primer probe combination  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89

    Structured Review

    Thermo Fisher primer probe combination
    Primer Probe Combination, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer probe combination/product/Thermo Fisher
    Average 89 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    primer probe combination - by Bioz Stars, 2020-07
    89/100 stars

    Images

    Related Articles

    SYBR Green Assay:

    Article Title: Association between early promoter-specific DNA methylation changes and outcome in older acute myeloid leukemia patients
    Article Snippet: .. Methylation status of APAF1, CDH1, CDKN2A, CDKN2B, HIC1 , and RARB promoter regions of bisulfite converted DNA was quantified using SYBR Green qPCR and normalized to COL2A1 using a primer probe combination with TaqMan Universal qPCR mix (4440040, Applied Biosystems). .. Briefly, 25–50 ng of bisulfite converted DNA was combined with methylation-specific primers (500 nM) and SYBR Green mix or with probe (100 nM) and TaqMan mix in a final volume of 20 µL Primer sequences ( ) were previously published (citations in ).

    Fluorescence:

    Article Title: Simultaneous detection and differentiation of Rice black streaked dwarf virus (RBSDV) and Southern rice black streaked dwarf virus (SRBSDV) by duplex real time RT-PCR
    Article Snippet: .. For fluorescence detection, one primer–probe combination was selected from combinations proposed by the PRIMER EXPRESS software (Applied Biosystems, USA) according to the manufacturer’s instructions. .. The first primer–probe combination was designed: 1460 F: 5’- TGA AGT TTC AGA GCA CAT TCG AA -3’ (upstream Tm = 55°C), 1490 T: 5’- CGA AAG CCG TTT TCT CAG TCC TTA TGC A -3’ (TaqMan probe Tm = 70°C), and 1545R: 5’- CAC CTG GAA CTA AAG GCA AAG AA -3’ (downstream Tm = 61°C) targeting the conserved region within the positive-sense strand of RNA4 of SRBSDV (GenBank accession number FN563992.1 ).

    Methylation:

    Article Title: Association between early promoter-specific DNA methylation changes and outcome in older acute myeloid leukemia patients
    Article Snippet: .. Methylation status of APAF1, CDH1, CDKN2A, CDKN2B, HIC1 , and RARB promoter regions of bisulfite converted DNA was quantified using SYBR Green qPCR and normalized to COL2A1 using a primer probe combination with TaqMan Universal qPCR mix (4440040, Applied Biosystems). .. Briefly, 25–50 ng of bisulfite converted DNA was combined with methylation-specific primers (500 nM) and SYBR Green mix or with probe (100 nM) and TaqMan mix in a final volume of 20 µL Primer sequences ( ) were previously published (citations in ).

    Size-exclusion Chromatography:

    Article Title: Stimulating the RIG-I pathway to kill cells in the latent HIV reservoir following viral reactivation
    Article Snippet: .. Cycling conditions were 50°C for 30 min, 95°C for 5 min, and then 50 cycles of 95°C for 15 sec and 59°C for 1 min. HIV DNA copy numbers were assessed with the same primer/probe combination and the TaqMan Gene Expression Master mix (Life Technologies, Grand Island, NY). .. Results were expressed as averaged HIV-1 RNA or DNA copies per million CD4 equivalents for cellular nucleic acids and as RNA copies/ml for supernatant HIV RNA concentration.

    Quantitative RT-PCR:

    Article Title: Identification of circulating microRNAs as diagnostic biomarkers for use in multiple myeloma
    Article Snippet: .. The qRT–PCR was performed using the specific primer/probe combination provided with each TaqMan assay and TaqMan Universal PCR Master Mix, No AmpErase UNG (Life Technologies). .. For absolute quantification, synthetic miRNAs from Sigma-Aldrich (St Louis, MO, USA) were used for standards.

    Real-time Polymerase Chain Reaction:

    Article Title: Association between early promoter-specific DNA methylation changes and outcome in older acute myeloid leukemia patients
    Article Snippet: .. Methylation status of APAF1, CDH1, CDKN2A, CDKN2B, HIC1 , and RARB promoter regions of bisulfite converted DNA was quantified using SYBR Green qPCR and normalized to COL2A1 using a primer probe combination with TaqMan Universal qPCR mix (4440040, Applied Biosystems). .. Briefly, 25–50 ng of bisulfite converted DNA was combined with methylation-specific primers (500 nM) and SYBR Green mix or with probe (100 nM) and TaqMan mix in a final volume of 20 µL Primer sequences ( ) were previously published (citations in ).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Transcriptome analysis identifies novel responses and potential regulatory genes involved in seasonal dormancy transitions of leafy spurge (Euphorbia esula L.)
    Article Snippet: .. For RT-PCR of the FT -like gene, the primer-probe combination was designed by Applied Biosystems Custom Taqman(R) Gene Expression Assay Service based on sequence from the genomic clone: reverse primer GCTGGTCTTGGACTCTCATACC, forward primer GGTGACTGATATTCCAGCAACTACT, and probe TCTCTTGCCCATAGCTTG. ..

    TaqMan Assay:

    Article Title: Identification of circulating microRNAs as diagnostic biomarkers for use in multiple myeloma
    Article Snippet: .. The qRT–PCR was performed using the specific primer/probe combination provided with each TaqMan assay and TaqMan Universal PCR Master Mix, No AmpErase UNG (Life Technologies). .. For absolute quantification, synthetic miRNAs from Sigma-Aldrich (St Louis, MO, USA) were used for standards.

    Polymerase Chain Reaction:

    Article Title: Identification of circulating microRNAs as diagnostic biomarkers for use in multiple myeloma
    Article Snippet: .. The qRT–PCR was performed using the specific primer/probe combination provided with each TaqMan assay and TaqMan Universal PCR Master Mix, No AmpErase UNG (Life Technologies). .. For absolute quantification, synthetic miRNAs from Sigma-Aldrich (St Louis, MO, USA) were used for standards.

    Expressing:

    Article Title: Transcriptome analysis identifies novel responses and potential regulatory genes involved in seasonal dormancy transitions of leafy spurge (Euphorbia esula L.)
    Article Snippet: .. For RT-PCR of the FT -like gene, the primer-probe combination was designed by Applied Biosystems Custom Taqman(R) Gene Expression Assay Service based on sequence from the genomic clone: reverse primer GCTGGTCTTGGACTCTCATACC, forward primer GGTGACTGATATTCCAGCAACTACT, and probe TCTCTTGCCCATAGCTTG. ..

    Article Title: Stimulating the RIG-I pathway to kill cells in the latent HIV reservoir following viral reactivation
    Article Snippet: .. Cycling conditions were 50°C for 30 min, 95°C for 5 min, and then 50 cycles of 95°C for 15 sec and 59°C for 1 min. HIV DNA copy numbers were assessed with the same primer/probe combination and the TaqMan Gene Expression Master mix (Life Technologies, Grand Island, NY). .. Results were expressed as averaged HIV-1 RNA or DNA copies per million CD4 equivalents for cellular nucleic acids and as RNA copies/ml for supernatant HIV RNA concentration.

    Sequencing:

    Article Title: Transcriptome analysis identifies novel responses and potential regulatory genes involved in seasonal dormancy transitions of leafy spurge (Euphorbia esula L.)
    Article Snippet: .. For RT-PCR of the FT -like gene, the primer-probe combination was designed by Applied Biosystems Custom Taqman(R) Gene Expression Assay Service based on sequence from the genomic clone: reverse primer GCTGGTCTTGGACTCTCATACC, forward primer GGTGACTGATATTCCAGCAACTACT, and probe TCTCTTGCCCATAGCTTG. ..

    Variant Assay:

    Article Title: Epstein-Barr Virus Infection of Na?ve B Cells In Vitro Frequently Selects Clones with Mutated Immunoglobulin Genotypes: Implications for Virus Biology
    Article Snippet: .. A primer/probe combination to specifically detect an AID splice variant lacking exon 4 was designed using Primer Express software (Applied Biosystems). .. Immunoblotting Western blotting was carried out as described previously using mAbs to: EBNA1 (1H4), EBNA2 (PE2), LMP1 (CS1-4), BZLF1 (BZ-1).

    Software:

    Article Title: Simultaneous detection and differentiation of Rice black streaked dwarf virus (RBSDV) and Southern rice black streaked dwarf virus (SRBSDV) by duplex real time RT-PCR
    Article Snippet: .. For fluorescence detection, one primer–probe combination was selected from combinations proposed by the PRIMER EXPRESS software (Applied Biosystems, USA) according to the manufacturer’s instructions. .. The first primer–probe combination was designed: 1460 F: 5’- TGA AGT TTC AGA GCA CAT TCG AA -3’ (upstream Tm = 55°C), 1490 T: 5’- CGA AAG CCG TTT TCT CAG TCC TTA TGC A -3’ (TaqMan probe Tm = 70°C), and 1545R: 5’- CAC CTG GAA CTA AAG GCA AAG AA -3’ (downstream Tm = 61°C) targeting the conserved region within the positive-sense strand of RNA4 of SRBSDV (GenBank accession number FN563992.1 ).

    Article Title: Stat6-Dependent Inhibition of Mincle Expression in Mouse and Human Antigen-Presenting Cells by the Th2 Cytokine IL-4
    Article Snippet: .. For human MINCLE, the primer/probe combination was selected using the software PrimerExpress (Applied Biosystems). ..

    Article Title: Predicting the sensitivity and specificity of published real-time PCR assays
    Article Snippet: .. A common approach to developing a primer/probe combination is by using commercial software such as PrimerExpress® (Applied Biosystems, Foster City, CA, USA). .. This software asks the user to upload a DNA sequence file, and then finds possible primer/probe sets that meet the assay criteria.

    Article Title: Epstein-Barr Virus Infection of Na?ve B Cells In Vitro Frequently Selects Clones with Mutated Immunoglobulin Genotypes: Implications for Virus Biology
    Article Snippet: .. A primer/probe combination to specifically detect an AID splice variant lacking exon 4 was designed using Primer Express software (Applied Biosystems). .. Immunoblotting Western blotting was carried out as described previously using mAbs to: EBNA1 (1H4), EBNA2 (PE2), LMP1 (CS1-4), BZLF1 (BZ-1).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89
    Thermo Fisher primer probe combination
    Primer Probe Combination, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer probe combination/product/Thermo Fisher
    Average 89 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    primer probe combination - by Bioz Stars, 2020-07
    89/100 stars
      Buy from Supplier

    Image Search Results