prokaryotic expression vector pgex 3x  (GE Healthcare)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Name:
    PGEX 3X
    Description:

    Catalog Number:
    28954654
    Price:
    Discontinued
    Buy from Supplier


    Structured Review

    GE Healthcare prokaryotic expression vector pgex 3x

    https://www.bioz.com/result/prokaryotic expression vector pgex 3x/product/GE Healthcare
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    prokaryotic expression vector pgex 3x - by Bioz Stars, 2021-01
    97/100 stars

    Related Products / Commonly Used Together

    pcr

    Images

    Related Articles

    Clone Assay:

    Article Title: Expression of Xhdsi-1VOC, a novel member of the vicinal oxygen chelate (VOC) metalloenzyme superfamily, is up-regulated in leaves and roots during desiccation in the resurrection plant Xerophyta humilis (Bak) Dur and Schinz
    Article Snippet: .. The amplified HC205 PCR product was cloned into pGEM®-T Easy (Promega, USA) prior to being digested with Bam HI and Eco RI restriction enzymes, purified, and cloned into the same sites in the pGEX-3X (Amersham Pharmacia Biotech, Sweden) expression vector. .. E . coli XL-1Blue transformed with the pGEX-3X:HC205 construct was grown at 37 °C in Luria broth medium containing ampicillin until the cell density reached 0.9 at OD600 .

    Amplification:

    Article Title: Expression of Xhdsi-1VOC, a novel member of the vicinal oxygen chelate (VOC) metalloenzyme superfamily, is up-regulated in leaves and roots during desiccation in the resurrection plant Xerophyta humilis (Bak) Dur and Schinz
    Article Snippet: .. The amplified HC205 PCR product was cloned into pGEM®-T Easy (Promega, USA) prior to being digested with Bam HI and Eco RI restriction enzymes, purified, and cloned into the same sites in the pGEX-3X (Amersham Pharmacia Biotech, Sweden) expression vector. .. E . coli XL-1Blue transformed with the pGEX-3X:HC205 construct was grown at 37 °C in Luria broth medium containing ampicillin until the cell density reached 0.9 at OD600 .

    Purification:

    Article Title: Expression of Xhdsi-1VOC, a novel member of the vicinal oxygen chelate (VOC) metalloenzyme superfamily, is up-regulated in leaves and roots during desiccation in the resurrection plant Xerophyta humilis (Bak) Dur and Schinz
    Article Snippet: .. The amplified HC205 PCR product was cloned into pGEM®-T Easy (Promega, USA) prior to being digested with Bam HI and Eco RI restriction enzymes, purified, and cloned into the same sites in the pGEX-3X (Amersham Pharmacia Biotech, Sweden) expression vector. .. E . coli XL-1Blue transformed with the pGEX-3X:HC205 construct was grown at 37 °C in Luria broth medium containing ampicillin until the cell density reached 0.9 at OD600 .

    Article Title: The Histidine Kinase Domain of UhpB Inhibits UhpA Action at the Escherichia coli uhpT Promoter
    Article Snippet: .. Plasmids pGEX3x-TEV, encoding GST, and pJSW141, encoding GST-Bc and its variants, were expressed in JM109 (Amersham-Pharmacia Biotech Inc.) and purified using the manufacturer's recommendations with minor modifications. ..

    other:

    Article Title: An autoimmune response to OBP1a is associated with dry eye in the Aire-deficient mouse
    Article Snippet: For pGEX-3X, primers used were: forward primer 5′ CGGGATCCGCATGGCAAAATTTCTGC and reverse primer 5′ ATAGTTTAGCGGCCGCTCATTCAGGACAGTAAT.

    Plasmid Preparation:

    Article Title: Sensitivity to Alternaria alternata toxin in citrus because of altered mitochondrial RNA processing
    Article Snippet: .. Mitochondrial DNA was then digested with 15 units of Bam HI, and the reaction was stopped by heating at 85°C for 10 min. Bam HI-digested mitochondrial DNA fragments were subcloned randomly into vector pGEX-3X (Amersham Pharmacia Biotech) and transformed into E. coli (XL1-Blue MRF′; Stratagene) cells. .. Transformed cells were placed with 1 mM of isopropyl 1-thio-β- d -galactoside (IPTG) on both LB/ampicillin plates with or without ACR-toxin (1 μg/ml).

    Article Title: Expression of Xhdsi-1VOC, a novel member of the vicinal oxygen chelate (VOC) metalloenzyme superfamily, is up-regulated in leaves and roots during desiccation in the resurrection plant Xerophyta humilis (Bak) Dur and Schinz
    Article Snippet: .. The amplified HC205 PCR product was cloned into pGEM®-T Easy (Promega, USA) prior to being digested with Bam HI and Eco RI restriction enzymes, purified, and cloned into the same sites in the pGEX-3X (Amersham Pharmacia Biotech, Sweden) expression vector. .. E . coli XL-1Blue transformed with the pGEX-3X:HC205 construct was grown at 37 °C in Luria broth medium containing ampicillin until the cell density reached 0.9 at OD600 .

    Article Title: Involvement of ITIH5, a Candidate Gene for Congenital Uterovaginal Aplasia (Mayer-Rokitansky-Küster-Hauser Syndrome), in Female Genital Tract Development
    Article Snippet: .. A cDNA fragment corresponding to amino acids 219–952 of the Itih5 protein was inserted into pGEX-3X (GE Healthcare, Saclay, France) and the resulting recombinant plasmid was used to produce a GST-fusion protein, GST-Itih5. ..

    Article Title: Interaction Maps of the Saccharomyces cerevisiae ESCRT-III Protein Snf7
    Article Snippet: .. The vector plasmid pRK1235 was derived from pGEX-3X (GE Healthcare, Freiburg, Germany) by insertion of a SalI linker into the EcoRI site. ..

    Expressing:

    Article Title: Influenza A H3N2 subtype virus NS1 protein targets into the nucleus and binds primarily via its C-terminal NLS2/NoLS to nucleolin and fibrillarin
    Article Snippet: .. Plasmids and DNA manipulations Wild type A/Udorn/72 (H3N2 virus) NS1 gene (GenBank ID: V01102) was expressed in E. coli GST (pGEX-3X; Amersham Biosciences, Buckinghamshire, U. K.) and eukaryotic pcDNA3.1(+) (Invitrogen Corp., Carlsbad, CA, USA) expression vectors. .. Wild type A/WSN/33 (H1N1 virus) NS1 gene (GenBank ID: M12597) was modified by PCR to create N- and C-terminal Bgl II sites for further cloning into the Bam HI site of the pcDNA3.1(+) expression vector (Invitrogen).

    Article Title: Expression of Xhdsi-1VOC, a novel member of the vicinal oxygen chelate (VOC) metalloenzyme superfamily, is up-regulated in leaves and roots during desiccation in the resurrection plant Xerophyta humilis (Bak) Dur and Schinz
    Article Snippet: .. The amplified HC205 PCR product was cloned into pGEM®-T Easy (Promega, USA) prior to being digested with Bam HI and Eco RI restriction enzymes, purified, and cloned into the same sites in the pGEX-3X (Amersham Pharmacia Biotech, Sweden) expression vector. .. E . coli XL-1Blue transformed with the pGEX-3X:HC205 construct was grown at 37 °C in Luria broth medium containing ampicillin until the cell density reached 0.9 at OD600 .

    Article Title: Nuclear and Nucleolar Targeting of Influenza A Virus NS1 Protein: Striking Differences between Different Virus Subtypes ▿
    Article Snippet: .. The wild-type (wt) A/Udorn/72 (H3N2 virus) NS1 gene ( ) was expressed in E. coli GST (pGEX-3X; Amersham Biosciences) and eukaryotic pcDNA3.1(+) (Invitrogen) expression vectors. .. The wt A/WSN/33 (H1N1 virus) NS1 gene ( ) was modified by PCR to create N- and C-terminal BglII sites for further cloning into the BamHI site of a pcDNA3.1(+) expression vector (Invitrogen).

    Polymerase Chain Reaction:

    Article Title: Expression of Xhdsi-1VOC, a novel member of the vicinal oxygen chelate (VOC) metalloenzyme superfamily, is up-regulated in leaves and roots during desiccation in the resurrection plant Xerophyta humilis (Bak) Dur and Schinz
    Article Snippet: .. The amplified HC205 PCR product was cloned into pGEM®-T Easy (Promega, USA) prior to being digested with Bam HI and Eco RI restriction enzymes, purified, and cloned into the same sites in the pGEX-3X (Amersham Pharmacia Biotech, Sweden) expression vector. .. E . coli XL-1Blue transformed with the pGEX-3X:HC205 construct was grown at 37 °C in Luria broth medium containing ampicillin until the cell density reached 0.9 at OD600 .

    Transformation Assay:

    Article Title: Sensitivity to Alternaria alternata toxin in citrus because of altered mitochondrial RNA processing
    Article Snippet: .. Mitochondrial DNA was then digested with 15 units of Bam HI, and the reaction was stopped by heating at 85°C for 10 min. Bam HI-digested mitochondrial DNA fragments were subcloned randomly into vector pGEX-3X (Amersham Pharmacia Biotech) and transformed into E. coli (XL1-Blue MRF′; Stratagene) cells. .. Transformed cells were placed with 1 mM of isopropyl 1-thio-β- d -galactoside (IPTG) on both LB/ampicillin plates with or without ACR-toxin (1 μg/ml).

    Recombinant:

    Article Title: Involvement of ITIH5, a Candidate Gene for Congenital Uterovaginal Aplasia (Mayer-Rokitansky-Küster-Hauser Syndrome), in Female Genital Tract Development
    Article Snippet: .. A cDNA fragment corresponding to amino acids 219–952 of the Itih5 protein was inserted into pGEX-3X (GE Healthcare, Saclay, France) and the resulting recombinant plasmid was used to produce a GST-fusion protein, GST-Itih5. ..

    Derivative Assay:

    Article Title: Interaction Maps of the Saccharomyces cerevisiae ESCRT-III Protein Snf7
    Article Snippet: .. The vector plasmid pRK1235 was derived from pGEX-3X (GE Healthcare, Freiburg, Germany) by insertion of a SalI linker into the EcoRI site. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    GE Healthcare prokaryot expression vector pgex 3x
    Prokaryot Expression Vector Pgex 3x, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/prokaryot expression vector pgex 3x/product/GE Healthcare
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    prokaryot expression vector pgex 3x - by Bioz Stars, 2021-01
    97/100 stars
      Buy from Supplier

    Image Search Results