primer u5 siv ltrs 1  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 78

    Structured Review

    Thermo Fisher primer u5 siv ltrs 1
    Map of SIV vector constructs and gag-pol expression plasmids. Viral open reading frames and intact regulatory elements are marked by white boxes. GFP, coding region for the green fluorescent protein; CMV, human cytomegalovirus immediate-early promoter. The arrows mark the primer binding sites of <t>U5</t> SIV LTRs 0 and U5 SIV LTRs 1; KpnI and DpnII restriction sites relevant for the LM-PCR are also shown (not all DpnII sites are shown).
    Primer U5 Siv Ltrs 1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer u5 siv ltrs 1/product/Thermo Fisher
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    primer u5 siv ltrs 1 - by Bioz Stars, 2020-02
    78/100 stars

    Images

    1) Product Images from "Viral Determinants of Integration Site Preferences of Simian Immunodeficiency Virus-Based Vectors"

    Article Title: Viral Determinants of Integration Site Preferences of Simian Immunodeficiency Virus-Based Vectors

    Journal: Journal of Virology

    doi: 10.1128/JVI.00373-06

    Map of SIV vector constructs and gag-pol expression plasmids. Viral open reading frames and intact regulatory elements are marked by white boxes. GFP, coding region for the green fluorescent protein; CMV, human cytomegalovirus immediate-early promoter. The arrows mark the primer binding sites of U5 SIV LTRs 0 and U5 SIV LTRs 1; KpnI and DpnII restriction sites relevant for the LM-PCR are also shown (not all DpnII sites are shown).
    Figure Legend Snippet: Map of SIV vector constructs and gag-pol expression plasmids. Viral open reading frames and intact regulatory elements are marked by white boxes. GFP, coding region for the green fluorescent protein; CMV, human cytomegalovirus immediate-early promoter. The arrows mark the primer binding sites of U5 SIV LTRs 0 and U5 SIV LTRs 1; KpnI and DpnII restriction sites relevant for the LM-PCR are also shown (not all DpnII sites are shown).

    Techniques Used: Plasmid Preparation, Construct, Expressing, Binding Assay, Polymerase Chain Reaction

    Related Articles

    Amplification:

    Article Title: Viral Determinants of Integration Site Preferences of Simian Immunodeficiency Virus-Based Vectors
    Article Snippet: KpnI digestion of the ligation reaction was used to avoid amplification of an internal vector fragment by ligation-mediated (LM)-PCR. .. Purified fragments were sequenced with primer U5 SIV LTRs 1 by Geneart (Regensburg, Germany) using standard procedures.

    Agarose Gel Electrophoresis:

    Article Title: Viral Determinants of Integration Site Preferences of Simian Immunodeficiency Virus-Based Vectors
    Article Snippet: Cycling conditions were as follows: 95°C for 2 min; 40 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 2 min; and 1 cycle at 72°C for 10 min. PCR products were separated by agarose gel electrophoresis, and the DNA bands were excised and the DNA purified with a BioGene Geneclean III kit or the freeze-and-squeeze method ( ). .. Purified fragments were sequenced with primer U5 SIV LTRs 1 by Geneart (Regensburg, Germany) using standard procedures.

    Ligation:

    Article Title: Viral Determinants of Integration Site Preferences of Simian Immunodeficiency Virus-Based Vectors
    Article Snippet: KpnI digestion of the ligation reaction was used to avoid amplification of an internal vector fragment by ligation-mediated (LM)-PCR. .. Purified fragments were sequenced with primer U5 SIV LTRs 1 by Geneart (Regensburg, Germany) using standard procedures.

    Purification:

    Article Title: Viral Determinants of Integration Site Preferences of Simian Immunodeficiency Virus-Based Vectors
    Article Snippet: .. Purified fragments were sequenced with primer U5 SIV LTRs 1 by Geneart (Regensburg, Germany) using standard procedures. .. Sequences were first viewed using Chromas 2.23 software (Technelysium Pty Ltd., Tewantin, Australia) to detect the 5′ LTR sequence and the adapter sequence.

    Polymerase Chain Reaction:

    Article Title: Viral Determinants of Integration Site Preferences of Simian Immunodeficiency Virus-Based Vectors
    Article Snippet: Cycling conditions were as follows: 95°C for 2 min; 40 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 2 min; and 1 cycle at 72°C for 10 min. PCR products were separated by agarose gel electrophoresis, and the DNA bands were excised and the DNA purified with a BioGene Geneclean III kit or the freeze-and-squeeze method ( ). .. Purified fragments were sequenced with primer U5 SIV LTRs 1 by Geneart (Regensburg, Germany) using standard procedures.

    Nested PCR:

    Article Title: Viral Determinants of Integration Site Preferences of Simian Immunodeficiency Virus-Based Vectors
    Article Snippet: A nested PCR was performed with the outer primers “adapter 1 G” (5′ GTAATACGACTCACTATAGGGC 3′) and “U5 SIV LTRs 0” (5′ CTGGTCAACTCGGTACTCAATA 3′) under the following conditions: 300 nM primer, 2 mM MgCl2 , 200 μM of each deoxynucleoside triphosphate, and 1 U Platinium Taq DNA polymerase (Invitrogen) in 1× PCR buffer. .. Purified fragments were sequenced with primer U5 SIV LTRs 1 by Geneart (Regensburg, Germany) using standard procedures.

    Plasmid Preparation:

    Article Title: Viral Determinants of Integration Site Preferences of Simian Immunodeficiency Virus-Based Vectors
    Article Snippet: KpnI digestion of the ligation reaction was used to avoid amplification of an internal vector fragment by ligation-mediated (LM)-PCR. .. Purified fragments were sequenced with primer U5 SIV LTRs 1 by Geneart (Regensburg, Germany) using standard procedures.