2 was raised against a recombinant His6 -tagged fragment of Orc2 from amino acids 27 to 577 created by cloning the Xba I- Sac I Orc2 fragment into the Pvu II site of pRSETC.

Variant Assay:

Article Title: Determination of hierarchical relationship of Src and Rac at subcellular locations with FRET biosensors
Article Snippet: For the MT1-MMP FRET biosensors, the substrate peptide sequence CPKESC NL FVLKD connecting a N-terminal YFP variant (Citrine, cpVenus, or YPet) and a C-terminal ECFP was derived from MT1-MMP substrate-molecule, proMMP-2 ( ). .. Biosensor constructs for Src, Rac, and Ca2+ were cloned into pRSETB (Invitrogen) for bacteria expression and into pcDNA3.1 (Invitrogen) behind a Kozak sequence for mammalian cell expression using BamHI/EcoRI.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher prset a
    Prset A, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 49 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/prset a/product/Thermo Fisher
    Average 90 stars, based on 49 article reviews
    Price from $9.99 to $1999.99
    prset a - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    94
    Thermo Fisher vector prset b
    Vector Prset B, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vector prset b/product/Thermo Fisher
    Average 94 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    vector prset b - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    N/A
    The GeneArt Gene Synthesis service offers chemical synthesis cloning and sequence verification of virtually any desired genetic sequence
      Buy from Supplier

    Image Search Results